|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
salvia sucks!
#5341554 - 02/26/06 03:43 PM (17 years, 10 months ago) |
|
|
well im still technicall on it
it only happened 10 minutes ago... no peak... no loss of conciousness that would proke me to think im on seom5thing.
although i do feel really weird right now.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
i held it in as long as possible... smoked almost the whole gram... i had to repack a few times..... held it in as long as possible
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Weeded420
All Grown Up

Registered: 11/17/05
Posts: 206
Loc: Colorado
Last seen: 4 years, 7 months
|
|
i think u suck not salvia...if you smoke a whole gram, and not breakthrough thats your fault, not the drugs.
|
abrad84
Stranger


Registered: 10/15/05
Posts: 1,128
|
Re: salvia sucks! [Re: Weeded420]
#5341564 - 02/26/06 03:46 PM (17 years, 10 months ago) |
|
|
Reverse tolerance probably. Lots of people are disapointed with it at first. Its not his fault he didn't break through, it just happens.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: Weeded420]
#5341566 - 02/26/06 03:47 PM (17 years, 10 months ago) |
|
|
i did everything i was supposed to do. didnt use a torch lighter.
held in so many.
the last one just burst out of me cause it hurt
did it in a completely black room.... i think music and lights would have been better.
i still have some left... another hit or two... should i smoke it now or wait?
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
it felt really weird... like my whole body was being "scanned" by something and i could feel it move up my body, my face and then faded to scan my brain.
i dunno it was really weird.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
ClammyJoe
Azurescen Head



Registered: 11/03/05
Posts: 3,691
Loc: PNW
Last seen: 11 years, 1 month
|
|
If you didn't break through, hurry and try again, and if you still get nothing, you need a stronger extract.
|
abrad84
Stranger


Registered: 10/15/05
Posts: 1,128
|
|
You should save the rest for another time and try again, if you want. If you smoked nearly a gram you should probably leave it for now.
|
Fruitboot
Stranger
Registered: 10/04/05
Posts: 417
Last seen: 12 years, 23 days
|
|
Are you smoking an extract or just the leaves?
|
EquilibriuM
dream stalker

Registered: 07/17/05
Posts: 2,323
Last seen: 16 years, 7 months
|
|
you shouldnt disrespect salvia like that.
-------------------- HELP!!!!!!!!!
|
shriek
*********

Registered: 12/13/03
Posts: 3,274
|
Re: salvia sucks! [Re: Weeded420]
#5341578 - 02/26/06 03:50 PM (17 years, 10 months ago) |
|
|
was it one gram with leaves or extract? i didnt break trough for a long time on salvia, what i did was to mix salvia into weed and chewed on leaves that fell off my plant for some time, maybe 3-4 months. i got mild effects all the time. one day i smoked a bowl of leaves and things turned out diffrent, i closed my eyes and a million things started to happend, and after that i have gotten better and better effects from it. i have yet to try extract from salvia. but my preffered method today is chewing leaves.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: shriek]
#5341596 - 02/26/06 03:54 PM (17 years, 10 months ago) |
|
|
it was 10x extract from shamans palace.
i think its better i just try it again the first time.
im not saying it was a failed event... just didnt break through into a "psychedelic conciousness" like i thought.
like some people said... maybe not your first time you will break through. and hopefully reverse tolerance works.
its hard to get everyone out of the house at once for an event like this... im really sad i didnt break through the first time.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
if its worth to try again now though i will.... let me know someone.
man this shit is harsh on the lungs too! i only smoke weed so anyhting else kills me... even weed does.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
next time i would definitally get at least 20x though.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
beavis190
(.Y.)'s


Registered: 01/25/06
Posts: 432
Loc: lost in my head
|
|
take the fattest hit possible and count to 30 in ur head one u hit 30 exhale and u should trip.worked for me
--------------------
Confucius Says ... Man who put cock in Peanut Butter jar is Fucking Nuts. Man with tool in woman mouth May not necessarily be dentist. Schoolboy who play with schoolgirl during wrong period, get caught red-handed. He who fish in other's hole often catch crabs. Man who go to sleep with itchy butt, wake with smelly fingers... Man young when he snatches kisses, old when he kisses snatches.
|
Weeded420
All Grown Up

Registered: 11/17/05
Posts: 206
Loc: Colorado
Last seen: 4 years, 7 months
|
Re: salvia sucks! [Re: shriek]
#5341619 - 02/26/06 03:59 PM (17 years, 10 months ago) |
|
|
i dont see why so many people have so much trouble breaking through on salvia. The first hit me and a lot of people i know ever smoked salvie was out of a regular pipe with a regular lighter, and we were all blasted somewhere else. I started with 10x and usually smoke 20x if im visiting sally.
of course we use a torch lighter now when one is available but if not a regular lighter works jus fine as long as u keep the flame on the whole time.
Oh and mixing salvia with weed is great.!!
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: Weeded420]
#5341622 - 02/26/06 04:00 PM (17 years, 10 months ago) |
|
|
im about to go smoke a regular bowl of weed unless it would be worth it right now for me to try again. is it too soon?
still feel goofy though.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
beavis190
(.Y.)'s


Registered: 01/25/06
Posts: 432
Loc: lost in my head
|
Re: salvia sucks! [Re: Weeded420]
#5341629 - 02/26/06 04:01 PM (17 years, 10 months ago) |
|
|
yea first time i tried i used 10x and it was incredible....just....AMAZING..
--------------------
Confucius Says ... Man who put cock in Peanut Butter jar is Fucking Nuts. Man with tool in woman mouth May not necessarily be dentist. Schoolboy who play with schoolgirl during wrong period, get caught red-handed. He who fish in other's hole often catch crabs. Man who go to sleep with itchy butt, wake with smelly fingers... Man young when he snatches kisses, old when he kisses snatches.
|
beavis190
(.Y.)'s


Registered: 01/25/06
Posts: 432
Loc: lost in my head
|
Re: salvia sucks! [Re: beavis190]
#5341633 - 02/26/06 04:02 PM (17 years, 10 months ago) |
|
|
wait till u are completely sober then try again...take some deep breathes b4 u smoke again
--------------------
Confucius Says ... Man who put cock in Peanut Butter jar is Fucking Nuts. Man with tool in woman mouth May not necessarily be dentist. Schoolboy who play with schoolgirl during wrong period, get caught red-handed. He who fish in other's hole often catch crabs. Man who go to sleep with itchy butt, wake with smelly fingers... Man young when he snatches kisses, old when he kisses snatches.
|
ClammyJoe
Azurescen Head



Registered: 11/03/05
Posts: 3,691
Loc: PNW
Last seen: 11 years, 1 month
|
|
two good hits of 15x is the most I've ever seen anyone need to break through
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
I can feel a half of a leaf(no extract) put ontop of weed easily, and its very interesting. You could have made the title "salvia didnt work for me the first time", but you went with "salvia sucks".
Take a 2 massive rips of that 10x youve got, and if you dont feel it, your likely a hard head, and thats not a good thing. It usually means you dont know what to look for, and you know nothing about you own head or hallucinogens for that matter. Even if the 10x was really 5x, it should still work really well.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: stemmer]
#5341645 - 02/26/06 04:05 PM (17 years, 10 months ago) |
|
|
ehh i put salvia sucks to get more people in my thread... everything is about marketing these days isnt it? 
should i go try again?
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
beavis190
(.Y.)'s


Registered: 01/25/06
Posts: 432
Loc: lost in my head
|
Re: salvia sucks! [Re: stemmer]
#5341647 - 02/26/06 04:06 PM (17 years, 10 months ago) |
|
|
5x was not that good for me i felt it but no visuals it was still awsome
--------------------
Confucius Says ... Man who put cock in Peanut Butter jar is Fucking Nuts. Man with tool in woman mouth May not necessarily be dentist. Schoolboy who play with schoolgirl during wrong period, get caught red-handed. He who fish in other's hole often catch crabs. Man who go to sleep with itchy butt, wake with smelly fingers... Man young when he snatches kisses, old when he kisses snatches.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: beavis190]
#5341656 - 02/26/06 04:07 PM (17 years, 10 months ago) |
|
|
id have to say the "scanning" i experienced was some weird shit!
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
F it im going to try again.
brb.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Lakefingers

Registered: 08/26/05
Posts: 6,440
Loc: mumuland
|
|
in salviaspace now, agoutihead?
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
And smoke a bunch within about 30 seconds, because you really dont get it.
|
tiny_rabid_birds
Nocturnal


Registered: 11/08/05
Posts: 15,653
Loc: estados unidos
|
Re: salvia sucks! [Re: beavis190]
#5341697 - 02/26/06 04:18 PM (17 years, 10 months ago) |
|
|
I just made my own 10x extract from an oz of leaves I got from iamshaman, using 95% ethyl alcohol for the extraction. I tried it out last night, took a rip and a half from a makeshift 1-liter bong and I was completely gone. I'm not sure I liked it, I got SOOOO confused, it was insane. Like I forgot most of the details about my life and I thought I existed in a 2-D pattern.. and for some reason I felt distraught. The people hanging out with me seemed so foriegn, I almost forgot who they were.
It was straight up fuckin crazy.
--------------------
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
"salvia sucks"
You're not the first person to think of a clever thread title like this.
You'd better hope it doesn't work this second time, she'll make you pay.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
smoked more
no break through..
effects like small dosage of lsd... three weekends ago i did 180 micrograms... this feels like about 25
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
i still took it as respect... like i said the "salvia sucks" was just a marketing tool for the forum.
i smoked more.... its like very low dosage of lsd, which is cool cause everything is weird... alexgrey.com is fun but i just need a higher dosage i guess.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
ExplosiveMango
HallucinogenusDigitallus


Registered: 07/12/05
Posts: 3,222
Last seen: 14 years, 2 months
|
Re: salvia sucks! [Re: shriek]
#5341756 - 02/26/06 04:36 PM (17 years, 10 months ago) |
|
|
The first time I 'broke through' on salvia space filled with imaginary barriers and forces. It was almost like I was thrown around the room. Crazy cool stuff.
I took about .2 of 6x standardized extract and held it in for a good 70 seconds, maybe a little longer.
-------------------- Know your self. Know your substance. Know your source. The most distorted perspective possible is the perspective that yours is not distorted.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
see my problem is its hard for me to hold it in long. i dont think i can even reach 30 seconds. well i couldnt... unless i was just really really counting slow... which i might have. heh
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
No one should need a higher dosage than a gram of 10x, heh. Either technique or shitty salvia on shamanspalace's part. Maybe they got it from the same supplier as their old peruvian torch, and it's really just oak leaves or something. As I've not heard a single report of that torch being anything at all.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
YOu really are returning to the internet after a fat hit or 2 of 10x. Well let me be the first to say, the visuals can be amazing, but they are NOTHING like LSD. They are more similare to shrooms, but are obviously very different still. I just think your looking to party, and play with psychedelics. If that is not the case then wait a week and then try a massive dose. Then you might understand why it has been called "one of the most potent psychedelics". Otherwise, I dont know what to say.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
hmm. it smelled like dirt... litereally dirt.
so i dunno what that means.
like i said it still fucked me up... but no peak... no mutation into the "psychedelic conciousness" just everything was kinda weird... when i finished the first bowl i decided to get up to get more cause it wasnt doing much and it was really hard to stand.. that felt weird too... eventually went to my knees cause i had to get the stuff and that felt weird too... packing it up again was kinda hard... but not impossible obviously.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Lakefingers

Registered: 08/26/05
Posts: 6,440
Loc: mumuland
|
|
Hang in there. I have a feeling it's going to whirl your body backward and outward, and run your mind over like a thousand freight trains.
Are you using a bong now?
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
no no, not looking to just party... i take this very serilously... i make it as though its an experiment and try and push my mind as far as possible and to see what i can learn/understand and bring that back and try to apply it to my everyday life in order to improve it.
even though i couldnt hold the hit long enough (i still did at least 20 seconds... 25 or so) shouldnt smoking an entire whole gram in general be enough to make me blast off?
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
yeah i used a nice glass water bong and everything.
the only thing i didnt do, but i followed elgrs advise was using a torch... i just used a regular bic.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
by the way i did this by myself, no sitter or anything.
there was a pug, but she didnt say much. heh.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Mezcal
Registered: 08/11/05
Posts: 1,980
|
|
regular bic lighters work well for me.
sometimes, smoking the same samples of a high quality extract will have different effects on me. sometimes it's like being drunk or on dxm or something, sometimes its like being supremely stoned... other times its like a huge dose of freebase DMT.
i find that it's best to be ready for any of the above, but it generally depends on set and setting more than anything else.
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
Aw man Im sorry. I dont know anyone who doesnt find salvia to be almost explosive. Ive never used a torch, just a regulare bic. Even if I have smoked it 3 times in a row with a break inbetween, I can easily feel it and it is always very interesting. Maybee thats because I had tripped about 100 times on other substances before I ever tried it. I dont know what the hell your problem is, and I dont want to call you an idiot.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
yeah im gonna buy like 30x or 40x next time...
ill have enough that if i need a big dose of that i will have enough
and if it comes to where i actually end up getting reverse tolerance i will have plenty o' plenty of some high dosage 40x salvia to last me a long time.
how long does reverse tolerance last by the way because i might not be able to do this for a while, maybe a month or two i dunno
win/win situation if you ask me. heh
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
Sounds like shitty salvia? Smelled like dirt? Never had any that did this... bad extract?
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Mezcal
Registered: 08/11/05
Posts: 1,980
|
|
for reference, i trip hard off of 1/30 of a gram of 15x. a friend of mine blacked out on 1/15 g.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
ive tripped close to 50 times between lsd/shrooms... so i know what the dillyo is.
i dunno, i said a small prayer right before, inhaled and exhaled 20 times or so really deep to expand lungs and took a breath.
like i said i start to feel something.... i think the "Scanning" was the begining of it... but it just wasnt enough to push me over the threshold to start peaking. i was still very aware of my surrondings.
no voices/noise...
CEV, ehh sorta but not really.
OEV, everything just had a slight fuzzyness or blur to it
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
yes elgr, i do mean like a cup of fresh soil, it was weird, i mentioned it to several people and had them smell it and they agreed.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
and people trust me, im no idiot who just wants to party..
i cleaned out my bank account, borrowed 50k miles to buy a plane ticket to fly 4500 miles to switzerland for the lsd symposium... by myself mind you, just for knowledge and to learn what "psychedelics" really are.
so i take this very seriously, in a "scientist/explorer" type of way.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
Edited by agoutihead (02/26/06 05:03 PM)
|
Lakefingers

Registered: 08/26/05
Posts: 6,440
Loc: mumuland
|
|
1/10 of a gram of 5x should be more than enough, for instance. i forget what it is you had now...
instead of estimating how long you hold it for why don't you use the clock on your computer and actually time it. after one good hit you should start feeling funky after about 18 seconds
torch lighter is best, some say necessary, some say not. salivinorin requires high temps say the scientists. use a torch lighter if you can.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
i really hope i didnt waste the whole gram because i needed a torch and only used a bic lighter.
but i mean i did smoke it and i did leave the bic lighter on for a very long time... it was a SUPER bright orange coal.
i also did get smoke and choked my balls off.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
Edited by agoutihead (02/26/06 05:08 PM)
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
"i really hope i didnt waste the whole gram because i needed a torch and only used a bic lighter."
Don't worry, you don't. Might it help? Maybe. Is it the reason that a gram of 10x didn't work at ALL out of a bong? Fuck no.
There is bad salvia out there. Head shop stuff tends to be the worst. We've split grams of their "10x" that caused nothing close to breakthrough. But then there are good sources online (normally yours is one of them... maybe not anymore) that a tiny fraction of a gram of 10x, even 5x (with a normal lighter) will take me places I don't want to be, meaning it worked just dandy.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Lakefingers

Registered: 08/26/05
Posts: 6,440
Loc: mumuland
|
|
Another thing is that you shouldn't be choking like that from salvia. Most people, especially experienced smokers, find the smoke pretty smooth. Maybe the supplier mixed up salvia with bark from an oak tree?
|
Lakefingers

Registered: 08/26/05
Posts: 6,440
Loc: mumuland
|
|
Better luck next time
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
"Maybe the supplier mixed up salvia with bark from an oak tree?"
Hehe. Really though, I've had 20x salvia that was unbelievably strong that really was tough on my lungs. Simillarly, I've smoked dmt crystal that was unbelievable, but easier on my lungs than salvia, pot, cigarettes, etc. I suppose it depends on the person, and the batch, but doesn't mean much as far as potency goes.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
well i have never been a smoker of cigarettes my whole life... so that is why.
i only started smoking weed about 4-5 years ago... even though i did/do still kinda smoke it very very heavily.
i still choke by balls off to this day on almost each and every hit.
my gf thinks i over re-act or put on a show... but it really makes me choke that much.
i remember going to the doctor when i was younger for slight asthma... so maybe that is a factor.
i dunno.
but i did get it from shamans palace.com... i will try a stronger extract else where next time.
i just like shamans because they send free gifts every time, not based on your order amount.
then again... the free gifts werent really worth it... sure the sacred lotus extract did a lil something... but i would never buy it.
i did get a free MAOI though.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
shamans palace does have AOL... and i have spoken to them once before on instant messanger.. maybe i will complain the next time he is on and maybe he will be nice and send me some more stonger stuff for free.
but if its not supposed to smell like dirt... then im worried that what i got really wasnt real.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
BBB sends gifts too, and their salvia was fucking insane.
But whatever shop it is (and a lot send gifts) it is more often than not something they probably have overstock of. Why the hell else would I keep getting so damn many yopo seeds! hehe. I got some rivea seeds from SP, I wanted to plant them but can't manage to find em.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
You can bet that it aint the bic lighter. It might be a combination of other factors. BBB is great for sure though.
|
SapphireCat
Seeker


Registered: 11/29/05
Posts: 613
Loc: Ireland
Last seen: 13 years, 1 month
|
Re: salvia sucks! [Re: stemmer]
#5342161 - 02/26/06 06:16 PM (17 years, 10 months ago) |
|
|
were u on edge while taking it? cause the first time i took salvia while i was excited the salvia first relaxed me before letting me breakthrough. But yeah every extract i've come across smelled slightly like tea....well that's the closest thing i can think of.....dirt, really shouldn't describe it from my knowledge? do they have different extracts maybe? from other companies? because i came across a 5x extract that was alot more potent than the 10x i usually got, my advice would be to try a different vendor and just try to remain relaxed and your head clear while you're inhaling.
-------------------- Beauty of style and harmony and grace and good rhythm depend on Simplicity ~Plato
|
DeathCompany
Oneironaut


Registered: 03/16/05
Posts: 12,662
Loc: Somewhere in my head
Last seen: 9 months, 29 days
|
|
Ive smoked out countless i mean countless people and what Ive learned from that is everyones dosage is different regardless of what they use to smoke with, strength of extract or experience (although heavy users need less cause of the whole reverse tolerance). For one friend it could take a pinch of 10x extract while another friend with exact same smoking conditions can go through 4 or 5 bowls and merely feel a little loopy. You might just have a high tolerance which isn't that uncommon
--------------------
|
ajna
Hunter


Registered: 01/02/05
Posts: 410
Loc: Qld, AUS
Last seen: 14 years, 8 months
|
|
i'm also experiencing some trouble breaking through with the old gal. i only have a 5x extract, but one hit of this same extract has turned one guy i know into a pencil case, and another felt himself spinning around the planet by his feet.
i've tried on 3 different occasions, and the only effects i've really noticed have been an uncomfortable body buzz and the feeling like i'm sweating all over.
on my second attempt i remember laying down listening to the music with my eyes closed, and my eyelid kept twitching so i couldn't close my eyes properly. i could sense some patterns in the CEV field, but couldn't keep my eyes closed to focus.
just tried again this morning, this time with a torch lighter. same effects experienced as before, although this time my eye hasn't stopped twitching - it's now 2 hours after the smoke and it's still going. i think sally is playing a game with me...
|
EquilibriuM
dream stalker

Registered: 07/17/05
Posts: 2,323
Last seen: 16 years, 7 months
|
Re: salvia sucks! [Re: ajna]
#5342347 - 02/26/06 07:05 PM (17 years, 10 months ago) |
|
|
he doesnt like you...
-------------------- HELP!!!!!!!!!
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
equilibium... you talking to me?
i dunno i think i either have a high tolerance or this was crappy stuff.
i did sweat a decent amount i remember that.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
There are certain aspects of the salvia trip that will kick you ass if you didnt feel it the 5th time +.........
No reason to name them all.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: stemmer]
#5342623 - 02/26/06 07:59 PM (17 years, 10 months ago) |
|
|
stemmer what do you mean the 5th time?
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
its a number I just threw out there. I just think you should be interested if youve had a pile of the substance before you and smoked it. You shouldnt need anyone on this site to tell you that it works VERY well for mostly everybody in one way or another. If it doesnt interest you after say, the 3rd or 4th time, then just quit trying to find interest in it. It will never be like acid or shrooms. I hope you dont expect that. It is what you would call an atypical psychedelic. VERY intense, very visual, but very seperate from the rest. So, if you dont find interest or cant see the visuals, the drug doesnt like you(kidding). Its just not for you.
Its a drug that I beleive is so strange that it can mess with your head more than most psychedelics. There is no reason to do that to yourself if you get nothing out of it.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: stemmer]
#5342758 - 02/26/06 08:23 PM (17 years, 10 months ago) |
|
|
well this was only the first time... so im not outta the game yet. i will give it several more attempts... like i said i did feel very weird... just no breakthrough... so i guess it is normal.
next time i will get a stronger extract from a different supplier, and make sure i have a torch lighter... might as well retrace my steps and make changes where i can.
every other psychedelic has loved me, and i have loved it. i see no reason for this drug not to want me.
conclusion: do not give up.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Ekstaza
stranger than most


Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 9 months, 23 days
|
Re: salvia sucks! [Re: stemmer]
#5342789 - 02/26/06 08:28 PM (17 years, 10 months ago) |
|
|
Quote:
stemmer said: ........ If it doesnt interest you after say, the 3rd or 4th time, then just quit trying to find interest in it............ So, if you dont find interest or cant see the visuals, the drug doesnt like you(kidding). Its just not for you.
Do you really think that if something doesn't work the first few time for a person, that they should give up hope of it ever working? That or do you believe that one should lose interest after a few tries?
If Thomas Edison had of thought this way we wouldn't even be having this discussion.
-------------------- YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: Ekstaza]
#5342810 - 02/26/06 08:32 PM (17 years, 10 months ago) |
|
|
you go boyyyyyy!
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
You cant breakthrough unless youre using the doors reference or the definition of breakthrough used so often on this site(which is a joke).
Dude just feel the perceptual changes, and Wait a week or so before you use it again. It should blow your mind. If it doesnt, then I dont know why.
Id recommend 3 fat hits out of a small bong or even a pipe with a normal lighter. There should be no unecessary qualifiers here. You really only need a pipe, a good working bic lighter, and the ability to take massive hits that you can hold in for atleast 30 sec.
I didnt mean to say you will never feel it. I just think you need to look at it as an entirely different drug. It will get to you in one way or another. Once you get there you might even become quite scared.
Ekstaza, you must have missed the part about me joking around. Really though, everyone should feel it. No one has any reason to beleive that they cant. That just doesnt fly when talking about such a potent substance.
Edited by stemmer (02/26/06 08:38 PM)
|
Ekstaza
stranger than most


Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 9 months, 23 days
|
Re: salvia sucks! [Re: stemmer]
#5342953 - 02/26/06 08:52 PM (17 years, 10 months ago) |
|
|
Oh, I thought the just kidding was just for the part about the drug not liking him.
-------------------- YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.
|
duggan18
Stranger
Registered: 08/02/05
Posts: 166
Last seen: 16 years, 4 months
|
Re: salvia sucks! [Re: Ekstaza]
#5342963 - 02/26/06 08:56 PM (17 years, 10 months ago) |
|
|
i tripped my first time off of 5x. it was a weird 2-3minute long trip.
im sure this has been said a billion times in here, but use a water bong and take as many huge hits as u can. i never get past the first
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: Ekstaza]
#5342965 - 02/26/06 08:57 PM (17 years, 10 months ago) |
|
|
by the way i had standardized 10x.... so it should have been ok.
i have found 1 gram of non-standardized 20x for 19.00 at bouncing bear i think
i have also found 1 gram of standardized 20x for 31.98 at iamshaman.com
clearly there is a HUGE price difference.... im leaning more towards the non-standardized now only because its getting pricey.
what do you guys think?
does anyone have any other places to buy higher extracts?
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
EquilibriuM
dream stalker

Registered: 07/17/05
Posts: 2,323
Last seen: 16 years, 7 months
|
|
Quote:
agoutihead said: equilibium... you talking to me?
i dunno i think i either have a high tolerance or this was crappy stuff.
i did sweat a decent amount i remember that.
No, I was talking to ajna.
With you I would give it more time... A couple more chances... I think you'll get it
-------------------- HELP!!!!!!!!!
Edited by EquilibriuM (02/26/06 09:04 PM)
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
cool equil.. thanks!
also duggan i smoked a whole gram of standardized 10x from a water bong... trust me i got a couple of good hits in. heh.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
You never know if it's really standardized unless you standardize it yourself.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
ajna
Hunter


Registered: 01/02/05
Posts: 410
Loc: Qld, AUS
Last seen: 14 years, 8 months
|
|
Quote:
EquilibriuM said:
Quote:
agoutihead said: equilibium... you talking to me?
i dunno i think i either have a high tolerance or this was crappy stuff.
i did sweat a decent amount i remember that.
No, I was talking to ajna.
With you I would give it more time... A couple more chances... I think you'll get it
in that case...
maybe she does like me, but also likes to play hard to get. the thrill of the chase can be half the fun
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
Re: salvia sucks! [Re: ajna]
#5343224 - 02/26/06 09:54 PM (17 years, 10 months ago) |
|
|
ya thats what I was kidding about for the most part Ekstaza.
He will "break through" if he wants. Or he can learn to appreciat the effects of the drug without going almost blind for 4 min. Thats all I was saying. And ya, if Salvia D had the capability to like people, it aint him. I wouldnt worry about that Ekstaza, nore would I worry about it if I was him. He will find interest in it one day.
Edited by stemmer (02/26/06 09:55 PM)
|
OmahaStylee
Stranger
Registered: 02/26/06
Posts: 1
Last seen: 16 years, 3 months
|
Re: salvia sucks! [Re: stemmer]
#5344079 - 02/27/06 02:43 AM (17 years, 10 months ago) |
|
|
I've tried salvia too and had no results
Was disappointed :/
|
inv3rse
OP-4Warez/0day-warezon Rizon


Registered: 08/26/05
Posts: 312
Loc: Denver, CO
Last seen: 3 years, 11 months
|
|
same thing happened the first time I tried it....
Oh man, the second time was a different story and a kick in my ass...lol
-------------------- "I hate to advocate drugs, alcohol, violence, or insanity to anyone, but they've always worked for me." "Strange memories on this nervous night in Las Vegas. Five years later? Six? It seems like a lifetime, or at least a main era - -the kind of peak that never comes again. San Francisco in the middle sixties was a very special time and place to be a part of. Maybe it meant something. Maybe not, in the long run, but no explanation, no mix of words or music or memories can touch that sense of knowing that you were there and alive in that corner of time and the world. Whatever it meant." Hunter S. Thompson.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: inv3rse]
#5344316 - 02/27/06 06:47 AM (17 years, 10 months ago) |
|
|
there was a brief moment... that was kinda weird when i closed my eyes.... i dont remember which time it was... but i did kinda see two female like figures swim/slither up closer to me.... both from the front of me... but a couple feet away from each other. almost in a very aphrodisiac/sensual type of way... but then i lost it before they seemed to "touch" me. it was kinda a bummer. heh they werent dressed either... but i couldnt see any boobs or anything.
i do kinda remember that.
dont know if i just made it up in my head... but i did just get done smoking a ton of sally d.
heh.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
Edited by agoutihead (02/27/06 06:48 AM)
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
just an update:
shamanspalace was online, so i instant messanged them.
told them i was severly disappointed with the 10x standardized.
after a few questions he is going to send me out a free gram of 20x standardized.
i am really impressed, and even though the product wasnt the greatest, the service makes up for it!
hopefully this 20x standardized should give me a break through.
They make 40x standardized too... 29.99 for half a gram... 55.99 for a full gram.
sounds tempting but pricey!
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
I've had simillar experience with him. So I can't quite tell if I want to recommend him to anyone or not. On the one hand, I got one total garbage product. On the other hand, he sent me a ton of free stuff to try to make up for it, surely at a total loss to him. But it still never was equal in value to the loss.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
dubbyah
Stranger
Registered: 09/07/05
Posts: 198
Last seen: 15 years, 18 days
|
|
I break through from the 10x from SP all the time dude. Some people are more sensitive to salvia, sometimes people dont break thru and they smoke it right. I know someone who can never break thru from salvia, and hes done it tons of times and uses all types of drugs with positive effects. The 10x from SP was not the problem at all, but its awesome youre getting 20x out of it.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: salvia sucks! [Re: dubbyah]
#5345420 - 02/27/06 01:45 PM (17 years, 10 months ago) |
|
|
You're right... especially with 10x (from most anywhere). But I've never heard of someone killing a gram of 20x the way he did with the 10. (which I've heard of people doing all the time with little effect)
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
elgr, what did you get from SP that was junk?
well see how the 20x works... should be here later this week, ill see if i can set it up for this weekend.
heh... well hopefully i wont have to run through the whole gram of 20x like a porn star again....
if it doesnt work on the first bowl, i wont keep smoking, and i will just attempt at a later time.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
schmutzen
King of the side-pins


Registered: 12/03/02
Posts: 15,314
Loc: Miss Kitty's Lounge
Last seen: 6 hours, 19 minutes
|
|
One of these days you will break through and it won't be all fun and games, well actually, yeah it will be all fun and games... for her. Ha!
Seriously though, I smoked a few times daily for awhile, them BAMN! she knocked me on my head. I suggest not taking breaths between puffs, bongs can be more effective than pipes once you think you know what you're doing. Now I see her as an oricle, a tool to look deep inside when I need help solving a problem.
You just wait...
--------------------
"Blow up your TV, throw away your paper. Go to the country, build you a home."
|
ShamansPalace
Tree Hugger

Registered: 10/21/04
Posts: 277
Loc: www.ShamansPalace.com
|
Re: salvia sucks! [Re: schmutzen]
#5345940 - 02/27/06 03:56 PM (17 years, 10 months ago) |
|
|
A good factor not to forget is that Non-Standardized will be a more harsh incense. Given the means of extraction. Pm me and we will resolve this.  Shamanspalace Support.
-------------------- Shaman's Palace FREE Gift's with EVERY ORDER !! QUICK shipping !10% Shroomery Member Discount! www.ShamansPalace.com Questions - Sales@Shamanspalace.com
|
DeathCompany
Oneironaut


Registered: 03/16/05
Posts: 12,662
Loc: Somewhere in my head
Last seen: 9 months, 29 days
|
|
--------------------
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
yeah i told you guys they were good peoples!
great customer service!
thanks again guys!
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
|