|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
The Shroomery LSD Museum 5
#5356730 - 03/02/06 09:03 AM (17 years, 10 months ago) |
|
|
Log in to view attachment
Ladies & Gentlemen, welcome to the Shroomery LSD Museum!
This thread aims to become the largest collection of photos of LSD dosage units on the web!
This is the sister thread of Recent LSD Prints in Other Drugs Discussion. If you cannot view this forum you either are a newbie - and will be able to view it soon, or have been banned from that forum, in which case you blew it. See this thread for comments that go with many of these pics.
Feel free to browse our collections and to submit some of your own.
Rules for submission are:
1..It has to be a photo made by you or a friend of a friend and it has to represent a dosage unit they bought or recieved for usage. Blottewr art is NOT allowed, we're looking for the genuine laid articler here of what was sold or distributed as LSD. 2..Submit one or a few clear photographs that are good-sized (meaning not tiny and not huge) and remember to not say things you might regret later. 3..Do not clutter the thread with discussion, ideally most posts have to contain exhibits. This is, after all a museum thread. 4..Do not show other people's works without consent, you may however uplink to it, but never to that of non-shroomerites and especially anti-drug/governmental sites. 5..Remember that the displayed pieces are *alleged* LSD, meaning that they cannot be used for dosage identification purposes.
The works featured here are public domain (because of their previous publication on the Shroomery boards) but are linked such that their rightful owners can take them down. Do not knowingly post copyrighted material.
Please click an attachment for an appropriate musical background and enjoy your tour of our elesdious collections!
Edited by Asante (03/02/06 10:13 AM)
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Asante]
#5356829 - 03/02/06 09:39 AM (17 years, 10 months ago) |
|
|
Log in to view attachment
Edited by Asante (03/02/06 09:57 AM)
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Asante]
#5356831 - 03/02/06 09:40 AM (17 years, 10 months ago) |
|
|
Log in to view attachment
Edited by Asante (03/02/06 10:07 AM)
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Asante]
#5356832 - 03/02/06 09:40 AM (17 years, 10 months ago) |
|
|
Edited by Asante (03/02/06 09:47 AM)
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Asante]
#5356839 - 03/02/06 09:41 AM (17 years, 10 months ago) |
|
|
Edited by Asante (03/02/06 09:48 AM)
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Asante]
#5356840 - 03/02/06 09:42 AM (17 years, 10 months ago) |
|
|
Edited by Asante (03/02/06 09:49 AM)
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Asante]
#5356842 - 03/02/06 09:42 AM (17 years, 10 months ago) |
|
|
Edited by Asante (03/02/06 09:50 AM)
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Asante]
#5356844 - 03/02/06 09:42 AM (17 years, 10 months ago) |
|
|
Edited by Asante (03/02/06 09:50 AM)
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Asante]
#5356845 - 03/02/06 09:43 AM (17 years, 10 months ago) |
|
|
Edited by Asante (03/02/06 09:51 AM)
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Asante]
#5356846 - 03/02/06 09:43 AM (17 years, 10 months ago) |
|
|
Edited by Asante (03/02/06 09:52 AM)
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Asante]
#5356853 - 03/02/06 09:45 AM (17 years, 10 months ago) |
|
|
AND MORE TO COME
Edited by Asante (03/02/06 09:53 AM)
|
sui
I love you.


Registered: 08/20/04
Posts: 31,853
Loc: Cali, Contra Costa Co.
|
Re: The Shroomery LSD Museum [Re: Asante] 1
#5356873 - 03/02/06 09:56 AM (17 years, 10 months ago) |
|
|
I think the spongebobs in the second pic were 5-meo-AMT, is that confirmed LSD?
MED EDIT: please remember that it is all *alleged* LSD.
-------------------- "There is never a wrong note, bend it." Jimi Hendrix
Edited by Wiccan_Seeker (03/02/06 10:16 AM)
|
sui
I love you.


Registered: 08/20/04
Posts: 31,853
Loc: Cali, Contra Costa Co.
|
Re: The Shroomery LSD Museum [Re: sui]
#5356878 - 03/02/06 09:58 AM (17 years, 10 months ago) |
|
|
and the ones on the Camel pack are DOB, i have one right now.
I took this pic a couple months ago.
-------------------- "There is never a wrong note, bend it." Jimi Hendrix
Edited by sui (03/02/06 09:59 AM)
|
QuantumMeltdown
Space Monkey



Registered: 10/31/01
Posts: 4,962
Loc: Ft. Lauderdale, FL
Last seen: 5 months, 10 days
|
Re: The Shroomery LSD Museum [Re: sui]
#5357059 - 03/02/06 11:06 AM (17 years, 10 months ago) |
|
|
-------------------- -QuantumMeltdown Total abstinence is so excellent a thing that it cannot be carried to too great an extent. In my passion for it I even carry it so far as to totally abstain from total abstinence itself. -Mark Twain "The time has come the walrus said, little oysters hide their heads, my Twain of thought is loosely bound I guess its time to Mark this down, Be good and you will be lonesome Be lonesome and you will be free Live a lie and you will live to regret it That's what livin' is to me That's what livin' is to me" Jimmy Buffett
|
mecreateme
YoUisMEEMsiUoY


Registered: 05/13/04
Posts: 2,727
Loc: Memphrica
|
|
-------------------- No ONE wants to know the ultimate TRUTH, as soon as YOU find IT out, YOU want to forget IT. You are everything's way of feeling itself. Happy Schwag, everygodly!
|
baraka



Registered: 07/15/00
Posts: 10,768
Loc: hyperspace
Last seen: 2 years, 26 days
|
Re: The Shroomery LSD Museum [Re: mecreateme]
#5364811 - 03/04/06 02:35 PM (17 years, 10 months ago) |
|
|
cool, i think you got all of my pics cept this one.


-------------------- This is the only time I really feel alive.
Edited by baraka (03/04/06 02:38 PM)
|
Christoph teh goat luvr
Drugstore Cowboy


Registered: 02/27/05
Posts: 1,261
Loc: Louisiana
|
Re: The Shroomery LSD Museum [Re: baraka]
#5364841 - 03/04/06 02:45 PM (17 years, 10 months ago) |
|
|
Liquid dropped on coffee paper. 1 hit shit.

|
Quoiyaien
><<<<0>>>><


Registered: 06/08/04
Posts: 1,409
Last seen: 3 years, 1 month
|
Re: The Shroomery LSD Museum [Re: Asante]
#5364906 - 03/04/06 03:13 PM (17 years, 10 months ago) |
|
|
Oh yeah! These are very potent hits. They are not the same as the other hits of the same type floating around... Trust me...

Peace
|
Harmonic_Order
Nshudimasupatogata


Registered: 02/13/06
Posts: 412
Loc: Out on the Street
Last seen: 17 years, 3 months
|
Re: The Shroomery LSD Museum [Re: Quoiyaien]
#5365310 - 03/04/06 06:09 PM (17 years, 10 months ago) |
|
|
Oh... wow... I haven't seen any of that since 1994. When I see that I feel kind of sad, actually Reflecting on how far out of the scene I have gotten it seems impossible to get back in Don't know if I want, really Yeah, that takes me back
H_O
--------------------
.oOo. Are you high? .oOo..oOo. You look like you're on some kind of drug .oOo.
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Quoiyaien]
#5395605 - 03/13/06 03:27 PM (17 years, 10 months ago) |
|
|
Thats some good sheet you got there
-------------------- Omnicyclion.org higher knowledge starts here
|
Christoph teh goat luvr
Drugstore Cowboy


Registered: 02/27/05
Posts: 1,261
Loc: Louisiana
|
Re: The Shroomery LSD Museum [Re: Quoiyaien]
#5395683 - 03/13/06 03:50 PM (17 years, 10 months ago) |
|
|
Do you live in canada?
|
Abrainspot
Stranger

Registered: 01/06/06
Posts: 1,500
Loc: Rewind
|
Re: The Shroomery LSD Museum [Re: Asante]
#5395776 - 03/13/06 04:31 PM (17 years, 10 months ago) |
|
|
I really gotta find some dose...
|
JeffersonDarcy
Stranger
Registered: 03/18/02
Posts: 182
Last seen: 16 years, 30 days
|
|
Quote:
QuantumMeltdown said:
nice DMT pipe... where u get it?
|
Herbus
...

Registered: 10/19/04
Posts: 1,477
Loc: Reading the map...
Last seen: 10 years, 23 days
|
|
This thread is making my tongue tingle.
-------------------- ...
|
scatmanrav
Brainy Smurf

Registered: 05/08/04
Posts: 11,483
Loc:
Last seen: 11 years, 26 days
|
Re: The Shroomery LSD Museum [Re: Herbus]
#5398532 - 03/14/06 10:38 AM (17 years, 10 months ago) |
|
|
|
indica


Registered: 08/17/05
Posts: 18,905
|
Re: The Shroomery LSD Museum [Re: scatmanrav]
#5592370 - 05/05/06 12:19 AM (17 years, 8 months ago) |
|
|
Shivas 500 hits not sure how many mics, apparently really good. All the rage in Switzerland ATM, people prefer it over Hofmanns
The front of this print is a 3D image...

|
indica


Registered: 08/17/05
Posts: 18,905
|
Re: The Shroomery LSD Museum [Re: indica]
#5714065 - 06/05/06 06:42 AM (17 years, 7 months ago) |
|
|
Da Vinci Code 500 hits 290ug


keepin this thread alive
|
Quoiyaien
><<<<0>>>><


Registered: 06/08/04
Posts: 1,409
Last seen: 3 years, 1 month
|
Re: The Shroomery LSD Museum [Re: indica]
#5716325 - 06/05/06 07:32 PM (17 years, 7 months ago) |
|
|
These are fractal mushrooms. Absolutely amazing hits. Here we have a sheet of 500 hits. I posted this pic elsewhere, but for the sake of consolidation:

So very potent! These reminded me why I love LSD soooooo much 
Peace 
|
indica


Registered: 08/17/05
Posts: 18,905
|
Re: The Shroomery LSD Museum [Re: Quoiyaien]
#5716330 - 06/05/06 07:34 PM (17 years, 7 months ago) |
|
|
lucky you got that sheet so cheap
|
Quoiyaien
><<<<0>>>><


Registered: 06/08/04
Posts: 1,409
Last seen: 3 years, 1 month
|
Re: The Shroomery LSD Museum [Re: indica]
#5716494 - 06/05/06 08:17 PM (17 years, 7 months ago) |
|
|
The only reason I bought so much was because it was so cheap. I probably wont see a deal like this for a very long time, hence 500 hits.
Usually I limit my "orders" to one or two sheets. It takes me a good year of giving it away and taking it myself to go through 100 hits. Though I can easily go through half a sheet in July and August alone. Ahhh... I love tripping near the water at a park on a warm summer day. Does that not conjure up the most relaxing image
Peace 
|
aNeway2sayHooray
Cresley Wusher



Registered: 07/07/05
Posts: 7,653
Loc: Orphic Trench
|
Re: The Shroomery LSD Museum [Re: Quoiyaien]
#5716548 - 06/05/06 08:32 PM (17 years, 7 months ago) |
|
|
Quote:
Quoiyaien said: Ahhh... I love tripping near the water at a park on a warm summer day. Does that not conjure up the most relaxing image
Peace 
Pure Bliss...
This is the first thought I had when I read that line.
Enjoy that sheet.I know you will.Its good to hear you are spreading the love to your friends and not asking anything in return.
-------------------- Mad_Larkin said: Death is just a thang.
MrJellineck said: Profits, prophets. That's all you jews think about. sheekle said: life is drugs... and music... and cat...
|
sunchaser
look at thebirds!

Registered: 06/07/06
Posts: 51
Loc: tallahassee
Last seen: 17 years, 5 months
|
Re: The Shroomery LSD Museum [Re: indica]
#5729636 - 06/09/06 04:23 AM (17 years, 7 months ago) |
|
|
divinci code inspired blotter art I`d like to see more sheets w/such themes
|
JaRRn
Lost in Space


Registered: 05/20/04
Posts: 1,155
Loc: Standing on the Cosmic Sh...
Last seen: 1 year, 8 months
|
|
 Some ppl were calling em Sunshines, but there sunflowers, Rofl  (x50)
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 15 years, 3 months
|
Re: The Shroomery LSD Museum [Re: JaRRn]
#5729794 - 06/09/06 06:11 AM (17 years, 7 months ago) |
|
|
fuck I gotta find my camera I got some great cid right now and I'd like to get the design out there so when it starts flowing ppl will know to look for it 
please don't ask tho I ain't no dealer
Edited by Iamthewalrus (06/09/06 06:13 AM)
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 15 years, 3 months
|
Re: The Shroomery LSD Museum [Re: Iamthewalrus]
#5729812 - 06/09/06 06:20 AM (17 years, 7 months ago) |
|
|
summer of the bee :P
|
Poseydon
Poseynous


Registered: 09/11/06
Posts: 135
Loc: Finland/Estonia
Last seen: 14 years, 4 months
|
Re: The Shroomery LSD Museum [Re: Asante]
#6550543 - 02/10/07 12:53 PM (16 years, 11 months ago) |
|
|
Picture's of my friend's blotters.
--------------------
|
sui
I love you.


Registered: 08/20/04
Posts: 31,853
Loc: Cali, Contra Costa Co.
|
Re: The Shroomery LSD Museum [Re: Poseydon]
#6564029 - 02/13/07 06:42 PM (16 years, 11 months ago) |
|
|
Quote:
Poseydon said: Picture's of my friend's blotters.
OOOOOOO Hoffmans!
-------------------- "There is never a wrong note, bend it." Jimi Hendrix
|
redgreenvines
irregular verb


Registered: 04/08/04
Posts: 37,532
|
Re: The Shroomery LSD Museum [Re: Quoiyaien]
#6564347 - 02/13/07 07:47 PM (16 years, 11 months ago) |
|
|
it brings tears of joy to my eyes whenever i think of it
Quote:
Quoiyaien said: These are fractal mushrooms. Absolutely amazing hits. Here we have a sheet of 500 hits. I posted this pic elsewhere, but for the sake of consolidation:

So very potent! These reminded me why I love LSD soooooo much 
Peace 
--------------------
_ 🧠 _
|
Nephlyte
Misfortunate One


Registered: 10/11/05
Posts: 1,025
Loc: South Texas
Last seen: 13 years, 5 months
|
|
I hate all of you.
Also, i'm green with envy.
-------------------- "To do right is to know what you want. Now when you are dissatisfied with yourself it's because you are after something you don't really want. What objects are you proposing to yourself? Are they the objects you really value? If they are not, you are cheating yourself. I don't meant that if you chose to pursue the objects you most value, you will attain them; of course not. Your experience will tell you that. But success in getting after much labor what you really don't care for is the bitterest and most ridiculous failure." -George Santayana
|
darkstar45
inquisitivetraveler


Registered: 04/14/05
Posts: 427
Last seen: 13 years, 11 months
|
Re: The Shroomery LSD Museum [Re: Nephlyte]
#6565330 - 02/14/07 12:41 AM (16 years, 11 months ago) |
|
|

The rainbow blotters tasted quite delicious. They must have been flavored somehow.
-------------------- There he goes... One of God's own prototypes. A high powered mutant of some kind never even considered for mass production. Too weird to live and too rare to die.
|
RobMarley420
LSD Enthusiast


Registered: 05/01/05
Posts: 12,554
Loc: Mushroom Mountain
|
Re: The Shroomery LSD Museum [Re: darkstar45] 1
#6565632 - 02/14/07 03:42 AM (16 years, 11 months ago) |
|
|



Shivas, and Internet Explorers. Top notch LSD, 250 mics per hit.

Orange Sunshine, these were sold to me as LSD but turned out to be an RC.
I love acid!
--------------------
Edited by RobMarley420 (02/14/07 03:51 AM)
|
stefan
work in progress

Registered: 04/11/01
Posts: 8,932
Loc: The Netherlands
Last seen: 3 years, 3 months
|
Re: The Shroomery LSD Museum [Re: Asante]
#6565656 - 02/14/07 04:29 AM (16 years, 11 months ago) |
|
|
I'm jealous, it's like blotters/dots are nonexistant over here
|
yageman
already dead


Registered: 01/26/06
Posts: 4,965
Last seen: 14 years, 9 months
|
Re: The Shroomery LSD Museum [Re: RobMarley420] 1
#6565664 - 02/14/07 04:33 AM (16 years, 11 months ago) |
|
|
Just so people know, if you eat the right acid, know the right people, and read alot about the doses needed to trip you will pretty much arrive at the conclusion that 99% of hits dont go above 150 mics per hit.
I figured Id just waist my time to say this.
I seldom hear about people getting hits that are less than 250 mics around here. This helps to bring me to the conclusion that most people actually have no idea. To have a good idea, some people wouldnt even need to "know the right people" as I said before.
Top notch for a blotter is 150-170, not 290 or some shit. Anything more is just irresponsible(to say, to lay). I too have seen it at the 200 + range, but that was geltabs. One kind out of 20 types or so. Two hits of that stuff was WAY too much for many seasoned psychedelic users. So basically, you are not going to take 2 hits and reach 500 mics no matter what you find, (even though they may be incredibly good hits). Too many of the wrong people have gotten word of the "microgram", and they use it and abused it. Even dead/phish lots have been tainted by this so called knowledge of dose per hit. I have never bought a hit from a hipster that was not supposedly considered to be"strong", or even more often, 250 mics+......lol Its always bullshit. They may be strong, but they are never anywhere close to 250 mics, not even 200 mics. The best lsd I have had were 150-170 mic blotters. I dont even consider the 230 mic geltabs to be a part of the norm. 2 of those gels would scare the shit out of most people. Just because of how many people eat 2 hits or more at once. AGain that was damn near irresponsible on the part of those who laid the shit. That was not made for the general public though. Thats why I know so much about potency and dose. I do "know" this is true. Its just fun speaking the truth when you can find so many people who dont agree with you.
your blotters are not going to exceed 170 mics. 170 mics are supreme lsd tabs. I have tried enough to know this. I have known the right people(person) to know this.
So there is my little lecture on micrograms. You dont have to believe it, but its true. All of that 200+ mic lsd is probably no more than 130-160 mics per hit.
-------------------- [quote]Me_Roy said: You moron. Material is material is material. No 'thing' fixes any situation. If anything were so simple we would be living in a much better world.[/quote] <-----the dumbest thing I have ever read in my life. Thanks shroomery.
Edited by yageman (02/14/07 04:42 AM)
|
RobMarley420
LSD Enthusiast


Registered: 05/01/05
Posts: 12,554
Loc: Mushroom Mountain
|
Re: The Shroomery LSD Museum [Re: yageman]
#6569726 - 02/15/07 02:42 AM (16 years, 11 months ago) |
|
|
Quote:
yageman said: Just so people know, if you eat the right acid, know the right people, and read alot about the doses needed to trip you will pretty much arrive at the conclusion that 99% of hits dont go above 150 mics per hit.
Well, my blotters must be in that 1% that are above 150 mics. jk. I was told that they are 250 mics and I believe that they are somewhere close. To give you an idea of how strong they are, you will trip off a 1/4 hit, and 2 hits will be too much for about everyone I know. Very strong stuff, I bet it would cause a lot of freak outs if it wasn't so expensive or if it got into the wrong hands.
--------------------
Edited by RobMarley420 (02/15/07 02:46 AM)
|
Yoschie99
nomad


Registered: 11/24/99
Posts: 3,149
Loc: center of earth
Last seen: 2 months, 17 days
|
Re: The Shroomery LSD Museum [Re: yageman]
#6569888 - 02/15/07 06:00 AM (16 years, 11 months ago) |
|
|
Quote:
yageman said: Just so people know, if you eat the right acid, know the right people, and read alot about the doses needed to trip you will pretty much arrive at the conclusion that 99% of hits dont go above 150 mics per hit.
I figured Id just waist my time to say this.
I seldom hear about people getting hits that are less than 250 mics around here. This helps to bring me to the conclusion that most people actually have no idea. To have a good idea, some people wouldnt even need to "know the right people" as I said before.
Top notch for a blotter is 150-170, not 290 or some shit. Anything more is just irresponsible(to say, to lay). I too have seen it at the 200 + range, but that was geltabs. One kind out of 20 types or so. Two hits of that stuff was WAY too much for many seasoned psychedelic users. So basically, you are not going to take 2 hits and reach 500 mics no matter what you find, (even though they may be incredibly good hits). Too many of the wrong people have gotten word of the "microgram", and they use it and abused it. Even dead/phish lots have been tainted by this so called knowledge of dose per hit. I have never bought a hit from a hipster that was not supposedly considered to be"strong", or even more often, 250 mics+......lol Its always bullshit. They may be strong, but they are never anywhere close to 250 mics, not even 200 mics. The best lsd I have had were 150-170 mic blotters. I dont even consider the 230 mic geltabs to be a part of the norm. 2 of those gels would scare the shit out of most people. Just because of how many people eat 2 hits or more at once. AGain that was damn near irresponsible on the part of those who laid the shit. That was not made for the general public though. Thats why I know so much about potency and dose. I do "know" this is true. Its just fun speaking the truth when you can find so many people who dont agree with you.
your blotters are not going to exceed 170 mics. 170 mics are supreme lsd tabs. I have tried enough to know this. I have known the right people(person) to know this.
So there is my little lecture on micrograms. You dont have to believe it, but its true. All of that 200+ mic lsd is probably no more than 130-160 mics per hit.
 
i said the same thing in the ODD thread, basically.. 250mics is a lot.. I remember reading in 2000-2001 on one of the DEA newsletters, i think, that the average dose of LSD tested contained ~70mics. I doubt it's gone up much from then...

yos-
|
Poseydon
Poseynous


Registered: 09/11/06
Posts: 135
Loc: Finland/Estonia
Last seen: 14 years, 4 months
|
Re: The Shroomery LSD Museum [Re: Yoschie99]
#6638315 - 03/05/07 04:31 PM (16 years, 10 months ago) |
|
|
7 hits of some lucy my friend has right now.

--------------------
|
RookieShroomie
Shuras labassistant



Registered: 05/14/07
Posts: 294
Loc: [ˈbundəsʁepu
Last seen: 7 years, 9 months
|
Re: The Shroomery LSD Museum [Re: Poseydon]
#7075181 - 06/21/07 12:58 PM (16 years, 7 months ago) |
|
|

Yummy acid in Germany. Obtained from mai to june 07
-------------------- Have a nice trip!
 
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: The Shroomery LSD Museum [Re: Yoschie99]
#7075357 - 06/21/07 01:43 PM (16 years, 7 months ago) |
|
|
Quote:
Yoschie99 said:
Quote:
yageman said: Just so people know, if you eat the right acid, know the right people, and read alot about the doses needed to trip you will pretty much arrive at the conclusion that 99% of hits dont go above 150 mics per hit.
I figured Id just waist my time to say this.
I seldom hear about people getting hits that are less than 250 mics around here. This helps to bring me to the conclusion that most people actually have no idea. To have a good idea, some people wouldnt even need to "know the right people" as I said before.
Top notch for a blotter is 150-170, not 290 or some shit. Anything more is just irresponsible(to say, to lay). I too have seen it at the 200 + range, but that was geltabs. One kind out of 20 types or so. Two hits of that stuff was WAY too much for many seasoned psychedelic users. So basically, you are not going to take 2 hits and reach 500 mics no matter what you find, (even though they may be incredibly good hits). Too many of the wrong people have gotten word of the "microgram", and they use it and abused it. Even dead/phish lots have been tainted by this so called knowledge of dose per hit. I have never bought a hit from a hipster that was not supposedly considered to be"strong", or even more often, 250 mics+......lol Its always bullshit. They may be strong, but they are never anywhere close to 250 mics, not even 200 mics. The best lsd I have had were 150-170 mic blotters. I dont even consider the 230 mic geltabs to be a part of the norm. 2 of those gels would scare the shit out of most people. Just because of how many people eat 2 hits or more at once. AGain that was damn near irresponsible on the part of those who laid the shit. That was not made for the general public though. Thats why I know so much about potency and dose. I do "know" this is true. Its just fun speaking the truth when you can find so many people who dont agree with you.
your blotters are not going to exceed 170 mics. 170 mics are supreme lsd tabs. I have tried enough to know this. I have known the right people(person) to know this.
So there is my little lecture on micrograms. You dont have to believe it, but its true. All of that 200+ mic lsd is probably no more than 130-160 mics per hit.
 
i said the same thing in the ODD thread, basically.. 250mics is a lot.. I remember reading in 2000-2001 on one of the DEA newsletters, i think, that the average dose of LSD tested contained ~70mics. I doubt it's gone up much from then...

yos-
I doubt it's gone up by a ton, but 2000-2001 was an extreme low point in lsd strength from what I witnessed.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
DoseMeHomie



Registered: 08/15/08
Posts: 2,265
Loc: 'merica
|
Re: The Shroomery LSD Museum [Re: Koala Koolio]
#9487089 - 12/24/08 01:44 AM (15 years, 1 month ago) |
|
|
We need to bring this thread back!!
-------------------- The Gospel
|
LysergicDreams
Stranger


Registered: 07/21/08
Posts: 34
Last seen: 12 years, 11 months
|
|
I just jizzed all over this topic
|
yageman
already dead


Registered: 01/26/06
Posts: 4,965
Last seen: 14 years, 9 months
|
|
Quote:
LysergicDreams said: I just jizzed all over this topic
Ya, nice dude. Cool as hell............
-------------------- [quote]Me_Roy said: You moron. Material is material is material. No 'thing' fixes any situation. If anything were so simple we would be living in a much better world.[/quote] <-----the dumbest thing I have ever read in my life. Thanks shroomery.
|
Coaster
Baʿal



Registered: 05/22/06
Posts: 33,501
Loc: Deep in the Valley
Last seen: 12 years, 3 months
|
Re: The Shroomery LSD Museum [Re: yageman]
#9487389 - 12/24/08 03:38 AM (15 years, 1 month ago) |
|
|
the one and only Doublestackittyflipill
--------------------
|
holycow
Stranger


Registered: 10/29/08
Posts: 238
Last seen: 4 years, 7 months
|
Re: The Shroomery LSD Museum [Re: Coaster]
#9489174 - 12/24/08 12:50 PM (15 years, 1 month ago) |
|
|
don't mean to clutter the thread, but damn! i am so jealous. i have never met lucy for real before. i wonder when i will be able to...
enjoy them mates!
|
Harri


Registered: 10/29/08
Posts: 1,452
|
Re: The Shroomery LSD Museum [Re: Asante]
#9664854 - 01/23/09 11:50 AM (15 years, 8 days ago) |
|
|
Rolling Stones....very nice
Edited by Harri (01/23/09 11:51 AM)
|
haymaker
Mr Psychonaut




Registered: 10/26/07
Posts: 1,374
Loc: United Kingdom
Last seen: 4 years, 2 months
|
Re: The Shroomery LSD Museum [Re: Harri]
#9664872 - 01/23/09 11:54 AM (15 years, 8 days ago) |
|
|
coaster i'm so fucking jealous... i've never seen a pic of someone who could get LSD like that before, that's amazing 
-------------------- "Make hay while the sun shines" My Trade List
|
dsotm12345
WTF!


Registered: 10/12/06
Posts: 243
Loc: Over there
|
Re: The Shroomery LSD Museum [Re: haymaker] 1
#9664926 - 01/23/09 12:08 PM (15 years, 8 days ago) |
|
|
Quote:
haymaker said: coaster i'm so fucking jealous... i've never seen a pic of someone who could get LSD like that before, that's amazing 
Coaster is not around anymore. I'm pretty sure that is MDMA crystal with some Ketamine. Not sure why he posted it here.
|
haymaker
Mr Psychonaut




Registered: 10/26/07
Posts: 1,374
Loc: United Kingdom
Last seen: 4 years, 2 months
|
Re: The Shroomery LSD Museum [Re: dsotm12345]
#9664958 - 01/23/09 12:16 PM (15 years, 8 days ago) |
|
|
what do you mean he's not around anymore? =\
and ah ok, it still made me heart jump though
-------------------- "Make hay while the sun shines" My Trade List
|
dsotm12345
WTF!


Registered: 10/12/06
Posts: 243
Loc: Over there
|
Re: The Shroomery LSD Museum [Re: haymaker]
#9664965 - 01/23/09 12:19 PM (15 years, 8 days ago) |
|
|
He got banned for something, not sure what.
|
King Koopa
Mr. Hit Dat Hoe


Registered: 06/02/08
Posts: 8,045
Loc: Houston
Last seen: 13 years, 4 months
|
|
internet explorers! thats fucking awesome
-------------------- Best Post on the Shroomery Don't criticize my mess unless you'd like to become part of it.
|
muistrue
Inspired by the mystery


Registered: 03/20/05
Posts: 12,899
Loc: Behind the Redwoods
|
Re: The Shroomery LSD Museum [Re: King Koopa] 2
#12451640 - 04/24/10 10:42 PM (13 years, 9 months ago) |
|
|
Quote:
King Koopa said: internet explorers! thats fucking awesome
I bet they make you crash on the comedown.
--------------------
|
fallenlsd
electricapricot



Registered: 07/01/08
Posts: 1,509
Loc: missouri
Last seen: 9 years, 10 months
|
Re: The Shroomery LSD Museum [Re: muistrue]
#12452177 - 04/25/10 01:48 AM (13 years, 9 months ago) |
|
|
Quote:
FractalDust said:
Quote:
King Koopa said: internet explorers! thats fucking awesome
I bet they make you crash on the comedown. 
haha nice
|
PilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 12 years, 9 months
|
Re: The Shroomery LSD Museum [Re: fallenlsd] 1
#12536380 - 05/10/10 11:04 AM (13 years, 8 months ago) |
|
|
-------------------- "The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live." If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules...
|
dwpineal
Psychedelic Artist



Registered: 07/20/06
Posts: 4,667
|
Re: The Shroomery LSD Museum [Re: PilzeEssen]
#12536555 - 05/10/10 11:50 AM (13 years, 8 months ago) |
|
|
Damn Pilze - Nice collection of pics! Great addition to the thread!
|
UtOpiaN-MiNdStAtEs


Registered: 10/25/09
Posts: 1,820
Loc: place
|
Re: The Shroomery LSD Museum [Re: Asante]
#12536848 - 05/10/10 01:02 PM (13 years, 8 months ago) |
|
|
Quote:
Wiccan_Seeker said: < <img src=https://files.shroomery.org/files/05-24/876967060-cameldose.jpg>
<img src=https://files.shroomery.org/files/05-24/888609743-Image2.jpg>
i have had the ones that are on he camel box. they were double layered and stuck together with glue. or just realy thick. they tasted horible. and im positve they were a type of DOX
--------------------
    ]KILLEER TOFFUUUUUU!!!! love life and live loving Wizard of the Night ~Peace Love and Hippy Shit~
|
UtOpiaN-MiNdStAtEs


Registered: 10/25/09
Posts: 1,820
Loc: place
|
Re: The Shroomery LSD Museum [Re: Asante]
#12536852 - 05/10/10 01:03 PM (13 years, 8 months ago) |
|
|
Quote:
Wiccan_Seeker said: <img src=https://files.shroomery.org/files/04-17/277210084-dragon_clouds.jpg>
<img src=https://files.shroomery.org/files/04-15/171500804-dragon.jpg>
<img src=https://files.shroomery.org/files/04-18/347276074-fairy_prince.jpg>
<img src=https://files.shroomery.org/files/04-25/724241897-sa.jpg>
<img src=https://files.shroomery.org/files/05-18/523435455-paper.jpg>
<img src=https://files.shroomery.org/files/05-19/606469091-L1.jpg>
<img src=https://files.shroomery.org/files/05-21/691337396-trippin_041.jpg>
<img src=https://files.shroomery.org/files/05-24/864977176-05lsd.jpg>
<img src=https://files.shroomery.org/files/05-24/876967060-cameldose.jpg>
<img src=https://files.shroomery.org/files/05-24/888609743-Image2.jpg>
the ones that look like disco . soccer balls.
--------------------
    ]KILLEER TOFFUUUUUU!!!! love life and live loving Wizard of the Night ~Peace Love and Hippy Shit~
|
fallenlsd
electricapricot



Registered: 07/01/08
Posts: 1,509
Loc: missouri
Last seen: 9 years, 10 months
|
Re: The Shroomery LSD Museum [Re: PilzeEssen]
#12536905 - 05/10/10 01:16 PM (13 years, 8 months ago) |
|
|
Quote:
PilzeEssen said:

i was given a ring with this symbol on it and told it was "my" symbol as i was a child of the third, that my soul was on its third generation
a realllly old far out lady told me this; she said a lot of things about me my energy and my life.. like without ever even meeting me
she could feel my energy through my gf, and distinguish the two and pull them a part and whatnot
and tell me DEEP shit about myself over the phone after my girlfriend dialed it for her lol
she went to woodstock and all that
but before i got to learn from her she died
|
LuckeyMA
I catapult downtown...



Registered: 08/06/09
Posts: 2,231
Last seen: 5 years, 9 months
|
Re: The Shroomery LSD Museum [Re: fallenlsd]
#12536934 - 05/10/10 01:22 PM (13 years, 8 months ago) |
|
|
THATS the ohm symbol
-------------------- "Consciousness survives the death of the body on which it rides"... *Disclaimer* Everything written from this account are meant for amusement purposes ONLY. Everything written or posted from this account are NOT TRUE.
|
fallenlsd
electricapricot



Registered: 07/01/08
Posts: 1,509
Loc: missouri
Last seen: 9 years, 10 months
|
Re: The Shroomery LSD Museum [Re: LuckeyMA]
#12536940 - 05/10/10 01:24 PM (13 years, 8 months ago) |
|
|
right, & the crown chakra
i don't know if she just said it was my symbol because of the 3 and that whole "soul in the third generation" thing
she could've been old and ate too much LSD but she was more than spot on with everything else she said
|
LuckeyMA
I catapult downtown...



Registered: 08/06/09
Posts: 2,231
Last seen: 5 years, 9 months
|
Re: The Shroomery LSD Museum [Re: fallenlsd]
#12536990 - 05/10/10 01:34 PM (13 years, 8 months ago) |
|
|
like what?
sometime people can get really good at sounding like they know shit about you but they play of your response and shit... ya know...
-------------------- "Consciousness survives the death of the body on which it rides"... *Disclaimer* Everything written from this account are meant for amusement purposes ONLY. Everything written or posted from this account are NOT TRUE.
|
fallenlsd
electricapricot



Registered: 07/01/08
Posts: 1,509
Loc: missouri
Last seen: 9 years, 10 months
|
Re: The Shroomery LSD Museum [Re: LuckeyMA]
#12537089 - 05/10/10 01:50 PM (13 years, 8 months ago) |
|
|
true but i didnt really give her any response
she held my gfs hand and then proceeded to describe me to a T, then my girlfriend was shocked and told me she was going to call me for this old lady
she wasn't an old lady on the street or an old lady acting like she had powers or anything
my gf's dad is like 50 and was friends with this old woman and then this old woman mentioned to my gf how she was cool and she knew an old lady that my gf might be able to learn from.. gave her the number and my gf started just hanging out with this lady
this lady started just talking and my gf learned a lot of shit, i used to get like a transcript of it all from my gf on an old phone this happened last year anywhere in between 08/09 - 11/09 i dont remember, if i can find that phone i had saved one of the texts because it blew my fucking mind
|
LuckeyMA
I catapult downtown...



Registered: 08/06/09
Posts: 2,231
Last seen: 5 years, 9 months
|
Re: The Shroomery LSD Museum [Re: fallenlsd]
#12537119 - 05/10/10 01:55 PM (13 years, 8 months ago) |
|
|
hmmm...
Isn't the ohm symbol the symbol of life?
How is the third level mang? why can't you get you ass up here to the forth level with the rest of us...haha jk...
sound crazy... maybe she snorted lots of fluff...
-------------------- "Consciousness survives the death of the body on which it rides"... *Disclaimer* Everything written from this account are meant for amusement purposes ONLY. Everything written or posted from this account are NOT TRUE.
|
PilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 12 years, 9 months
|
Re: The Shroomery LSD Museum [Re: LuckeyMA]
#12539775 - 05/10/10 08:41 PM (13 years, 8 months ago) |
|
|
the ankh is the symbol of life.
-------------------- "The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live." If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules...
|
Narttram
Shipwrecked Frontier Pioneer



Registered: 03/22/09
Posts: 114
Loc: Germany
Last seen: 12 years, 5 months
|
Re: The Shroomery LSD Museum [Re: PilzeEssen]
#12541747 - 05/11/10 07:03 AM (13 years, 8 months ago) |
|
|
 Dalai Lama blotters from Germany, pretty potent as far as I can tell.
|
dwpineal
Psychedelic Artist



Registered: 07/20/06
Posts: 4,667
|
Re: The Shroomery LSD Museum [Re: Narttram]
#12541851 - 05/11/10 07:49 AM (13 years, 8 months ago) |
|
|
Can you get a better pic? Looks like a neat print, but really hard to make out...
|
Narttram
Shipwrecked Frontier Pioneer



Registered: 03/22/09
Posts: 114
Loc: Germany
Last seen: 12 years, 5 months
|
Re: The Shroomery LSD Museum [Re: dwpineal]
#12542645 - 05/11/10 11:57 AM (13 years, 8 months ago) |
|
|
Sadly most of them are gone by now (the other pic was an older one), but I tried to get some better shots at them.

|
fallenlsd
electricapricot



Registered: 07/01/08
Posts: 1,509
Loc: missouri
Last seen: 9 years, 10 months
|
Re: The Shroomery LSD Museum [Re: LuckeyMA]
#12546041 - 05/11/10 10:11 PM (13 years, 8 months ago) |
|
|
Quote:
LuckeyMA said: hmmm...
Isn't the ohm symbol the symbol of life?
How is the third level mang? why can't you get you ass up here to the forth level with the rest of us...haha jk...
sound crazy... maybe she snorted lots of fluff...
lol idk but i was thinking about it and maybe i had already completed a good part of the path in a past life because everybody around me doesn't really think deep or meditate i guess, and i've never really meditated but my entire life i have always had consciousness awareness to the point where i'm constantly thinking deep no matter what i was doing, all my thoughts i recognized as simply thoughts i could let go without being attached to i could like focus on my breathing and bring myself back to that anchor of happiness even when talking playing doing shit, at school doing whatever and anything and i never even knew it was meditation i was just doing it because i liked to think and i thought EVERYBODY did this.. like i experienced lots of shit that i just assumed was everyday stuff then i started tripping and i've always been able to handle whatever psychedelics i have (so far :P)even when i'm freaking the fuck out and have to remind myself i'm tripping multiple times a minute whereas people around me cannot and these people when i trip with them and help them through their trip they tell me it seems like i am a guide to their trip; like i was supposed to take them on a voyage, even though i sit there quietly normally and don't try to cloud up others thoughts.
anyways i started learning about meditation and realized that meditation is what i've been doing for most of my life that i can remember..and when people described meditation to me i was like what? that's it? i do that ALL the time without even thinking about it; every time i get a free second to myself i connect back to the breathing and let my mind unwind so all those thoughts in my head work themselves out and then i'm free to just sit and think whenever i have an issue or a problem; something to approach; an argument maybe, 9/10 times i'm going to see it in my head from both sides after i get the stories and then react in the best interests of whoever is asking for help; just because i keep myself thinking straight and not let emotion run my mouth or get me in trouble; this taking a step back thing is reallly wonderful and i'm glad i can do it without thinking, like i know some people that blindly only see one side to their issues and it's like wtF?
i thought i was retarded because i couldn't get that meditation was just the same shit i was doing but i didn't know it was something to do i thought it just was.. and i just googled any mediation readings i could find and read them and realized i already knew it
maybe i realized the value of meditation a long one of my past lives and took it with me to this life as a sort of tool set?
and then the people who are starting meditation and it takes them a long time to see results or "get it " - for lack of a better phrase not saying you guys dont understand i know you do - is only because this is the life where they decided to take up meditation ya know?
that could be crazy talk from the old lady and i could've followed it to far down the rabbit hole one night but i'm open to either option without the results breaking me :P
either way it's something to think about
|
woodruss67
barely here ,almost there



Registered: 03/20/10
Posts: 562
Last seen: 11 years, 1 month
|
Re: The Shroomery LSD Museum [Re: fallenlsd]
#12696518 - 06/06/10 11:07 AM (13 years, 7 months ago) |
|
|
would it be a bad idea to get blotter through mail? just is nowhere to be found, not for years round here.? i mean i know its not smart,but what other options for this are there for me, other than just forget about it, haha.
-------------------- everything i post is only in reference to my alternate persona's , and is based on their needs to fit in. woodruss.
|
PilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 12 years, 9 months
|
Re: The Shroomery LSD Museum [Re: woodruss67]
#12696806 - 06/06/10 12:05 PM (13 years, 7 months ago) |
|
|
-------------------- "The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live." If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules...
|
King Koopa
Mr. Hit Dat Hoe


Registered: 06/02/08
Posts: 8,045
Loc: Houston
Last seen: 13 years, 4 months
|
Re: The Shroomery LSD Museum [Re: PilzeEssen]
#12696813 - 06/06/10 12:06 PM (13 years, 7 months ago) |
|
|

you're the fucking man Plize
-------------------- Best Post on the Shroomery Don't criticize my mess unless you'd like to become part of it.
|
GoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,766
Loc: VENUS
Last seen: 1 year, 7 days
|
Re: The Shroomery LSD Museum *DELETED* [Re: King Koopa]
#12696890 - 06/06/10 12:24 PM (13 years, 7 months ago) |
|
|
Post deleted by HofmannBlotterReason for deletion: Wrong links and triple post
Edited by GoddessOfLove (06/06/10 12:27 PM)
|
GoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,766
Loc: VENUS
Last seen: 1 year, 7 days
|
Re: The Shroomery LSD Museum *DELETED* [Re: GoddessOfLove]
#12696942 - 06/06/10 12:33 PM (13 years, 7 months ago) |
|
|
Post deleted by HofmannBlotterReason for deletion: Wrong links
Edited by GoddessOfLove (06/06/10 12:36 PM)
|
GoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,766
Loc: VENUS
Last seen: 1 year, 7 days
|
|
Afoaf contributions 
They are LSD except for the Bugs Bunny which are DOI. The stuff is from Belgium they are very good and DOI dosage is 2mg.
Apologize for my english and enjoy !
For people who can't see what is it :

Bugs Bunny Blotter - DOI 2Mg

Super Mario Bros - 120µg

Fat Freddy's Cat - 120µg

Jesus Christ On Acid - 80µg

Mickey Mouse Acid - 80µg

Hofmann's 1943-2005 Blotter - 100µg

Bart Simpsons 2001 Edition - 120µg

Mash Up

Beavis And Butthead The Psychedelic Experience - 150µg

All Seeing Eye Pyramid - 80µg
Mickey Mouse Acid - All Seeing Eye Pyramid - Beavis and Butthead the psychedelic experience - Super Mario Bros - Hofmann 1943-2005 - Jesus Christ On Acid - DOI Bugs Bunny - Fat Freddy's Cat - Bart Simpson's 2001 Edition
He have also a nice sheet of Lady GaGa's LSD Blotter but i'll upload it later cuz i need to go 
Peace
--------------------
Edited by GoddessOfLove (06/06/10 01:30 PM)
|
PilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 12 years, 9 months
|
|
upload them to the shroomery. click "pics" at the top left of the screen, right under your screen name. then upload them and post them.
-------------------- "The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live." If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules...
|
GoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,766
Loc: VENUS
Last seen: 1 year, 7 days
|
Re: The Shroomery LSD Museum [Re: PilzeEssen]
#12697261 - 06/06/10 01:29 PM (13 years, 7 months ago) |
|
|
Links Fix'd ! Thanks Shroomey
Edited by GoddessOfLove (06/06/10 01:30 PM)
|
The Vapor
Lost In A Tea Daze


Registered: 03/22/10
Posts: 8,433
Loc: Misty Mountains, B.C.
Last seen: 1 year, 10 months
|
|
How do you know the dosage on those HofmannBlotter?
--------------------

|
GoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,766
Loc: VENUS
Last seen: 1 year, 7 days
|
Re: The Shroomery LSD Museum [Re: The Vapor]
#12702141 - 06/07/10 09:18 AM (13 years, 7 months ago) |
|
|
I don't know if i can speak about this, but trust me i know how many µg these sheets have been layed originally. Hope you understand and sorry for my bad english
--------------------
|
The Vapor
Lost In A Tea Daze


Registered: 03/22/10
Posts: 8,433
Loc: Misty Mountains, B.C.
Last seen: 1 year, 10 months
|
|
Yeah I understand what your talking about, and no need to apologize for your English, it seems pretty good to me.
Thanks for sharing those awesome pictures by the way.
--------------------

|
GoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,766
Loc: VENUS
Last seen: 1 year, 7 days
|
Re: The Shroomery LSD Museum [Re: The Vapor]
#12707450 - 06/08/10 06:09 AM (13 years, 7 months ago) |
|
|
No problem I'll upload more in da future !
Peace Out
--------------------
|
Evolution



Registered: 02/27/10
Posts: 282
Loc: Somewhere in time and spa...
Last seen: 12 years, 3 months
|
Re: The Shroomery LSD Museum [Re: Asante]
#12719822 - 06/10/10 10:12 AM (13 years, 7 months ago) |
|
|

Does anyone recognize these? On front they have a colored print and on the back a (unknown) figure in black lines.
-------------------- - Convictions are more dangerous enemies of truth than lies - F.W. Nietzche
|
Dr. Siekadellyk
Look at the corruption!




Registered: 11/19/08
Posts: 2,580
Loc: Floating amidst nothing
|
Re: The Shroomery LSD Museum [Re: Evolution]
#12719846 - 06/10/10 10:18 AM (13 years, 7 months ago) |
|
|
-------------------- -My ISO list- -My trade list-
|
Evolution



Registered: 02/27/10
Posts: 282
Loc: Somewhere in time and spa...
Last seen: 12 years, 3 months
|
Re: The Shroomery LSD Museum [Re: Evolution]
#12719906 - 06/10/10 10:36 AM (13 years, 7 months ago) |
|
|
-------------------- - Convictions are more dangerous enemies of truth than lies - F.W. Nietzche
|
PilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 12 years, 9 months
|
Re: The Shroomery LSD Museum [Re: Evolution]
#12719935 - 06/10/10 10:43 AM (13 years, 7 months ago) |
|
|
yuuup. thats the alex grey/ganesh print. i still havent gotten to eat any yet.
-------------------- "The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live." If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules...
|
GoddessOfLove
Mother Monster


Registered: 01/10/10
Posts: 3,766
Loc: VENUS
Last seen: 1 year, 7 days
|
Re: The Shroomery LSD Museum [Re: PilzeEssen]
#12719964 - 06/10/10 10:50 AM (13 years, 7 months ago) |
|
|
It's look like shiva to me :\ no ?
--------------------
|
PilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 12 years, 9 months
|
|
shiva isnt an elephant
-------------------- "The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live." If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules...
|
Evolution



Registered: 02/27/10
Posts: 282
Loc: Somewhere in time and spa...
Last seen: 12 years, 3 months
|
Re: The Shroomery LSD Museum [Re: PilzeEssen]
#12720920 - 06/10/10 02:25 PM (13 years, 7 months ago) |
|
|
How many mcg does one hit contain? Don't know if they are of the same batch/source though.
-------------------- - Convictions are more dangerous enemies of truth than lies - F.W. Nietzche
Edited by Evolution (06/10/10 02:27 PM)
|
PilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 12 years, 9 months
|
Re: The Shroomery LSD Museum [Re: Evolution]
#12721249 - 06/10/10 03:27 PM (13 years, 7 months ago) |
|
|
i got mine at a festival last summer from an older hippy dude. he said to be careful because some of the greys were dosed twice as strong as others. i THINK he said they were 120 and 240. he said some old hippy ate 2 and ended up in safestock. (where you go when you get too fucked up)
-------------------- "The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live." If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules...
|
Evolution



Registered: 02/27/10
Posts: 282
Loc: Somewhere in time and spa...
Last seen: 12 years, 3 months
|
Re: The Shroomery LSD Museum [Re: PilzeEssen]
#12721422 - 06/10/10 03:59 PM (13 years, 7 months ago) |
|
|
That's the downside of acid IMO that I can't say how much I will dose myself.
*need to find a reliable source*
-------------------- - Convictions are more dangerous enemies of truth than lies - F.W. Nietzche
|
DoseInTheWoods3420
LSD Connoisseur



Registered: 10/06/09
Posts: 1,134
Loc: wherever im needed
Last seen: 8 years, 3 months
|
Re: The Shroomery LSD Museum [Re: Evolution]
#12721740 - 06/10/10 04:56 PM (13 years, 7 months ago) |
|
|
those greys had a taste like the hoffmans which makes me think its the same source.
--------------------
You're either on the bus, or off the bus everything i say is complete and utter bulshit
|
PilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 12 years, 9 months
|
|
Quote:
DoseInTheWoods3420 said: those greys had a taste like the hoffmans which makes me think its the same source.
the dude i got them from said its from the same source. and that its the same "crystal" as the hofmann originals. which were strong as fuck.
-------------------- "The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live." If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules...
|
Kman1898
Dr. Learn'd



Registered: 11/17/12
Posts: 1,192
Loc: A Park
Last seen: 2 years, 3 months
|
Re: The Shroomery LSD Museum [Re: PilzeEssen]
#21056708 - 01/02/15 01:28 PM (9 years, 28 days ago) |
|
|
here's some more to revive this thread and get the museum collection going!!
-------------------- Difficulty has more to do with reading abillity and ability to precisely follow directions. You need no knowledge of chemistry whatsoever, you just need to understand some basic principles as simple in concept as: water boils at 100C and freezes at 0C. Otherwise all published syntheses of organic and inorganic compounds can be reproduced successfully by pretty nearly anyone with at least average intelligence. Problems always have to do with availability of materials, not esoteric knowledge.
|
Libertycapper
Doctor Banner



Registered: 11/13/04
Posts: 688
Loc: British Columbia
|
Re: The Shroomery LSD Museum [Re: Kman1898] 1
#21058189 - 01/02/15 08:05 PM (9 years, 28 days ago) |
|
|
very potent.....i have done acid over the course of my 49 years many times and one third of a hit of these is equal to a full hit or even two hits of anything else I have ever dosed that was bought as acid. I really wish someone would confirm they are what I think they are....really potent doses.... and not some RC this old hippie has no interest in! I think thy are the many hands of shiva PEACE .
|
my3rdeye



Registered: 08/10/12
Posts: 4,354
Loc: Canada
Last seen: 2 years, 8 months
|
|
Quote:
Libertycapper said: very potent.....i have done acid over the course of my 49 years many times and one third of a hit of these is equal to a full hit or even two hits of anything else I have ever dosed that was bought as acid. I really wish someone would confirm they are what I think they are....really potent doses.... and not some RC this old hippie has no interest in! I think thy are the many hands of shiva PEACE .

Those are confirmed real, from the hunab crew. Two years ago at shambles that print put a bunch of kids in the chill out tent because they were "too strong".
|
Libertycapper
Doctor Banner



Registered: 11/13/04
Posts: 688
Loc: British Columbia
|
Re: The Shroomery LSD Museum [Re: my3rdeye]
#21062378 - 01/03/15 05:17 PM (9 years, 27 days ago) |
|
|
thanks for responding!!! I have a test kit coming to confirm what you are confirming.
|
Chronic7
Registered: 05/08/04
Posts: 13,679
|
|
--------------------
|
Asante
Mage


Registered: 02/06/02
Posts: 86,795
|
Re: The Shroomery LSD Museum [Re: Chronic7]
#25077954 - 03/20/18 03:09 PM (5 years, 10 months ago) |
|
|
Spanning 12 years of LSD prints, please keep adding!
-------------------- Omnicyclion.org higher knowledge starts here
|
Jersey_Devil
Lightening Seeker



Registered: 09/05/17
Posts: 168
Loc: Deep in the Pine Barons
Last seen: 2 years, 9 months
|
Re: The Shroomery LSD Museum [Re: Asante] 2
#25507244 - 10/02/18 07:14 PM (5 years, 3 months ago) |
|
|
This was a new one was a gift. Dance on...
|
BoolLord
Stranger
Registered: 07/12/19
Posts: 3
Last seen: 4 years, 5 months
|
|
Have you tested those? I was at a festival and bought some, then heard from a more reputable dealer that the dancing bears were questionable; but that might have just been two dealers duking it out lmao
|
mapleleafmarijuana
Archaeotek Magos



Registered: 03/08/12
Posts: 9,063
Loc: Alberta, Canada
|
Re: The Shroomery LSD Museum [Re: BoolLord] 3
#27493410 - 10/05/21 10:15 AM (2 years, 3 months ago) |
|
|
Bump, lets get this thread going!
-------------------- Vinegar Tom stay black cocksucker, thats the most important thing - joey coco diaz Flesh is Weak. All Hail the Machine God!
|
junker82317
Stranger


Registered: 02/27/21
Posts: 174
Last seen: 10 months, 15 days
|
|
|
mapleleafmarijuana
Archaeotek Magos



Registered: 03/08/12
Posts: 9,063
Loc: Alberta, Canada
|
Re: The Shroomery LSD Museum [Re: junker82317] 4
#27497519 - 10/08/21 03:43 PM (2 years, 3 months ago) |
|
|
-------------------- Vinegar Tom stay black cocksucker, thats the most important thing - joey coco diaz Flesh is Weak. All Hail the Machine God!
|
connectedcosmos
Neti Neti



Registered: 02/07/15
Posts: 7,426
Loc: The Pathless Path
|
|
--------------------
 54. The true nature of things is to be known personally , through the eyes of clear illumination and not through a sage : what the moon exactly is , is to be known with one's own eyes ; can another make him know it?
|
mapleleafmarijuana
Archaeotek Magos



Registered: 03/08/12
Posts: 9,063
Loc: Alberta, Canada
|
|
-------------------- Vinegar Tom stay black cocksucker, thats the most important thing - joey coco diaz Flesh is Weak. All Hail the Machine God!
|
Psicomb



Registered: 01/13/18
Posts: 4,635
Loc: the womb
|
|
--------------------
When we constantly pull things apart trying to see how it works, we may end up with only an understanding of how to destroy something - nick sand
|
The Blind Ass
Bodhi



Registered: 08/16/16
Posts: 26,657
Loc: The Primordial Mind
|
Re: The Shroomery LSD Museum [Re: Psicomb] 1
#27505903 - 10/15/21 07:49 PM (2 years, 3 months ago) |
|
|
You degenerates! Don’t you know you are scrambling and breaking down DNA when you take acid! Jk - nice sheets and gels bois 
How I wish I could acid away my dna right now . When will the lsd rain down upon us from the sky! Fungi is what I’ve been keeping to lately since sources went dry for Lucy, but I like them …so primal….like tapping into the force from Star Wars when it goes well. Or the Spice from dune but without addiction. God bless Hoffman & Mother Nature
-------------------- Give me Liberty caps -or- give me Death caps
|
Reticulated
Homo Reticulus



Registered: 08/24/21
Posts: 129
Loc: Scotland
|
|
Quote:
mapleleafmarijuana said:

That’s a very nice print.
I miss acid!!
--------------------
|
Psicomb



Registered: 01/13/18
Posts: 4,635
Loc: the womb
|
Re: The Shroomery LSD Museum [Re: Reticulated]
#27526793 - 11/01/21 07:16 PM (2 years, 2 months ago) |
|
|
     
Some of my pickups the last few years

I luv lsd so fuckin much
|
|