Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: PhytoExtractum Buy Bali Kratom Powder   Kraken Kratom Red Vein Kratom   Unfolding Nature Unfolding Nature: Being in the Implicate Order   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract   Myyco.com Golden Teacher Liquid Culture For Sale

Jump to first unread post Pages: 1 | 2 | 3 | 4 | 5 | 6  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
The Shroomery LSD Museum * 5
    #5356730 - 03/02/06 09:03 AM (18 years, 1 month ago)
Log in to view attachment

Ladies & Gentlemen, welcome to the Shroomery LSD Museum!

This thread aims to become the largest collection of photos of LSD dosage units on the web!

This is the sister thread of Recent LSD Prints in Other Drugs Discussion. If you cannot view this forum you either are a newbie - and will be able to view it soon, or have been banned from that forum, in which case you blew it.
See this thread for comments that go with many of these pics.

Feel free to browse our collections and to submit some of your own.

Rules for submission are:

1..It has to be a photo made by you or a friend of a friend and it has to represent a dosage unit they bought or recieved for usage. Blottewr art is NOT allowed, we're looking for the genuine laid articler here of what was sold or distributed as LSD.
2..Submit one or a few clear photographs that are good-sized (meaning not tiny and not huge) and remember to not say things you might regret later.
3..Do not clutter the thread with discussion, ideally most posts have to contain exhibits. This is, after all a museum thread.
4..Do not show other people's works without consent, you may however uplink to it, but never to that of non-shroomerites and especially anti-drug/governmental sites.
5..Remember that the displayed pieces are *alleged* LSD, meaning that they cannot be used for dosage identification purposes.

The works featured here are public domain (because of their previous publication on the Shroomery boards) but are linked such that their rightful owners can take them down.
Do not knowingly post copyrighted material.

Please click an attachment for an appropriate musical background and enjoy your tour of our elesdious collections!

Edited by Asante (03/02/06 10:13 AM)

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Asante]
    #5356829 - 03/02/06 09:39 AM (18 years, 1 month ago)
Log in to view attachment




















Edited by Asante (03/02/06 09:57 AM)

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Asante]
    #5356831 - 03/02/06 09:40 AM (18 years, 1 month ago)
Log in to view attachment



















Edited by Asante (03/02/06 10:07 AM)

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Asante]
    #5356832 - 03/02/06 09:40 AM (18 years, 1 month ago)




















Edited by Asante (03/02/06 09:47 AM)

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Asante]
    #5356839 - 03/02/06 09:41 AM (18 years, 1 month ago)




















Edited by Asante (03/02/06 09:48 AM)

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Asante]
    #5356840 - 03/02/06 09:42 AM (18 years, 1 month ago)




















Edited by Asante (03/02/06 09:49 AM)

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Asante]
    #5356842 - 03/02/06 09:42 AM (18 years, 1 month ago)




















Edited by Asante (03/02/06 09:50 AM)

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Asante]
    #5356844 - 03/02/06 09:42 AM (18 years, 1 month ago)




















Edited by Asante (03/02/06 09:50 AM)

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Asante]
    #5356845 - 03/02/06 09:43 AM (18 years, 1 month ago)




















Edited by Asante (03/02/06 09:51 AM)

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Asante]
    #5356846 - 03/02/06 09:43 AM (18 years, 1 month ago)


















Edited by Asante (03/02/06 09:52 AM)

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Asante]
    #5356853 - 03/02/06 09:45 AM (18 years, 1 month ago)

:heart:AND MORE TO COME :heart:

Edited by Asante (03/02/06 09:53 AM)

Extras: Filter Print Post Top
Invisiblesui
I love you.
Male User Gallery

Registered: 08/20/04
Posts: 32,583
Loc: Cali, Contra Costa Co. Flag
Re: The Shroomery LSD Museum [Re: Asante] * 1
    #5356873 - 03/02/06 09:56 AM (18 years, 1 month ago)

I think the spongebobs in the second pic were 5-meo-AMT, is that confirmed LSD?


MED EDIT: please remember that it is all *alleged* LSD.


--------------------

"There is never a wrong note, bend it."
Jimi Hendrix


Edited by Wiccan_Seeker (03/02/06 10:16 AM)

Extras: Filter Print Post Top
Invisiblesui
I love you.
Male User Gallery

Registered: 08/20/04
Posts: 32,583
Loc: Cali, Contra Costa Co. Flag
Re: The Shroomery LSD Museum [Re: sui]
    #5356878 - 03/02/06 09:58 AM (18 years, 1 month ago)

and the ones on the Camel pack are DOB, i have one right now.

I took this pic a couple months ago.


--------------------

"There is never a wrong note, bend it."
Jimi Hendrix


Edited by sui (03/02/06 09:59 AM)

Extras: Filter Print Post Top
OfflineQuantumMeltdown
Space Monkey
Male User Gallery

Folding@home Statistics
Registered: 10/31/01
Posts: 4,962
Loc: Ft. Lauderdale, FL
Last seen: 7 months, 26 days
Re: The Shroomery LSD Museum [Re: sui]
    #5357059 - 03/02/06 11:06 AM (18 years, 1 month ago)



--------------------
-QuantumMeltdown

Total abstinence is so excellent a thing that it cannot be carried to too great an extent. In my passion for it I even carry it so far as to totally abstain from total abstinence itself.
  -Mark Twain

"The time has come the walrus said, little oysters  hide their heads, my Twain of thought is loosely bound I guess its time to Mark this down, Be good and you will be lonesome
Be lonesome and you will be free
Live a lie and you will live to regret it
That's what livin' is to me
That's what livin' is to me"
Jimmy Buffett

Extras: Filter Print Post Top
Invisiblemecreateme
YoUisMEEMsiUoY
Male User Gallery

Registered: 05/13/04
Posts: 2,727
Loc: Memphrica
Re: The Shroomery LSD Museum [Re: QuantumMeltdown]
    #5357232 - 03/02/06 12:18 PM (18 years, 1 month ago)



--------------------
No ONE wants to know the ultimate TRUTH, as soon as YOU find IT out, YOU want to forget IT.

You are everything's way of feeling itself.

Happy Schwag, everygodly!

Extras: Filter Print Post Top
Offlinebaraka
Male User Gallery

Folding@home Statistics
Registered: 07/15/00
Posts: 10,768
Loc: hyperspace Flag
Last seen: 2 years, 3 months
Re: The Shroomery LSD Museum [Re: mecreateme]
    #5364811 - 03/04/06 02:35 PM (18 years, 1 month ago)

cool, i think you got all of my pics cept this one.





--------------------
This is the only time I really feel alive.

Edited by baraka (03/04/06 02:38 PM)

Extras: Filter Print Post Top
InvisibleChristoph teh goat luvr
Drugstore Cowboy
 User Gallery

Registered: 02/27/05
Posts: 1,261
Loc: Louisiana Flag
Re: The Shroomery LSD Museum [Re: baraka]
    #5364841 - 03/04/06 02:45 PM (18 years, 1 month ago)

Liquid dropped on coffee paper. 1 hit shit.




Extras: Filter Print Post Top
OfflineQuoiyaien
><<<<0>>>><
Male User Gallery

Registered: 06/08/04
Posts: 1,409
Last seen: 3 years, 3 months
Re: The Shroomery LSD Museum [Re: Asante]
    #5364906 - 03/04/06 03:13 PM (18 years, 1 month ago)

Oh yeah! :laugh:  These are very potent hits.  They are not the same as the other hits of the same type floating around... Trust me... :wink: 



:heart:Peace:heart:

:hippie:

Extras: Filter Print Post Top
OfflineHarmonic_Order
Nshudimasupatogata
Male User Gallery

Registered: 02/13/06
Posts: 412
Loc: Out on the Street
Last seen: 17 years, 6 months
Re: The Shroomery LSD Museum [Re: Quoiyaien]
    #5365310 - 03/04/06 06:09 PM (18 years, 1 month ago)

Oh... wow...
I haven't seen any of that since 1994.
When I see that I feel kind of sad, actually
Reflecting on how far out of the scene I have gotten it seems impossible to get back in
Don't know if I want, really
Yeah, that takes me back

H_O


--------------------
.oOo. Are you high? .oOo.
.oOo. You look like you're on some kind of drug .oOo.

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Quoiyaien]
    #5395605 - 03/13/06 03:27 PM (18 years, 1 month ago)

Thats some good sheet you got there :thumbup:


--------------------
Omnicyclion.org
higher knowledge starts here

Extras: Filter Print Post Top
InvisibleChristoph teh goat luvr
Drugstore Cowboy
 User Gallery

Registered: 02/27/05
Posts: 1,261
Loc: Louisiana Flag
Re: The Shroomery LSD Museum [Re: Quoiyaien]
    #5395683 - 03/13/06 03:50 PM (18 years, 1 month ago)

Do you live in canada?

Extras: Filter Print Post Top
InvisibleAbrainspot
Stranger
 User Gallery
Registered: 01/06/06
Posts: 1,500
Loc: Rewind
Re: The Shroomery LSD Museum [Re: Asante]
    #5395776 - 03/13/06 04:31 PM (18 years, 1 month ago)

I really gotta find some dose...

Extras: Filter Print Post Top
OfflineJeffersonDarcy
Stranger
Registered: 03/18/02
Posts: 182
Last seen: 16 years, 3 months
Re: The Shroomery LSD Museum [Re: QuantumMeltdown]
    #5395826 - 03/13/06 04:44 PM (18 years, 1 month ago)

Quote:

QuantumMeltdown said:





nice DMT pipe... where u get it?

Extras: Filter Print Post Top
OfflineHerbus
...

Registered: 10/19/04
Posts: 1,477
Loc: Reading the map...
Last seen: 10 years, 3 months
Re: The Shroomery LSD Museum [Re: JeffersonDarcy]
    #5396400 - 03/13/06 07:45 PM (18 years, 1 month ago)

This thread is making my tongue tingle.


--------------------
...

Extras: Filter Print Post Top
Offlinescatmanrav
Brainy Smurf

Registered: 05/08/04
Posts: 11,483
Loc: Flag
Last seen: 11 years, 3 months
Re: The Shroomery LSD Museum [Re: Herbus]
    #5398532 - 03/14/06 10:38 AM (18 years, 1 month ago)



--------------------
"life is like a drop of rain getting closer and closer to falling into a lake, and then when you hit the lake there is no more rain drop, only the lake."

Growing with bags, start to finish (including my new grain and substrate prep)
Anyone looking to start bulk tubs/mono tubs/shotgun hybrids? Good tubs to use..
How I do grain (old still good tips)
Turn your closet into a fruiting chamber
Casing layer colonization and overlay

Extras: Filter Print Post Top
Invisibleindica
Male User Gallery

Registered: 08/17/05
Posts: 18,905
Re: The Shroomery LSD Museum [Re: scatmanrav]
    #5592370 - 05/05/06 12:19 AM (17 years, 11 months ago)

Shivas
500 hits
not sure how many mics, apparently really good.
All the rage in Switzerland ATM, people prefer it over Hofmanns

The front of this print is a 3D image...




Extras: Filter Print Post Top
Invisibleindica
Male User Gallery

Registered: 08/17/05
Posts: 18,905
Re: The Shroomery LSD Museum [Re: indica]
    #5714065 - 06/05/06 06:42 AM (17 years, 10 months ago)

Da Vinci Code
500 hits
290ug
:thumbup:



keepin this thread alive :smirk:

Extras: Filter Print Post Top
OfflineQuoiyaien
><<<<0>>>><
Male User Gallery

Registered: 06/08/04
Posts: 1,409
Last seen: 3 years, 3 months
Re: The Shroomery LSD Museum [Re: indica]
    #5716325 - 06/05/06 07:32 PM (17 years, 10 months ago)

These are fractal mushrooms.  Absolutely amazing hits.  Here we have a sheet of 500 hits.  I posted this pic elsewhere, but for the sake of consolidation:



So very potent!  These reminded me why I love LSD soooooo much :laugh:

:heart: Peace :heart:

:hippie:

Extras: Filter Print Post Top
Invisibleindica
Male User Gallery

Registered: 08/17/05
Posts: 18,905
Re: The Shroomery LSD Museum [Re: Quoiyaien]
    #5716330 - 06/05/06 07:34 PM (17 years, 10 months ago)

lucky you got that sheet so cheap :frown:

Extras: Filter Print Post Top
OfflineQuoiyaien
><<<<0>>>><
Male User Gallery

Registered: 06/08/04
Posts: 1,409
Last seen: 3 years, 3 months
Re: The Shroomery LSD Museum [Re: indica]
    #5716494 - 06/05/06 08:17 PM (17 years, 10 months ago)

The only reason I bought so much was because it was so cheap.  I probably wont see a deal like this for a very long time, hence 500 hits. 

Usually I limit my "orders" to one or two sheets.  It takes me a good year of giving it away and taking it myself to go through 100 hits. 
Though I can easily go through half a sheet in July and August alone. 
Ahhh... I love tripping near the water at a park on a warm summer day.  Does that not conjure up the most relaxing image          :sunny: 

:heart: Peace :heart:

:hippie:

Extras: Filter Print Post Top
InvisibleaNeway2sayHooray
Cresley Wusher
 User Gallery

Folding@home Statistics
Registered: 07/07/05
Posts: 7,653
Loc: Orphic Trench
Re: The Shroomery LSD Museum [Re: Quoiyaien]
    #5716548 - 06/05/06 08:32 PM (17 years, 10 months ago)

Quote:

Quoiyaien said:
Ahhh... I love tripping near the water at a park on a warm summer day.  Does that not conjure up the most relaxing image          :sunny: 

:heart: Peace :heart:

:hippie:




Pure Bliss...

This is the first thought I had when I read that line.


Enjoy that sheet.I know you will.Its good to hear you are spreading the love to your friends and not asking anything in return. :thumbup:


--------------------
Mad_Larkin said:  Death is just a thang.
:clementine:
MrJellineck said:  Profits, prophets. That's all you jews think about.
sheekle said: life is drugs... and music... and cat... :snowman:

Extras: Filter Print Post Top
Offlinesunchaser
look at thebirds!
Male
Registered: 06/07/06
Posts: 51
Loc: tallahassee
Last seen: 17 years, 7 months
Re: The Shroomery LSD Museum [Re: indica]
    #5729636 - 06/09/06 04:23 AM (17 years, 10 months ago)

divinci code inspired blotter art I`d like to see more sheets w/such themes

Extras: Filter Print Post Top
OfflineJaRRn
Lost in Space
Male User Gallery

Registered: 05/20/04
Posts: 1,155
Loc: Standing on the Cosmic Sh...
Last seen: 1 year, 11 months
Re: The Shroomery LSD Museum [Re: aNeway2sayHooray]
    #5729647 - 06/09/06 04:29 AM (17 years, 10 months ago)


Some ppl were calling em Sunshines, but there sunflowers, Rofl  :crazy2:
(x50)

Extras: Filter Print Post Top
OfflineIamthewalrus
every evening Idied and everynight I wasreborn
Male User Gallery

Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 15 years, 6 months
Re: The Shroomery LSD Museum [Re: JaRRn]
    #5729794 - 06/09/06 06:11 AM (17 years, 10 months ago)

fuck I gotta find my camera I got some great cid right now and I'd like to get the design out there so when it starts flowing ppl will know to look for it :smile:

please don't ask tho I ain't no dealer

Edited by Iamthewalrus (06/09/06 06:13 AM)

Extras: Filter Print Post Top
OfflineIamthewalrus
every evening Idied and everynight I wasreborn
Male User Gallery

Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 15 years, 6 months
Re: The Shroomery LSD Museum [Re: Iamthewalrus]
    #5729812 - 06/09/06 06:20 AM (17 years, 10 months ago)

summer of the bee :P

Extras: Filter Print Post Top
OfflinePoseydon
Poseynous
Male

Registered: 09/11/06
Posts: 135
Loc: Finland/Estonia
Last seen: 14 years, 7 months
Re: The Shroomery LSD Museum [Re: Asante]
    #6550543 - 02/10/07 12:53 PM (17 years, 2 months ago)

Picture's of my friend's blotters.



--------------------

Extras: Filter Print Post Top
Invisiblesui
I love you.
Male User Gallery

Registered: 08/20/04
Posts: 32,583
Loc: Cali, Contra Costa Co. Flag
Re: The Shroomery LSD Museum [Re: Poseydon]
    #6564029 - 02/13/07 06:42 PM (17 years, 2 months ago)

Quote:

Poseydon said:
Picture's of my friend's blotters.







OOOOOOO Hoffmans!


--------------------

"There is never a wrong note, bend it."
Jimi Hendrix


Extras: Filter Print Post Top
Invisibleredgreenvines
irregular verb
 User Gallery

Registered: 04/08/04
Posts: 38,169
Re: The Shroomery LSD Museum [Re: Quoiyaien]
    #6564347 - 02/13/07 07:47 PM (17 years, 2 months ago)

it brings tears of joy to my eyes
whenever i think of it

Quote:

Quoiyaien said:
These are fractal mushrooms.  Absolutely amazing hits.  Here we have a sheet of 500 hits.  I posted this pic elsewhere, but for the sake of consolidation:



So very potent!  These reminded me why I love LSD soooooo much :laugh:

:heart: Peace :heart:

:hippie:




--------------------
:confused: _ :brainfart:🧠  _ :finger:

Extras: Filter Print Post Top
OfflineNephlyte
Misfortunate One
Male User Gallery

Registered: 10/11/05
Posts: 1,025
Loc: South Texas
Last seen: 13 years, 7 months
Re: The Shroomery LSD Museum [Re: redgreenvines]
    #6564913 - 02/13/07 10:20 PM (17 years, 2 months ago)

I hate all of you. 

Also, i'm green with envy.
:tongue2:


--------------------
"To do right is to know what you want. Now when you are dissatisfied with yourself it's because you are after something you don't really want. What objects are you proposing to yourself? Are they the objects you really value? If they are not, you are cheating yourself. I don't meant that if you chose to pursue the objects you most value, you will attain them; of course not. Your experience will tell you that. But success in getting after much labor what you really don't care for is the bitterest and most ridiculous failure." -George Santayana

Extras: Filter Print Post Top
Offlinedarkstar45
inquisitivetraveler
Male User Gallery

Registered: 04/14/05
Posts: 427
Last seen: 14 years, 2 months
Re: The Shroomery LSD Museum [Re: Nephlyte]
    #6565330 - 02/14/07 12:41 AM (17 years, 2 months ago)



The rainbow blotters tasted quite delicious. They must have been flavored somehow.


--------------------
There he goes...
One of God's own prototypes.
A high powered mutant of some kind never even considered for mass production.
Too weird to live and too rare to die.

Extras: Filter Print Post Top
InvisibleRobMarley420
LSD Enthusiast
Male User Gallery

Registered: 05/01/05
Posts: 12,554
Loc: Mushroom Mountain
Re: The Shroomery LSD Museum [Re: darkstar45] * 1
    #6565632 - 02/14/07 03:42 AM (17 years, 2 months ago)





Shivas, and Internet Explorers. Top notch LSD, 250 mics per hit.



Orange Sunshine, these were sold to me as LSD but turned out to be an RC.



:heart:I love acid! :heart:


--------------------

Edited by RobMarley420 (02/14/07 03:51 AM)

Extras: Filter Print Post Top
Offlinestefan
work in progress

Registered: 04/11/01
Posts: 8,932
Loc: The Netherlands
Last seen: 3 years, 6 months
Re: The Shroomery LSD Museum [Re: Asante]
    #6565656 - 02/14/07 04:29 AM (17 years, 2 months ago)

I'm jealous, it's like blotters/dots are nonexistant over here:thumbdown:

Extras: Filter Print Post Top
Offlineyageman
already dead
 User Gallery

Registered: 01/26/06
Posts: 4,965
Last seen: 14 years, 11 months
Re: The Shroomery LSD Museum [Re: RobMarley420] * 1
    #6565664 - 02/14/07 04:33 AM (17 years, 2 months ago)

Just so people know, if you eat the right acid, know the right people, and read alot about the doses needed to trip you will pretty much arrive at the conclusion that 99% of hits dont go above 150 mics per hit.

I figured Id just waist my time to say this.

I seldom hear about people getting hits that are less than 250 mics around here. This helps to bring me to the conclusion that most people actually have no idea.
To have a good idea, some people wouldnt even need to "know the right people" as I said before.

Top notch for a blotter is 150-170, not 290 or some shit.
Anything more is just irresponsible(to say, to lay). I too have seen it at the 200 + range, but that was geltabs. One kind out of 20 types or so.
Two hits of that stuff was WAY too much for many seasoned psychedelic users.
So basically, you are not going to take 2 hits and reach 500 mics no matter what you find, (even though they may be incredibly good hits).
Too many of the wrong people have gotten word of the "microgram", and they use it and abused it.
Even dead/phish lots have been tainted by this so called knowledge of dose per hit.
I have never bought a hit from a hipster that was not supposedly considered to be"strong", or even more often, 250 mics+......lol
Its always bullshit. They may be strong, but they are never anywhere close to 250 mics, not even 200 mics.
The best lsd I have had were 150-170 mic blotters. I dont even consider the 230 mic geltabs to be a part of the norm.
2 of those gels would scare the shit out of most people. Just because of how many people eat 2 hits or more at once.
AGain that was damn near irresponsible on the part of those who laid the shit. That was not made for the general public though. Thats why I know so much about potency and dose.
I do "know" this is true. Its just fun speaking the truth when you can find so many people who dont agree with you.

your blotters are not going to exceed 170 mics.
170 mics are supreme lsd tabs.
I have tried enough to know this. I have known the right people(person) to know this.

So there is my little lecture on micrograms. You dont have to believe it, but its true.
All of that 200+ mic lsd is probably no more than 130-160 mics per hit.


--------------------
[quote]Me_Roy said:
You moron. Material is material is material.  No 'thing' fixes any situation.  If anything were so simple we would be living in a much better world.[/quote] <-----the dumbest thing I have ever read in my life.
Thanks shroomery.

Edited by yageman (02/14/07 04:42 AM)

Extras: Filter Print Post Top
InvisibleRobMarley420
LSD Enthusiast
Male User Gallery

Registered: 05/01/05
Posts: 12,554
Loc: Mushroom Mountain
Re: The Shroomery LSD Museum [Re: yageman]
    #6569726 - 02/15/07 02:42 AM (17 years, 2 months ago)

Quote:

yageman said:
Just so people know, if you eat the right acid, know the right people, and read alot about the doses needed to trip you will pretty much arrive at the conclusion that 99% of hits dont go above 150 mics per hit.





Well, my blotters must be in that 1% that are above 150 mics. :wink: jk. I was told that they are 250 mics and I believe that they are somewhere close. To give you an idea of how strong they are, you will trip off a 1/4 hit, and 2 hits will be too much for about everyone I know. Very strong stuff, I bet it would cause a lot of freak outs if it wasn't so expensive or if it got into the wrong hands.


--------------------

Edited by RobMarley420 (02/15/07 02:46 AM)

Extras: Filter Print Post Top
OfflineYoschie99
nomad
Male

Registered: 11/24/99
Posts: 3,149
Loc: center of earth
Last seen: 2 months, 10 days
Re: The Shroomery LSD Museum [Re: yageman]
    #6569888 - 02/15/07 06:00 AM (17 years, 2 months ago)

Quote:

yageman said:
Just so people know, if you eat the right acid, know the right people, and read alot about the doses needed to trip you will pretty much arrive at the conclusion that 99% of hits dont go above 150 mics per hit.

I figured Id just waist my time to say this.

I seldom hear about people getting hits that are less than 250 mics around here.  This helps to bring me to the conclusion that most people actually have no idea.
  To have a good idea, some people wouldnt even need to "know the right people" as I said before.

  Top notch for a blotter is 150-170, not 290 or some shit.
Anything more is just irresponsible(to say, to lay).  I too have seen it at the 200 + range, but that was geltabs.  One kind out of 20 types or so.
  Two hits of that stuff was WAY too much for many seasoned psychedelic users.
  So basically, you are not going to take 2 hits and reach 500 mics no matter what you find, (even though they may be incredibly good hits).
  Too many of the wrong people have gotten word of the "microgram", and they use it and abused it.
  Even dead/phish lots have been tainted by this so called knowledge of dose per hit.
  I have never bought a hit from a hipster that was not supposedly considered to be"strong", or even more often, 250 mics+......lol
  Its always bullshit.  They may be strong, but they are never anywhere close to 250 mics, not even 200 mics.
  The best lsd I have had were 150-170 mic blotters.  I dont even consider the 230 mic geltabs to be a part of the norm.
  2 of those gels would scare the shit out of most people.  Just because of how many people eat 2 hits or more at once.
AGain that was damn near irresponsible on the part of those who laid the shit.  That was not made for the general public though.  Thats why I know so much about potency and dose.
  I do "know" this is true.  Its just fun speaking the truth when you can find so many people who dont agree with you.

  your blotters are not going to exceed 170 mics. 
170 mics are supreme lsd tabs.
  I have tried enough to know this.  I have known the right people(person) to know this.

So there is my little lecture on micrograms.  You dont have to believe it, but its true.
  All of that 200+ mic lsd is probably no more than 130-160 mics per hit.




:thumbup::thumbup:

i said the same thing in the ODD thread, basically.. 250mics is a lot.. I remember reading in 2000-2001 on one of the DEA newsletters, i think, that the average dose of LSD tested contained ~70mics.  I doubt it's gone up much from then...

:smile:

yos-

Extras: Filter Print Post Top
OfflinePoseydon
Poseynous
Male

Registered: 09/11/06
Posts: 135
Loc: Finland/Estonia
Last seen: 14 years, 7 months
Re: The Shroomery LSD Museum [Re: Yoschie99]
    #6638315 - 03/05/07 04:31 PM (17 years, 1 month ago)

7 hits of some lucy my friend has right now.




--------------------

Extras: Filter Print Post Top
OfflineRookieShroomie
Shuras labassistant
Male User Gallery


Registered: 05/14/07
Posts: 294
Loc: [ˈbundəsʁepu
Last seen: 8 years, 20 hours
Re: The Shroomery LSD Museum [Re: Poseydon]
    #7075181 - 06/21/07 12:58 PM (16 years, 9 months ago)



Yummy acid in Germany.
Obtained from mai to june 07


--------------------
Have a nice trip!


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: The Shroomery LSD Museum [Re: Yoschie99]
    #7075357 - 06/21/07 01:43 PM (16 years, 9 months ago)

Quote:

Yoschie99 said:
Quote:

yageman said:
Just so people know, if you eat the right acid, know the right people, and read alot about the doses needed to trip you will pretty much arrive at the conclusion that 99% of hits dont go above 150 mics per hit.

I figured Id just waist my time to say this.

I seldom hear about people getting hits that are less than 250 mics around here.  This helps to bring me to the conclusion that most people actually have no idea.
  To have a good idea, some people wouldnt even need to "know the right people" as I said before.

  Top notch for a blotter is 150-170, not 290 or some shit.
Anything more is just irresponsible(to say, to lay).  I too have seen it at the 200 + range, but that was geltabs.  One kind out of 20 types or so.
  Two hits of that stuff was WAY too much for many seasoned psychedelic users.
  So basically, you are not going to take 2 hits and reach 500 mics no matter what you find, (even though they may be incredibly good hits).
  Too many of the wrong people have gotten word of the "microgram", and they use it and abused it.
  Even dead/phish lots have been tainted by this so called knowledge of dose per hit.
  I have never bought a hit from a hipster that was not supposedly considered to be"strong", or even more often, 250 mics+......lol
  Its always bullshit.  They may be strong, but they are never anywhere close to 250 mics, not even 200 mics.
  The best lsd I have had were 150-170 mic blotters.  I dont even consider the 230 mic geltabs to be a part of the norm.
  2 of those gels would scare the shit out of most people.  Just because of how many people eat 2 hits or more at once.
AGain that was damn near irresponsible on the part of those who laid the shit.  That was not made for the general public though.  Thats why I know so much about potency and dose.
  I do "know" this is true.  Its just fun speaking the truth when you can find so many people who dont agree with you.

  your blotters are not going to exceed 170 mics. 
170 mics are supreme lsd tabs.
  I have tried enough to know this.  I have known the right people(person) to know this.

So there is my little lecture on micrograms.  You dont have to believe it, but its true.
  All of that 200+ mic lsd is probably no more than 130-160 mics per hit.




:thumbup::thumbup:

i said the same thing in the ODD thread, basically.. 250mics is a lot.. I remember reading in 2000-2001 on one of the DEA newsletters, i think, that the average dose of LSD tested contained ~70mics.  I doubt it's gone up much from then...

:smile:

yos-




I doubt it's gone up by a ton, but 2000-2001 was an extreme low point in lsd strength from what I witnessed.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
InvisibleDoseMeHomie
 User Gallery


Registered: 08/15/08
Posts: 2,265
Loc: 'merica
Re: The Shroomery LSD Museum [Re: Koala Koolio]
    #9487089 - 12/24/08 01:44 AM (15 years, 3 months ago)

We need to bring this thread back!!


--------------------
The Gospel

Extras: Filter Print Post Top
OfflineLysergicDreams
Stranger


Registered: 07/21/08
Posts: 34
Last seen: 13 years, 1 month
Re: The Shroomery LSD Museum [Re: Christoph teh goat luvr]
    #9487275 - 12/24/08 02:40 AM (15 years, 3 months ago)

I just jizzed all over this topic

Extras: Filter Print Post Top
Offlineyageman
already dead
 User Gallery

Registered: 01/26/06
Posts: 4,965
Last seen: 14 years, 11 months
Re: The Shroomery LSD Museum [Re: LysergicDreams]
    #9487387 - 12/24/08 03:36 AM (15 years, 3 months ago)

Quote:

LysergicDreams said:
I just jizzed all over this topic




Ya, nice dude.
Cool as hell............:fishsmack:


--------------------
[quote]Me_Roy said:
You moron. Material is material is material.  No 'thing' fixes any situation.  If anything were so simple we would be living in a much better world.[/quote] <-----the dumbest thing I have ever read in my life.
Thanks shroomery.

Extras: Filter Print Post Top
OfflineCoaster
Baʿal
Male User Gallery


Registered: 05/22/06
Posts: 33,501
Loc: Deep in the Valley
Last seen: 12 years, 6 months
Re: The Shroomery LSD Museum [Re: yageman]
    #9487389 - 12/24/08 03:38 AM (15 years, 3 months ago)

the one and only Doublestackittyflipill


--------------------

Extras: Filter Print Post Top
Offlineholycow
Stranger


Registered: 10/29/08
Posts: 238
Last seen: 4 years, 9 months
Re: The Shroomery LSD Museum [Re: Coaster]
    #9489174 - 12/24/08 12:50 PM (15 years, 3 months ago)

don't mean to clutter the thread, but damn! i am so jealous. i have never met lucy for real before. i wonder when i will be able to...

enjoy them mates!

Extras: Filter Print Post Top
InvisibleHarri


Registered: 10/29/08
Posts: 1,452
Re: The Shroomery LSD Museum [Re: Asante]
    #9664854 - 01/23/09 11:50 AM (15 years, 2 months ago)

Rolling Stones....very nice :smile:  :happyheart:

Edited by Harri (01/23/09 11:51 AM)

Extras: Filter Print Post Top
Offlinehaymaker
Mr Psychonaut
Male User Gallery


Folding@home Statistics
Registered: 10/26/07
Posts: 1,374
Loc: United Kingdom Flag
Last seen: 4 years, 5 months
Re: The Shroomery LSD Museum [Re: Harri]
    #9664872 - 01/23/09 11:54 AM (15 years, 2 months ago)

coaster i'm so fucking jealous... i've never seen a pic of someone who could get LSD like that before, that's amazing :smile:

:peace:


--------------------
"Make hay while the sun shines"
My Trade List

Extras: Filter Print Post Top
Invisibledsotm12345
WTF!
Male

Registered: 10/12/06
Posts: 243
Loc: Over there
Re: The Shroomery LSD Museum [Re: haymaker] * 1
    #9664926 - 01/23/09 12:08 PM (15 years, 2 months ago)

Quote:

haymaker said:
coaster i'm so fucking jealous... i've never seen a pic of someone who could get LSD like that before, that's amazing :smile:

:peace:




Coaster is not around anymore.  I'm pretty sure that is MDMA crystal with some Ketamine.  Not sure why he posted it here.

Extras: Filter Print Post Top
Offlinehaymaker
Mr Psychonaut
Male User Gallery


Folding@home Statistics
Registered: 10/26/07
Posts: 1,374
Loc: United Kingdom Flag
Last seen: 4 years, 5 months
Re: The Shroomery LSD Museum [Re: dsotm12345]
    #9664958 - 01/23/09 12:16 PM (15 years, 2 months ago)

what do you mean he's not around anymore? =\

and ah ok, it still made me heart jump though :smile:


--------------------
"Make hay while the sun shines"
My Trade List

Extras: Filter Print Post Top
Invisibledsotm12345
WTF!
Male

Registered: 10/12/06
Posts: 243
Loc: Over there
Re: The Shroomery LSD Museum [Re: haymaker]
    #9664965 - 01/23/09 12:19 PM (15 years, 2 months ago)

He got banned for something, not sure what.

Extras: Filter Print Post Top
OfflineKing Koopa
Mr. Hit Dat Hoe
Male User Gallery
Folding@home Statistics
Registered: 06/02/08
Posts: 8,045
Loc: Houston
Last seen: 13 years, 7 months
Re: The Shroomery LSD Museum [Re: RobMarley420]
    #12451417 - 04/24/10 09:39 PM (13 years, 11 months ago)

internet explorers! thats fucking awesome


--------------------
Best Post on the Shroomery
Don't criticize my mess unless you'd like to become part of it.

Extras: Filter Print Post Top
InvisibleFractalDust
Inspired by the mystery
 User Gallery

Registered: 03/20/05
Posts: 12,905
Loc: Behind the Redwoods
Re: The Shroomery LSD Museum [Re: King Koopa] * 2
    #12451640 - 04/24/10 10:42 PM (13 years, 11 months ago)

Quote:

King Koopa said:
internet explorers! thats fucking awesome




I bet they make you crash on the comedown. :tongue:


--------------------

Extras: Filter Print Post Top
Offlinefallenlsd
electricapricot
Male


Registered: 07/01/08
Posts: 1,509
Loc: missouri
Last seen: 10 years, 27 days
Re: The Shroomery LSD Museum [Re: FractalDust]
    #12452177 - 04/25/10 01:48 AM (13 years, 11 months ago)

Quote:

FractalDust said:
Quote:

King Koopa said:
internet explorers! thats fucking awesome




I bet they make you crash on the comedown. :tongue:





haha nice


--------------------
:mushroom2: :mushroomgrow: :mushroom2:

Extras: Filter Print Post Top
OfflinePilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 13 years, 8 days
Re: The Shroomery LSD Museum [Re: fallenlsd] * 1
    #12536380 - 05/10/10 11:04 AM (13 years, 11 months ago)

















--------------------
"The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live."

If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules... :frown:

Extras: Filter Print Post Top
Invisibledwpineal
Psychedelic Artist
 User Gallery


Registered: 07/20/06
Posts: 4,667
Re: The Shroomery LSD Museum [Re: PilzeEssen]
    #12536555 - 05/10/10 11:50 AM (13 years, 11 months ago)

Damn Pilze - Nice collection of pics! Great addition to the thread!

Extras: Filter Print Post Top
InvisibleUtOpiaN-MiNdStAtEs
 User Gallery

Registered: 10/25/09
Posts: 1,820
Loc: place
Re: The Shroomery LSD Museum [Re: Asante]
    #12536848 - 05/10/10 01:02 PM (13 years, 11 months ago)

Quote:

Wiccan_Seeker said:
<
<img src=https://files.shroomery.org/files/05-24/876967060-cameldose.jpg>

<img src=https://files.shroomery.org/files/05-24/888609743-Image2.jpg>



i have had the ones that are on he camel box. they were double layered and stuck together with glue. or just realy thick. they tasted horible. and im positve they were a type of DOX


--------------------
:tripmolecule::awecid2::awecid2::tripmolecule:]KILLEER TOFFUUUUUU!!!!
love life and live loving


Wizard of the Night

~Peace Love and Hippy Shit~

Extras: Filter Print Post Top
InvisibleUtOpiaN-MiNdStAtEs
 User Gallery

Registered: 10/25/09
Posts: 1,820
Loc: place
Re: The Shroomery LSD Museum [Re: Asante]
    #12536852 - 05/10/10 01:03 PM (13 years, 11 months ago)

Quote:

Wiccan_Seeker said:
<img src=https://files.shroomery.org/files/04-17/277210084-dragon_clouds.jpg>

<img src=https://files.shroomery.org/files/04-15/171500804-dragon.jpg>

<img src=https://files.shroomery.org/files/04-18/347276074-fairy_prince.jpg>

<img src=https://files.shroomery.org/files/04-25/724241897-sa.jpg>

<img src=https://files.shroomery.org/files/05-18/523435455-paper.jpg>

<img src=https://files.shroomery.org/files/05-19/606469091-L1.jpg>

<img src=https://files.shroomery.org/files/05-21/691337396-trippin_041.jpg>

<img src=https://files.shroomery.org/files/05-24/864977176-05lsd.jpg>

<img src=https://files.shroomery.org/files/05-24/876967060-cameldose.jpg>

<img src=https://files.shroomery.org/files/05-24/888609743-Image2.jpg>




the ones that look like disco . soccer balls.


--------------------
:tripmolecule::awecid2::awecid2::tripmolecule:]KILLEER TOFFUUUUUU!!!!
love life and live loving


Wizard of the Night

~Peace Love and Hippy Shit~

Extras: Filter Print Post Top
Offlinefallenlsd
electricapricot
Male


Registered: 07/01/08
Posts: 1,509
Loc: missouri
Last seen: 10 years, 27 days
Re: The Shroomery LSD Museum [Re: PilzeEssen]
    #12536905 - 05/10/10 01:16 PM (13 years, 11 months ago)

Quote:

PilzeEssen said:








i was given a ring with this symbol on it and told it was "my" symbol as i was a child of the third, that my soul was on its third generation

a realllly old far out lady told me this; she said a lot of things about me my energy and my life.. like without ever even meeting me

she could feel my energy through my gf, and distinguish the two and pull them a part and whatnot

and tell me DEEP shit about myself over the phone after my girlfriend dialed it for her lol

she went to woodstock and all that

but before i got to learn from her she died :frown:


--------------------
:mushroom2: :mushroomgrow: :mushroom2:

Extras: Filter Print Post Top
OfflineLuckeyMA
I catapult downtown...
 User Gallery


Registered: 08/06/09
Posts: 2,231
Last seen: 5 years, 11 months
Re: The Shroomery LSD Museum [Re: fallenlsd]
    #12536934 - 05/10/10 01:22 PM (13 years, 11 months ago)

THATS the ohm symbol


--------------------
"Consciousness survives the death of the body on which it rides"...



*Disclaimer*

Everything written from this account are meant for amusement purposes ONLY.  Everything written or posted from this account are NOT TRUE.

Extras: Filter Print Post Top
Offlinefallenlsd
electricapricot
Male


Registered: 07/01/08
Posts: 1,509
Loc: missouri
Last seen: 10 years, 27 days
Re: The Shroomery LSD Museum [Re: LuckeyMA]
    #12536940 - 05/10/10 01:24 PM (13 years, 11 months ago)

right, & the crown chakra

i don't know if she just said it was my symbol because of the 3 and that whole "soul in the third generation" thing

she could've been old and ate too much LSD but she was more than spot on with everything else she said


--------------------
:mushroom2: :mushroomgrow: :mushroom2:

Extras: Filter Print Post Top
OfflineLuckeyMA
I catapult downtown...
 User Gallery


Registered: 08/06/09
Posts: 2,231
Last seen: 5 years, 11 months
Re: The Shroomery LSD Museum [Re: fallenlsd]
    #12536990 - 05/10/10 01:34 PM (13 years, 11 months ago)

like what?


sometime people can get really good at sounding like they know shit about you but they play of your response and shit...  ya know...


--------------------
"Consciousness survives the death of the body on which it rides"...



*Disclaimer*

Everything written from this account are meant for amusement purposes ONLY.  Everything written or posted from this account are NOT TRUE.

Extras: Filter Print Post Top
Offlinefallenlsd
electricapricot
Male


Registered: 07/01/08
Posts: 1,509
Loc: missouri
Last seen: 10 years, 27 days
Re: The Shroomery LSD Museum [Re: LuckeyMA]
    #12537089 - 05/10/10 01:50 PM (13 years, 11 months ago)

true but i didnt really give her any response


she held my gfs hand and then proceeded to describe me to a T, then my girlfriend was shocked and told me she was going to call me for this old lady


she wasn't an old lady on the street or an old lady acting like she had powers or anything

my gf's dad is like 50 and was friends with this old woman and then this old woman mentioned to my gf how she was cool and she knew an old lady that my gf might be able to learn from.. gave her the number and my gf started just hanging out with this lady

this lady started just talking and my gf learned a lot of shit, i used to get like a transcript of it all from my gf on an old phone this happened last year anywhere in between 08/09 - 11/09 i dont remember, if i can find that phone i had saved one of the texts because it blew my fucking mind


--------------------
:mushroom2: :mushroomgrow: :mushroom2:

Extras: Filter Print Post Top
OfflineLuckeyMA
I catapult downtown...
 User Gallery


Registered: 08/06/09
Posts: 2,231
Last seen: 5 years, 11 months
Re: The Shroomery LSD Museum [Re: fallenlsd]
    #12537119 - 05/10/10 01:55 PM (13 years, 11 months ago)

hmmm... 


Isn't the ohm symbol the symbol of life?


How is the third level mang?  why can't you get you ass up here to the forth level with the rest of us...haha jk...

sound crazy...  maybe she snorted lots of fluff...


--------------------
"Consciousness survives the death of the body on which it rides"...



*Disclaimer*

Everything written from this account are meant for amusement purposes ONLY.  Everything written or posted from this account are NOT TRUE.

Extras: Filter Print Post Top
OfflinePilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 13 years, 8 days
Re: The Shroomery LSD Museum [Re: LuckeyMA]
    #12539775 - 05/10/10 08:41 PM (13 years, 11 months ago)

the ankh is the symbol of life.


--------------------
"The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live."

If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules... :frown:

Extras: Filter Print Post Top
OfflineNarttram
Shipwrecked Frontier Pioneer
Male User Gallery


Registered: 03/22/09
Posts: 114
Loc: Germany
Last seen: 12 years, 8 months
Re: The Shroomery LSD Museum [Re: PilzeEssen]
    #12541747 - 05/11/10 07:03 AM (13 years, 11 months ago)


Dalai Lama blotters from Germany, pretty potent as far as I can tell.

Extras: Filter Print Post Top
Invisibledwpineal
Psychedelic Artist
 User Gallery


Registered: 07/20/06
Posts: 4,667
Re: The Shroomery LSD Museum [Re: Narttram]
    #12541851 - 05/11/10 07:49 AM (13 years, 11 months ago)

Can you get a better pic? Looks like a neat print, but really hard to make out...

Extras: Filter Print Post Top
OfflineNarttram
Shipwrecked Frontier Pioneer
Male User Gallery


Registered: 03/22/09
Posts: 114
Loc: Germany
Last seen: 12 years, 8 months
Re: The Shroomery LSD Museum [Re: dwpineal]
    #12542645 - 05/11/10 11:57 AM (13 years, 11 months ago)

Sadly most of them are gone by now (the other pic was an older one), but I tried to get some better shots at them.






Extras: Filter Print Post Top
Offlinefallenlsd
electricapricot
Male


Registered: 07/01/08
Posts: 1,509
Loc: missouri
Last seen: 10 years, 27 days
Re: The Shroomery LSD Museum [Re: LuckeyMA]
    #12546041 - 05/11/10 10:11 PM (13 years, 11 months ago)

Quote:

LuckeyMA said:
hmmm... 


Isn't the ohm symbol the symbol of life?


How is the third level mang?  why can't you get you ass up here to the forth level with the rest of us...haha jk...

sound crazy...  maybe she snorted lots of fluff...




lol idk but i was thinking about it and maybe i had already completed a good part of the path in a past life because everybody around me doesn't really think deep or meditate i guess, and i've never really meditated but my entire life i have always had consciousness awareness to the point where i'm constantly thinking deep no matter what i was doing, all my thoughts i recognized as simply thoughts i could let go without being attached to i could like focus on my breathing and bring myself back to that anchor of happiness even when talking playing doing shit, at school doing whatever and anything and i never even knew it was meditation i was just doing it because i liked to think and i thought EVERYBODY did this.. like i experienced lots of shit that i just assumed was everyday stuff then i started tripping and i've always been able to handle whatever psychedelics i have (so far :P)even when i'm freaking the fuck out and have to remind myself i'm tripping multiple times a minute whereas people around me cannot and these people when i trip with them and help them through their trip they tell me it seems like i am a guide to their trip; like i was supposed to take them on a voyage, even though i sit there quietly normally and don't try to cloud up others thoughts.

anyways i started learning about meditation and realized that meditation is what i've been doing for most of my life that i can remember..and when people described meditation to me i was like what? that's it? i do that ALL the time without even thinking about it; every time i get a free second to myself i connect back to the breathing and let my mind unwind so all those thoughts in my head work themselves out and then i'm free to just sit and think :smile: whenever i have an issue or a problem; something to approach; an argument maybe, 9/10 times i'm going to see it in my head from both sides after i get the stories and then react in the best interests of whoever is asking for help; just because i keep myself thinking straight and not let emotion run my mouth or get me in trouble; this taking a step back thing is reallly wonderful and i'm glad i can do it without thinking, like i know some people that blindly only see one side to their issues and it's like wtF?

i thought i was retarded because i couldn't get that meditation was just the same shit i was doing but i didn't know it was something to do i thought it just was.. and i just googled any mediation readings i could find and read them and realized i already knew it

maybe i realized the value of meditation a long one of my past lives and took it with me to this life as a sort of tool set?

and then the people who are starting meditation and it takes them a long time to see results or "get it " - for lack of a better phrase not saying you guys dont understand i know you do - is only because this is the life where they decided to take up meditation ya know?

that could be crazy talk from the old lady and i could've followed it to far down the rabbit hole one night but i'm open to either option without the results breaking me :P

either way it's something to think about


--------------------
:mushroom2: :mushroomgrow: :mushroom2:

Extras: Filter Print Post Top
Offlinewoodruss67
barely here ,almost there
 User Gallery


Registered: 03/20/10
Posts: 562
Last seen: 11 years, 4 months
Re: The Shroomery LSD Museum [Re: fallenlsd]
    #12696518 - 06/06/10 11:07 AM (13 years, 10 months ago)

would it be a bad idea to get blotter through mail? just is nowhere to be found, not for years round here.? i mean i know its not smart,but what other options for this are there for me, other than just forget about it, haha.


--------------------
everything i post is only in reference to my alternate persona's , and is based on their needs to fit in.
woodruss.:crazy2:

Extras: Filter Print Post Top
OfflinePilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 13 years, 8 days
Re: The Shroomery LSD Museum [Re: woodruss67]
    #12696806 - 06/06/10 12:05 PM (13 years, 10 months ago)



--------------------
"The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live."

If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules... :frown:

Extras: Filter Print Post Top
OfflineKing Koopa
Mr. Hit Dat Hoe
Male User Gallery
Folding@home Statistics
Registered: 06/02/08
Posts: 8,045
Loc: Houston
Last seen: 13 years, 7 months
Re: The Shroomery LSD Museum [Re: PilzeEssen]
    #12696813 - 06/06/10 12:06 PM (13 years, 10 months ago)

:zaphod:

you're the fucking man Plize


--------------------
Best Post on the Shroomery
Don't criticize my mess unless you'd like to become part of it.

Extras: Filter Print Post Top
OfflineGoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,768
Loc: VENUS
Last seen: 26 days, 10 hours
Re: The Shroomery LSD Museum *DELETED* [Re: King Koopa]
    #12696890 - 06/06/10 12:24 PM (13 years, 10 months ago)

Post deleted by HofmannBlotter

Reason for deletion: Wrong links and triple post


Edited by GoddessOfLove (06/06/10 12:27 PM)

Extras: Filter Print Post Top
OfflineGoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,768
Loc: VENUS
Last seen: 26 days, 10 hours
Re: The Shroomery LSD Museum *DELETED* [Re: GoddessOfLove]
    #12696942 - 06/06/10 12:33 PM (13 years, 10 months ago)

Post deleted by HofmannBlotter

Reason for deletion: Wrong links


Edited by GoddessOfLove (06/06/10 12:36 PM)

Extras: Filter Print Post Top
OfflineGoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,768
Loc: VENUS
Last seen: 26 days, 10 hours
Re: The Shroomery LSD Museum [Re: GoddessOfLove]
    #12696998 - 06/06/10 12:43 PM (13 years, 10 months ago)

Afoaf contributions :smile:

They are LSD except for the Bugs Bunny which are DOI. The stuff is from Belgium they are very good and DOI dosage is 2mg.

Apologize for my english and enjoy !

For people who can't see what is it :



Bugs Bunny Blotter - DOI 2Mg



Super Mario Bros - 120µg



Fat Freddy's Cat - 120µg



Jesus Christ On Acid - 80µg



Mickey Mouse Acid - 80µg



Hofmann's 1943-2005 Blotter - 100µg



Bart Simpsons 2001 Edition - 120µg



Mash Up



Beavis And Butthead The Psychedelic Experience - 150µg



All Seeing Eye Pyramid - 80µg

Mickey Mouse Acid - All Seeing Eye Pyramid - Beavis and Butthead the psychedelic experience - Super Mario Bros - Hofmann 1943-2005 - Jesus Christ On Acid - DOI Bugs Bunny - Fat Freddy's Cat - Bart Simpson's 2001 Edition

He have also a nice sheet of Lady GaGa's LSD Blotter but i'll upload it later cuz i need to go :smile:

Peace



--------------------

Edited by GoddessOfLove (06/06/10 01:30 PM)

Extras: Filter Print Post Top
OfflinePilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 13 years, 8 days
Re: The Shroomery LSD Museum [Re: GoddessOfLove]
    #12697090 - 06/06/10 12:58 PM (13 years, 10 months ago)

upload them to the shroomery. click "pics" at the top left of the screen, right under your screen name. then upload them and post them.


--------------------
"The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live."

If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules... :frown:

Extras: Filter Print Post Top
OfflineGoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,768
Loc: VENUS
Last seen: 26 days, 10 hours
Re: The Shroomery LSD Museum [Re: PilzeEssen]
    #12697261 - 06/06/10 01:29 PM (13 years, 10 months ago)

Links Fix'd ! Thanks Shroomey :smile:

Edited by GoddessOfLove (06/06/10 01:30 PM)

Extras: Filter Print Post Top
OfflineThe Vapor
Lost In A Tea Daze


Registered: 03/22/10
Posts: 8,433
Loc: Misty Mountains, B.C. Flag
Last seen: 2 years, 1 month
Re: The Shroomery LSD Museum [Re: GoddessOfLove]
    #12697743 - 06/06/10 02:57 PM (13 years, 10 months ago)

How do you know the dosage on those HofmannBlotter?


--------------------

Extras: Filter Print Post Top
OfflineGoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,768
Loc: VENUS
Last seen: 26 days, 10 hours
Re: The Shroomery LSD Museum [Re: The Vapor]
    #12702141 - 06/07/10 09:18 AM (13 years, 10 months ago)

I don't know if i can speak about this, but trust me i know how many µg these sheets have been layed originally. Hope you understand and sorry for my bad english :smile:


--------------------

Extras: Filter Print Post Top
OfflineThe Vapor
Lost In A Tea Daze


Registered: 03/22/10
Posts: 8,433
Loc: Misty Mountains, B.C. Flag
Last seen: 2 years, 1 month
Re: The Shroomery LSD Museum [Re: GoddessOfLove]
    #12704938 - 06/07/10 06:48 PM (13 years, 10 months ago)

Yeah I understand what your talking about, and no need to apologize for your English, it seems pretty good to me.


Thanks for sharing those awesome pictures by the way.

:biggrin:


--------------------

Extras: Filter Print Post Top
OfflineGoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,768
Loc: VENUS
Last seen: 26 days, 10 hours
Re: The Shroomery LSD Museum [Re: The Vapor]
    #12707450 - 06/08/10 06:09 AM (13 years, 10 months ago)

No problem :smile: I'll upload more in da future !

Peace Out


--------------------

Extras: Filter Print Post Top
OfflineEvolution
Male User Gallery


Registered: 02/27/10
Posts: 282
Loc: Somewhere in time and spa...
Last seen: 12 years, 6 months
Re: The Shroomery LSD Museum [Re: Asante]
    #12719822 - 06/10/10 10:12 AM (13 years, 10 months ago)



Does anyone recognize these? On front they have a colored print and on the back a (unknown) figure in black lines.


--------------------
- Convictions are more dangerous enemies of truth than lies - F.W. Nietzche

Extras: Filter Print Post Top
InvisibleDr. Siekadellyk
Look at the corruption!
Male User Gallery


Folding@home Statistics
Registered: 11/19/08
Posts: 2,580
Loc: Floating amidst nothing Flag
Re: The Shroomery LSD Museum [Re: Evolution]
    #12719846 - 06/10/10 10:18 AM (13 years, 10 months ago)

:drooling:


--------------------
-My ISO list-

-My trade list-

Extras: Filter Print Post Top
OfflineEvolution
Male User Gallery


Registered: 02/27/10
Posts: 282
Loc: Somewhere in time and spa...
Last seen: 12 years, 6 months
Re: The Shroomery LSD Museum [Re: Evolution]
    #12719906 - 06/10/10 10:36 AM (13 years, 10 months ago)



--------------------
- Convictions are more dangerous enemies of truth than lies - F.W. Nietzche

Extras: Filter Print Post Top
OfflinePilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 13 years, 8 days
Re: The Shroomery LSD Museum [Re: Evolution]
    #12719935 - 06/10/10 10:43 AM (13 years, 10 months ago)

yuuup. thats the alex grey/ganesh print. i still havent gotten to eat any yet.


--------------------
"The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live."

If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules... :frown:

Extras: Filter Print Post Top
OfflineGoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,768
Loc: VENUS
Last seen: 26 days, 10 hours
Re: The Shroomery LSD Museum [Re: PilzeEssen]
    #12719964 - 06/10/10 10:50 AM (13 years, 10 months ago)

It's look like shiva to me :\ no ?


--------------------

Extras: Filter Print Post Top
OfflinePilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 13 years, 8 days
Re: The Shroomery LSD Museum [Re: GoddessOfLove]
    #12719974 - 06/10/10 10:53 AM (13 years, 10 months ago)

shiva isnt an elephant


--------------------
"The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live."

If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules... :frown:

Extras: Filter Print Post Top
OfflineEvolution
Male User Gallery


Registered: 02/27/10
Posts: 282
Loc: Somewhere in time and spa...
Last seen: 12 years, 6 months
Re: The Shroomery LSD Museum [Re: PilzeEssen]
    #12720920 - 06/10/10 02:25 PM (13 years, 10 months ago)

How many mcg does one hit contain? Don't know if they are of the same batch/source though.


--------------------
- Convictions are more dangerous enemies of truth than lies - F.W. Nietzche

Edited by Evolution (06/10/10 02:27 PM)

Extras: Filter Print Post Top
OfflinePilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 13 years, 8 days
Re: The Shroomery LSD Museum [Re: Evolution]
    #12721249 - 06/10/10 03:27 PM (13 years, 10 months ago)

i got mine at a festival last summer from an older hippy dude. he said to be careful because some of the greys were dosed twice as strong as others. i THINK he said they were 120 and 240. he said some old hippy ate 2 and ended up in safestock. (where you go when you get too fucked up)


--------------------
"The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live."

If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules... :frown:

Extras: Filter Print Post Top
OfflineEvolution
Male User Gallery


Registered: 02/27/10
Posts: 282
Loc: Somewhere in time and spa...
Last seen: 12 years, 6 months
Re: The Shroomery LSD Museum [Re: PilzeEssen]
    #12721422 - 06/10/10 03:59 PM (13 years, 10 months ago)

That's the downside of acid IMO that I can't say how much I will dose myself.

*need to find a reliable source*


--------------------
- Convictions are more dangerous enemies of truth than lies - F.W. Nietzche

Extras: Filter Print Post Top
OfflineDoseInTheWoods3420
LSD Connoisseur
Male User Gallery


Registered: 10/06/09
Posts: 1,134
Loc: wherever im needed Flag
Last seen: 8 years, 5 months
Re: The Shroomery LSD Museum [Re: Evolution]
    #12721740 - 06/10/10 04:56 PM (13 years, 10 months ago)

those greys had a taste like the hoffmans which makes me think its the same source.


--------------------

You're either on the bus, or off the bus
everything i say is complete and utter bulshit :wink:

Extras: Filter Print Post Top
OfflinePilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 13 years, 8 days
Re: The Shroomery LSD Museum [Re: DoseInTheWoods3420]
    #12721873 - 06/10/10 05:28 PM (13 years, 10 months ago)

Quote:

DoseInTheWoods3420 said:
those greys had a taste like the hoffmans which makes me think its the same source.




the dude i got them from said its from the same source. and that its the same "crystal" as the hofmann originals. which were strong as fuck.


--------------------
"The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live."

If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules... :frown:

Extras: Filter Print Post Top
OfflineKman1898
Dr. Learn'd
 User Gallery


Registered: 11/17/12
Posts: 1,192
Loc: A Park
Last seen: 2 years, 6 months
Re: The Shroomery LSD Museum [Re: PilzeEssen]
    #21056708 - 01/02/15 01:28 PM (9 years, 3 months ago)

here's some more to revive this thread and get the museum collection going!!



--------------------
Difficulty has more to do with reading abillity and ability to precisely follow directions. You need no knowledge of chemistry whatsoever, you just need to understand some basic principles as simple in concept as: water boils at 100C and freezes at 0C. Otherwise all published syntheses of organic and inorganic compounds can be reproduced successfully by pretty nearly anyone with at least average intelligence. Problems always have to do with availability of materials, not esoteric knowledge.

Extras: Filter Print Post Top
InvisibleLibertycapper
Doctor Banner
 User Gallery


Registered: 11/13/04
Posts: 688
Loc: British Columbia Flag
Re: The Shroomery LSD Museum [Re: Kman1898] * 1
    #21058189 - 01/02/15 08:05 PM (9 years, 3 months ago)

very potent.....i have done acid over the course of my 49 years many times and one third of a hit of these is equal to a full hit or even two hits of anything else I have ever dosed that was bought as acid. I really wish someone would confirm they are what I think they are....really potent doses.... and not some RC this old hippie has no interest in! I think thy are the many hands of shiva PEACE
.

Extras: Filter Print Post Top
Offlinemy3rdeye
 User Gallery


Registered: 08/10/12
Posts: 4,354
Loc: Canada Flag
Last seen: 2 years, 11 months
Re: The Shroomery LSD Museum [Re: Libertycapper]
    #21059196 - 01/03/15 01:30 AM (9 years, 3 months ago)

Quote:

Libertycapper said:
very potent.....i have done acid over the course of my 49 years many times and one third of a hit of these is equal to a full hit or even two hits of anything else I have ever dosed that was bought as acid. I really wish someone would confirm they are what I think they are....really potent doses.... and not some RC this old hippie has no interest in! I think thy are the many hands of shiva PEACE
.





Those are confirmed real, from the hunab crew. Two years ago at shambles that print put a bunch of kids in the chill out tent because they were "too strong".

Extras: Filter Print Post Top
InvisibleLibertycapper
Doctor Banner
 User Gallery


Registered: 11/13/04
Posts: 688
Loc: British Columbia Flag
Re: The Shroomery LSD Museum [Re: my3rdeye]
    #21062378 - 01/03/15 05:17 PM (9 years, 3 months ago)

thanks for responding!!! I have a test kit coming to confirm what you are confirming.

Extras: Filter Print Post Top
InvisibleChronic7
Registered: 05/08/04
Posts: 13,679
Re: The Shroomery LSD Museum [Re: Libertycapper]
    #21951297 - 07/16/15 10:18 AM (8 years, 8 months ago)

 

         

 


--------------------

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,330
Re: The Shroomery LSD Museum [Re: Chronic7]
    #25077954 - 03/20/18 03:09 PM (6 years, 28 days ago)

Spanning 12 years of LSD prints, please keep adding!





--------------------
Omnicyclion.org
higher knowledge starts here

Extras: Filter Print Post Top
OfflineJersey_Devil
Lightening Seeker
Male User Gallery


Registered: 09/05/17
Posts: 168
Loc: Deep in the Pine Barons Flag
Last seen: 3 years, 21 days
Re: The Shroomery LSD Museum [Re: Asante] * 2
    #25507244 - 10/02/18 07:14 PM (5 years, 6 months ago)

This was a new one was a gift. Dance on...



--------------------
 

Extras: Filter Print Post Top
OfflineBoolLord
Stranger
Registered: 07/12/19
Posts: 3
Last seen: 4 years, 8 months
Re: The Shroomery LSD Museum [Re: Jersey_Devil]
    #26104384 - 07/12/19 03:25 PM (4 years, 9 months ago)

Have you tested those? I was at a festival and bought some, then heard from a more reputable dealer that the dancing bears were questionable; but that might have just been two dealers duking it out lmao

Extras: Filter Print Post Top
Invisiblemapleleafmarijuana
Archaeotek Magos
Female User Gallery


Registered: 03/08/12
Posts: 9,063
Loc: Alberta, Canada
Re: The Shroomery LSD Museum [Re: BoolLord] * 3
    #27493410 - 10/05/21 10:15 AM (2 years, 6 months ago)

Bump, lets get this thread going!




--------------------
Vinegar Tom
stay black cocksucker, thats the most important thing - joey coco diaz
Flesh is Weak. All Hail the Machine God!

Extras: Filter Print Post Top
Offlinejunker82317
Stranger
 User Gallery

Registered: 02/27/21
Posts: 174
Last seen: 2 months, 4 days
Re: The Shroomery LSD Museum [Re: mapleleafmarijuana] * 3
    #27493650 - 10/05/21 02:23 PM (2 years, 6 months ago)


Extras: Filter Print Post Top
Invisiblemapleleafmarijuana
Archaeotek Magos
Female User Gallery


Registered: 03/08/12
Posts: 9,063
Loc: Alberta, Canada
Re: The Shroomery LSD Museum [Re: junker82317] * 4
    #27497519 - 10/08/21 03:43 PM (2 years, 6 months ago)



--------------------
Vinegar Tom
stay black cocksucker, thats the most important thing - joey coco diaz
Flesh is Weak. All Hail the Machine God!

Extras: Filter Print Post Top
Invisibleconnectedcosmos
Neti Neti
Male User Gallery


Registered: 02/07/15
Posts: 7,545
Loc: The Pathless Path
Re: The Shroomery LSD Museum [Re: mapleleafmarijuana] * 2
    #27498336 - 10/09/21 08:36 AM (2 years, 6 months ago)



--------------------


54. The true nature of things is to be known personally , through the eyes of clear illumination and not through a sage : what the moon exactly is , is to be known with one's own eyes ; can another make him know it?

Extras: Filter Print Post Top
Invisiblemapleleafmarijuana
Archaeotek Magos
Female User Gallery


Registered: 03/08/12
Posts: 9,063
Loc: Alberta, Canada
Re: The Shroomery LSD Museum [Re: connectedcosmos] * 2
    #27505625 - 10/15/21 03:47 PM (2 years, 5 months ago)



--------------------
Vinegar Tom
stay black cocksucker, thats the most important thing - joey coco diaz
Flesh is Weak. All Hail the Machine God!

Extras: Filter Print Post Top
InvisiblePsicomb
shroom or die
Male User Gallery


Registered: 01/13/18
Posts: 4,751
Loc: the womb
Re: The Shroomery LSD Museum [Re: mapleleafmarijuana] * 2
    #27505709 - 10/15/21 04:51 PM (2 years, 5 months ago)

  :crazy2:


--------------------

When we constantly pull things apart trying to see how it works, we may end up with only an understanding of how to destroy something
- nick sand

Extras: Filter Print Post Top
InvisibleThe Blind Ass
Bodhi
I'm a teapot User Gallery


Registered: 08/16/16
Posts: 27,619
Loc: The Primordial Mind
Re: The Shroomery LSD Museum [Re: Psicomb] * 1
    #27505903 - 10/15/21 07:49 PM (2 years, 5 months ago)

You degenerates!  Don’t you know you are scrambling and breaking down DNA when you take acid!
Jk - nice sheets and gels bois :thumbup:

How I wish I could acid away my dna right now :sad:.  When will the lsd rain down upon us from the sky!  Fungi is what I’ve been keeping to lately since sources went dry for Lucy, but I like them …so primal….like tapping into the force from Star Wars when it goes well.  Or the Spice from dune but without addiction.  God bless Hoffman & Mother Nature  :cheers:


--------------------
Give me Liberty caps -or- give me Death caps

Extras: Filter Print Post Top
InvisibleReticulated
Homo Reticulus
 User Gallery


Registered: 08/24/21
Posts: 129
Loc: Scotland Flag
Re: The Shroomery LSD Museum [Re: mapleleafmarijuana]
    #27507464 - 10/17/21 03:45 AM (2 years, 5 months ago)

Quote:

mapleleafmarijuana said:





That’s a very nice print.

I miss acid!!

:cryaboutit:


--------------------

Extras: Filter Print Post Top
InvisiblePsicomb
shroom or die
Male User Gallery


Registered: 01/13/18
Posts: 4,751
Loc: the womb
Re: The Shroomery LSD Museum [Re: Reticulated]
    #27526793 - 11/01/21 07:16 PM (2 years, 5 months ago)



Some of my pickups the last few years

:lsdabc:  :tripnoob: :chestpound:

I luv lsd so fuckin much

Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3 | 4 | 5 | 6  [ show all ]

Shop: PhytoExtractum Buy Bali Kratom Powder   Kraken Kratom Red Vein Kratom   Unfolding Nature Unfolding Nature: Being in the Implicate Order   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract   Myyco.com Golden Teacher Liquid Culture For Sale


Similar ThreadsPosterViewsRepliesLast post
* A question on LSD nickelpenny 669 1 06/07/04 10:58 PM
by splifftoter
* will LSD last?
( 1 2 all )
danlennon3 11,988 26 10/01/18 11:06 AM
by nube424
* Hunabs (hu nab ku) 4 1/2 hits :D LysergicX7 1,345 19 01/27/13 08:34 PM
by Mr.Mcrad
* "Ecstasy"- Psychedelic exhibit, LA Museum of Contemporary Art
( 1 2 all )
ArcofaJourney 4,627 20 11/06/05 10:55 PM
by Koala Koolio
* Does more low quality LSD = high quality LSD?
( 1 2 3 4 all )
LearyfanS 23,982 74 02/03/21 10:50 PM
by Typerwritermonky
* Potentiating your LSD, Mushroom, or DMT experience with smoked MAOI lonebuddha 15,532 4 08/31/10 12:32 AM
by Eternity
* Shrooms and LSD their effect on percieving novelty David_Scape 7,570 19 04/19/12 03:24 AM
by hamilton
* museums and shrooming Littlewing70 1,003 9 09/29/05 07:21 AM
by Sinistral

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
38,994 topic views. 0 members, 39 guests and 15 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.059 seconds spending 0.012 seconds on 14 queries.