Home | Community | Message Board

World Seed Supply
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   PhytoExtractum Buy Bali Kratom Powder

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinegotcha420haha
Not Available
Male User Gallery

Registered: 12/21/05
Posts: 1,217
Loc: In the woods
Last seen: 13 years, 9 months
Blotters?
    #5378429 - 03/08/06 05:44 PM (17 years, 10 months ago)

I know theres some threads going on about blotters with real LSD on them going around, but theres no way im reading all that, so i want to know about two-- one my dealer says has a smily face on it, but the smily is kinda squiggley, and the other he says has the super mario brothers on it... anyone else seen these?


--------------------
 
"Sometimes I wonder, If I know where I am going. I go for a walk and it seems like I have been walking for years and years and I don't know where I'm going. I hear the sound leading me on."


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: Blotters? [Re: gotcha420haha]
    #5378517 - 03/08/06 06:06 PM (17 years, 10 months ago)

Blotters are usually lsd. If you know who youre buying from, they should be able to tell you what your buying if they have tried it, and have any idea what they are talking about when it comes to lsd.

They sound good to me, but I wouldnt know.


Extras: Filter Print Post Top
OfflineDeathCompany
Oneironaut
Male User Gallery

Registered: 03/16/05
Posts: 12,662
Loc: Somewhere in my head
Last seen: 9 months, 29 days
Re: Blotters? [Re: stemmer]
    #5378885 - 03/08/06 07:28 PM (17 years, 10 months ago)

id have to disagree a lot of blotrers are rc's


--------------------


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: Blotters? [Re: DeathCompany]
    #5378953 - 03/08/06 07:43 PM (17 years, 10 months ago)

Well I guess it depends on who your dealing with. MOst dealers who have some respect for those who buy from them know the difference. I guess it helps to know exactly what the drug is before you buy it.

Notice that I said blotters are USUALLY lsd, which is true.

I tend to use acid that everyone knows is acid, including the dealer.
If I was asking a pool of burt out morons how good the acid was, I wouldnt be to confident in their answers.
SO ya, LSD is Usually lsd.
Also it doesnt really help much to know the print because they vary greatly. Ufo blotters can be extreemely potent good acid. In later years some really shitty ufos made their way around the US. They were still lsd though.


Edited by stemmer (03/08/06 07:44 PM)


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Blotters? [Re: stemmer]
    #5379261 - 03/08/06 08:57 PM (17 years, 10 months ago)

"Blotters are usually lsd"
"a lot of blotters are rc's"

I agree with both of these statements.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineTaco Chef
I found dead John Cheever
Male User Gallery

Registered: 03/03/06
Posts: 33,222
Loc: the city of dis
Last seen: 3 years, 7 months
Re: Blotters? [Re: Koala Koolio]
    #5379565 - 03/08/06 10:23 PM (17 years, 10 months ago)

yes make sure you are not getting a doX compound. Although a lot of fun dox's can last waaaaaaaaaaaaaaaaaaay longer than acid.

2c(x)'s also show up on blotter, great fun but nooooo where near as close as cid.

any honorable dealer should tell you
and RC blotters *shouls* always have the RC name on it IMHO, in a perfect world


--------------------





Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Blotters? [Re: Taco Chef]
    #5379601 - 03/08/06 10:32 PM (17 years, 10 months ago)

"2c(x)'s also show up on blotter, great fun but nooooo where near as close as cid."

Not really. 2c-c went around a little. But all the hits said 2cc on them, and they were huuuge. No need to get people worked up over nothing. :smile:


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Kraken Kratom Red Vein Kratom   PhytoExtractum Buy Bali Kratom Powder


Similar ThreadsPosterViewsRepliesLast post
* Non-LSD ergoloids in blotters? drr 3,352 9 08/13/14 04:38 AM
by mesjnaloar
* Interesting article on Erowid about blotter dose and purity drr 1,335 4 01/30/12 01:11 PM
by dwpineal
* 2010/2011 Blotters(Actual Acid)
( 1 2 3 all )
eloC 7,068 47 09/25/12 11:19 PM
by Mr.Mcrad
* Long rambling question about LSD blotter dosages Ballerium 7,981 9 11/10/10 06:31 PM
by Ballerium
* Aquired 12 hits of blotter last night,bitter paper
( 1 2 all )
Liquid_Dimension 5,612 35 12/07/08 07:07 AM
by LeftBehind
* Blotters: Discriminating Between LSD and RCs
( 1 2 all )
Desos 21,782 29 10/10/12 05:11 PM
by SurReality
* Blotter Paper?
( 1 2 all )
islander20 5,080 24 10/30/08 10:19 PM
by Plasmid
* Cheshire Blotter from tallahassee
( 1 2 3 all )
clemens 9,791 45 05/12/10 07:05 PM
by pistola321

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
924 topic views. 1 members, 51 guests and 7 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.024 seconds spending 0.007 seconds on 14 queries.