|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
I can feel a half of a leaf(no extract) put ontop of weed easily, and its very interesting. You could have made the title "salvia didnt work for me the first time", but you went with "salvia sucks".
Take a 2 massive rips of that 10x youve got, and if you dont feel it, your likely a hard head, and thats not a good thing. It usually means you dont know what to look for, and you know nothing about you own head or hallucinogens for that matter. Even if the 10x was really 5x, it should still work really well.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: stemmer]
#5341645 - 02/26/06 04:05 PM (17 years, 10 months ago) |
|
|
ehh i put salvia sucks to get more people in my thread... everything is about marketing these days isnt it? 
should i go try again?
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
beavis190
(.Y.)'s


Registered: 01/25/06
Posts: 432
Loc: lost in my head
|
Re: salvia sucks! [Re: stemmer]
#5341647 - 02/26/06 04:06 PM (17 years, 10 months ago) |
|
|
5x was not that good for me i felt it but no visuals it was still awsome
--------------------
Confucius Says ... Man who put cock in Peanut Butter jar is Fucking Nuts. Man with tool in woman mouth May not necessarily be dentist. Schoolboy who play with schoolgirl during wrong period, get caught red-handed. He who fish in other's hole often catch crabs. Man who go to sleep with itchy butt, wake with smelly fingers... Man young when he snatches kisses, old when he kisses snatches.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
Re: salvia sucks! [Re: beavis190]
#5341656 - 02/26/06 04:07 PM (17 years, 10 months ago) |
|
|
id have to say the "scanning" i experienced was some weird shit!
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
F it im going to try again.
brb.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Lakefingers

Registered: 08/26/05
Posts: 6,440
Loc: mumuland
|
|
in salviaspace now, agoutihead?
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
And smoke a bunch within about 30 seconds, because you really dont get it.
|
tiny_rabid_birds
Nocturnal


Registered: 11/08/05
Posts: 15,653
Loc: estados unidos
|
Re: salvia sucks! [Re: beavis190]
#5341697 - 02/26/06 04:18 PM (17 years, 10 months ago) |
|
|
I just made my own 10x extract from an oz of leaves I got from iamshaman, using 95% ethyl alcohol for the extraction. I tried it out last night, took a rip and a half from a makeshift 1-liter bong and I was completely gone. I'm not sure I liked it, I got SOOOO confused, it was insane. Like I forgot most of the details about my life and I thought I existed in a 2-D pattern.. and for some reason I felt distraught. The people hanging out with me seemed so foriegn, I almost forgot who they were.
It was straight up fuckin crazy.
--------------------
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
"salvia sucks"
You're not the first person to think of a clever thread title like this.
You'd better hope it doesn't work this second time, she'll make you pay.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
smoked more
no break through..
effects like small dosage of lsd... three weekends ago i did 180 micrograms... this feels like about 25
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
i still took it as respect... like i said the "salvia sucks" was just a marketing tool for the forum.
i smoked more.... its like very low dosage of lsd, which is cool cause everything is weird... alexgrey.com is fun but i just need a higher dosage i guess.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
ExplosiveMango
HallucinogenusDigitallus


Registered: 07/12/05
Posts: 3,222
Last seen: 14 years, 2 months
|
Re: salvia sucks! [Re: shriek]
#5341756 - 02/26/06 04:36 PM (17 years, 10 months ago) |
|
|
The first time I 'broke through' on salvia space filled with imaginary barriers and forces. It was almost like I was thrown around the room. Crazy cool stuff.
I took about .2 of 6x standardized extract and held it in for a good 70 seconds, maybe a little longer.
-------------------- Know your self. Know your substance. Know your source. The most distorted perspective possible is the perspective that yours is not distorted.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
see my problem is its hard for me to hold it in long. i dont think i can even reach 30 seconds. well i couldnt... unless i was just really really counting slow... which i might have. heh
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
No one should need a higher dosage than a gram of 10x, heh. Either technique or shitty salvia on shamanspalace's part. Maybe they got it from the same supplier as their old peruvian torch, and it's really just oak leaves or something. As I've not heard a single report of that torch being anything at all.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
YOu really are returning to the internet after a fat hit or 2 of 10x. Well let me be the first to say, the visuals can be amazing, but they are NOTHING like LSD. They are more similare to shrooms, but are obviously very different still. I just think your looking to party, and play with psychedelics. If that is not the case then wait a week and then try a massive dose. Then you might understand why it has been called "one of the most potent psychedelics". Otherwise, I dont know what to say.
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
hmm. it smelled like dirt... litereally dirt.
so i dunno what that means.
like i said it still fucked me up... but no peak... no mutation into the "psychedelic conciousness" just everything was kinda weird... when i finished the first bowl i decided to get up to get more cause it wasnt doing much and it was really hard to stand.. that felt weird too... eventually went to my knees cause i had to get the stuff and that felt weird too... packing it up again was kinda hard... but not impossible obviously.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
Lakefingers

Registered: 08/26/05
Posts: 6,440
Loc: mumuland
|
|
Hang in there. I have a feeling it's going to whirl your body backward and outward, and run your mind over like a thousand freight trains.
Are you using a bong now?
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
no no, not looking to just party... i take this very serilously... i make it as though its an experiment and try and push my mind as far as possible and to see what i can learn/understand and bring that back and try to apply it to my everyday life in order to improve it.
even though i couldnt hold the hit long enough (i still did at least 20 seconds... 25 or so) shouldnt smoking an entire whole gram in general be enough to make me blast off?
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
yeah i used a nice glass water bong and everything.
the only thing i didnt do, but i followed elgrs advise was using a torch... i just used a regular bic.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
agoutihead


Registered: 11/11/05
Posts: 1,449
Last seen: 6 years, 7 days
|
|
by the way i did this by myself, no sitter or anything.
there was a pug, but she didnt say much. heh.
-------------------- "When I'm on LSD and hearing something that's pure rhythm, it takes me to another world and into anther brain state where I've stopped thinking and started knowing" - Kevin Herbert "Psychedelics let you see the world through a child's eye." "Experience the liquid realm..." "The evolution of mankind is in the alteration of consciousness" - Dr. Albert Hofmann
|
|