Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Left Coast Kratom Buy Kratom Extract   Mushroom-Hut Liquid Cultures   Bridgetown Botanicals Bridgetown Botanicals   Kraken Kratom Red Vein Kratom   Unfolding Nature Unfolding Nature: Being in the Implicate Order   North Spore Injection Grain Bag

Jump to first unread post Pages: 1 | 2  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinejenerikcairet
cognitivelibertist
 User Gallery

Registered: 02/17/06
Posts: 546
Last seen: 11 years, 8 months
acid question
    #5336289 - 02/24/06 10:14 PM (17 years, 11 months ago)

okay so when ever i trip really hard off of acid, i get this brain buzz as i call it... its like this really intense good feelings in my brain that i get...i cant put it into words besides saying if the feeling could talk, it would be screaming "everything is chaos, but i dont care"...its like my brain accepts the fact that everything is going crazy but it chooses to like it...

its an intense buzz and almost has a sound...


does anyone know what the hell im talking about?


--------------------
Yes, ordinary water. Laced with nothing more than a few spoons full of LSD- professor farsnworth


Edited by jenerikcairet (02/24/06 10:15 PM)


Extras: Filter Print Post Top
Invisiblesui
I love you.
Male User Gallery

Registered: 08/20/04
Posts: 31,853
Loc: Cali, Contra Costa Co. Flag
Re: acid question [Re: jenerikcairet]
    #5336304 - 02/24/06 10:19 PM (17 years, 11 months ago)

LOL its called TRIPPIN, my friend. :lol:


--------------------

"There is never a wrong note, bend it."
Jimi Hendrix



Extras: Filter Print Post Top
Offlinejenerikcairet
cognitivelibertist
 User Gallery

Registered: 02/17/06
Posts: 546
Last seen: 11 years, 8 months
Re: acid question [Re: sui]
    #5336317 - 02/24/06 10:24 PM (17 years, 11 months ago)

right but it only happens certain times...and its never happened with shrooms..

its not just tripping, its a part of tripping and im trying to find if anyone else has had that specific feeling...


--------------------
Yes, ordinary water. Laced with nothing more than a few spoons full of LSD- professor farsnworth


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: acid question [Re: jenerikcairet]
    #5336494 - 02/24/06 11:21 PM (17 years, 11 months ago)

"its an intense buzz and almost has a sound..."

I know exactly what you're talking about. This is one of the key elements of DMT to me (I've experienced it a little on DOC). My friends don't know what buzz I'm talking about. On DMT, it's about 100x more intense than acid, it envelopes everything. It becomes not only a feeling and a sound, but a taste as well for me, for lack of a better sense to describe it.

I don't believe it has ever happened to me on mushrooms either. And I know your frustration in trying to describe this thing that seems to escape standard definition of the senses. It's a really unique thing. On DMT, I get the feeling that I've experienced it a million times, and that it's always an underlying feeling, somewhere normally escaping consciousness, but still being felt, that I can't put my finger on. Maybe dreaming... or in the split second between sleep/waking or the other way around.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinejenerikcairet
cognitivelibertist
 User Gallery

Registered: 02/17/06
Posts: 546
Last seen: 11 years, 8 months
Re: acid question [Re: Koala Koolio]
    #5336641 - 02/25/06 12:19 AM (17 years, 11 months ago)

oh my god dude thank you so much. ials get that feeling that its always an underlying feeling... thats amazing that you said that.

we should talk online sometime...as ive never met another tripper who knew what i was talking about...


--------------------
Yes, ordinary water. Laced with nothing more than a few spoons full of LSD- professor farsnworth


Extras: Filter Print Post Top
Offlinejenerikcairet
cognitivelibertist
 User Gallery

Registered: 02/17/06
Posts: 546
Last seen: 11 years, 8 months
Re: acid question [Re: jenerikcairet]
    #5336651 - 02/25/06 12:22 AM (17 years, 11 months ago)

also, the last time i got that feeling, the feeling would kind of come back to me , less intense, when ever i smoked marijuana for a few days after the trip(5 days i would guess).


--------------------
Yes, ordinary water. Laced with nothing more than a few spoons full of LSD- professor farsnworth


Edited by jenerikcairet (02/25/06 12:23 AM)


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: acid question [Re: jenerikcairet]
    #5336686 - 02/25/06 12:34 AM (17 years, 11 months ago)

You should check the geometric audio visuals thread, oh ya, that was deleted because I was pissed that everyone thought I was lying about the sound when heard at its fullest(for years). I got sort of pissy with a few mods.
The sound only becomes more obvious over time. I find that the drugs that make it most obvious are LSD, lsa's, then ayahuasca, (shrooms can do it to some degree).
I know some very smart people, and they thought I was making it all up(it was in my head), or some shit. Well.......when enveloped in the sound, it becomes clear that your fractal memory has no part in it. Its just far too complex. Its like your an antenii for some really unbeleivable things when you get to that point. The more important question would be, why do you hear that sound, and what the hell is it.
What is your take on it???????


Extras: Filter Print Post Top
Offlinejenerikcairet
cognitivelibertist
 User Gallery

Registered: 02/17/06
Posts: 546
Last seen: 11 years, 8 months
Re: acid question [Re: stemmer]
    #5336730 - 02/25/06 12:50 AM (17 years, 11 months ago)

well my take on it personally may seem crazy, but i think its the universe...or a suond that the real universe makes...

what i mean is, when i hear this high pitched sound, i imagine a desolate planet with no one but me, my own little universe...and this noise is present there. so i take the noise to be god, or life, or whatever...

(i dont believe in god, i simply believe in a beginning)


--------------------
Yes, ordinary water. Laced with nothing more than a few spoons full of LSD- professor farsnworth


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: acid question [Re: jenerikcairet]
    #5336839 - 02/25/06 01:27 AM (17 years, 11 months ago)

"i dont believe in god, i simply believe in a beginning". I like the simplicity of that.

For some its not a high pitched sound its very low as well. I have a feeling that the highest octave is also the lowest. When you hear them all playing around with each other like a good fusion jazz tune youre getting somewhere. They are like mirrors of each other, each making a move and they all react. I dont know why, and im a skilled musician. I dont know why they make their own structure without including the fractal memory of the individual.


Edited by stemmer (02/25/06 01:31 AM)


Extras: Filter Print Post Top
Offlinejenerikcairet
cognitivelibertist
 User Gallery

Registered: 02/17/06
Posts: 546
Last seen: 11 years, 8 months
Re: acid question [Re: stemmer]
    #5336856 - 02/25/06 01:35 AM (17 years, 11 months ago)

i also am a musician, guitar and piano...and i do sort of hear multiple octaves of the high pitched noise which is almost an oscillation you would get from a delay pedal self oscillating.


--------------------
Yes, ordinary water. Laced with nothing more than a few spoons full of LSD- professor farsnworth


Extras: Filter Print Post Top
Offlinejenerikcairet
cognitivelibertist
 User Gallery

Registered: 02/17/06
Posts: 546
Last seen: 11 years, 8 months
Re: acid question [Re: jenerikcairet]
    #5336863 - 02/25/06 01:37 AM (17 years, 11 months ago)

i also am a musician, guitar and piano...and i do sort of hear multiple octaves of the high pitched noise which is almost an oscillation you would get from a delay pedal self oscillating.

by the way, my theory is that if there is a beginning, then some force(benevolent or not) had to act as the catalyst... and whatever force that is would be "god" or ...the beginning.


--------------------
Yes, ordinary water. Laced with nothing more than a few spoons full of LSD- professor farsnworth


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: acid question [Re: jenerikcairet]
    #5336894 - 02/25/06 01:45 AM (17 years, 11 months ago)

Even "aliens" know that there are only so many notes within the scale. It the same every where in the universe. Audio is one of the only ways of expressing the finite nature of our reality.
You might need to re-tune your guitar every-time you switch an album, or even for every song. It all follows the same rules.
Big bang......even if it was not a big bang.......its reaches are endless. It is the reason for DNA. It is the reason for space and time. It IS..............


Extras: Filter Print Post Top
Offlinejenerikcairet
cognitivelibertist
 User Gallery

Registered: 02/17/06
Posts: 546
Last seen: 11 years, 8 months
Re: acid question [Re: jenerikcairet]
    #5336976 - 02/25/06 02:09 AM (17 years, 11 months ago)

were on the same page chum


--------------------
Yes, ordinary water. Laced with nothing more than a few spoons full of LSD- professor farsnworth


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: acid question [Re: jenerikcairet]
    #5337025 - 02/25/06 02:26 AM (17 years, 11 months ago)

Stemmer... I do believe I know what you were talking about back then now. There's a very specific "jagged" feeling imbedded in these feelings (for lack of a better word) that just really feels like it's digging to the core of me. Nevermind... this is impossible to articulate.

Either way, I apologize for the way I acted in that thread. It wasn't about the confusing subject matter, just about telling people to get lost if they didn't know what it was. But, I can see how it's frustrating to explain. There's no way to make someone understand besides "yes" or "no, that's not it."

We may still be talking about different things. But this... feel is developing more and more each time I trip, to the point where it has almost become the root of the psychedelic experience to me. It's... nevermind.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinejenerikcairet
cognitivelibertist
 User Gallery

Registered: 02/17/06
Posts: 546
Last seen: 11 years, 8 months
Re: acid question [Re: Koala Koolio]
    #5337057 - 02/25/06 02:48 AM (17 years, 11 months ago)

dude...that jagged word is fucking spot on...i can definitely see what you mean and that word defnitely describes my feeling...i think were on to a new effect of the drug, which may not be fully documented...and is near impossible to articulate. next time i feel it i will try to explain it then...although i have tried to no avail to describe it to nontripping friends while i was tripping.


--------------------
Yes, ordinary water. Laced with nothing more than a few spoons full of LSD- professor farsnworth


Edited by jenerikcairet (02/25/06 02:52 AM)


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: acid question [Re: jenerikcairet]
    #5337077 - 02/25/06 03:11 AM (17 years, 11 months ago)

There's not a chance in hell that it's new. But I've certainly not read anything, but how could I? I couldn't expect myself to write serious literature on the subject.

None of my friends quite understand what I'm trying to tell them. They think they get it, but then end up lost. I used to call it "that... raw feeling", or "the taste", as I thought it was what people were referring to in DMT Spirit Molecule when the "DMT taste" would set in before the syringe plunger was even all the way down. I still think it's possible, but it didn't go into great detail.

This mystery was taken a step higher with my first DMT experience. It became physically connected, and concentrated in specific parts of my body. Namely, I could feel it at my teeth (gums I suppose) and the tip of my tongue. To a lesser degree, the tips of my fingers. This was just another aspect thrown in the mix. It can be everything, but the same? This can't be synesthesia, can it? I'm not mistaking anything for anything, and none of them are feelings that previously existed. It's a sight, touch, buzz, and taste that all feel more or less the same, but don't exist outside of this special experience.

The DMT really helped me get a firm grasp on what I was experiencing. It wouldn't fade, or escape me. More of a full on confrontation that really gave me a beating.

I've begun to wonder just how important a role this strange mystery plays in the human experience, tripping or non. It's so very real and unmistakable. There have been times in more recent trips where I've decided that what I'm feeling is the essence of life itself. Something one might find spiritual, though I wish to look at it in a more biological way if that is at all possible.

Thanks for giving me the chance to express what would otherwise be unexpressable. I don't think I can really explain it to someone who doesn't know what I mean. It's sort of a language we have...

Heh, at first I thought you were just going to be talking about that electric vibe acid can give you. Just sort of a pulsing through the body, a very euphoric rush. Then I read about the sound... the buzz... euphoria is far from it. Though there is something reassuringly "human" about it all, or at least it feels like life (in a far concentrated form).

I'd be curious to hear what anyone else thinks. Is it:
"Oh yeah! I can totally relate!"
or
"You guys are fucking nuts..."


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Edited by elgr (02/25/06 03:26 AM)


Extras: Filter Print Post Top
OfflineGrapefruity
Lawn Gnome
Registered: 08/07/03
Posts: 601
Last seen: 12 years, 11 months
Re: acid question [Re: Koala Koolio]
    #5337667 - 02/25/06 11:21 AM (17 years, 11 months ago)

This is the signal that ego death is possible, in my experience. I know what you mean, it is an orgasmic signal. It Can be when, like you say, you start not caring, or when you start freaking out...It's your ticket...In ego death, its this feeling you like, goes on for some time. Its one of my only reason for trippnig really.

The psychedelic experience by leary talks about it...An uncategorized energy, making your cells feel in orgasmic activity. Soemthing like that anyways dont feel like quoting.

Luminous, Cryin half-birds coming through me like a flock of bats. Lol from what I remember :p

It holds truth, truth which is hidden by you.

I wonder why nobody mentioned ego death, maybe im far from the point :smile:


Edited by Grapefruity (02/25/06 11:42 AM)


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: acid question [Re: Grapefruity]
    #5338133 - 02/25/06 02:15 PM (17 years, 11 months ago)

Ego death usually comes hand in hand with the *intensity* that this strong buzz has. Meaning, the stronger it is, the harder you're tripping and the more likely ego death is. Still, I think they're independant of each other. The analysis of the feeling might lead to ego-less thoughts... but in a more rational way (rather than just having your ego stripped away by the drug).

You're speaking about something very real too... but you've said orgasmic too many times for me to think it's the same thing. Is that possible with what I'm talking about? Maybe... but is the last thing I'd mention as a definition or description.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineGrapefruity
Lawn Gnome
Registered: 08/07/03
Posts: 601
Last seen: 12 years, 11 months
Re: acid question [Re: Koala Koolio]
    #5338618 - 02/25/06 05:47 PM (17 years, 11 months ago)

''Ego death usually comes hand in hand with the *intensity* that this strong buzz has. Meaning, the stronger it is, the harder you're tripping and the more likely ego death is''

Yeah exactly. But the harder you trip, the less you are to decide to go into ego death. If yu know what I mean. And the more you wait , the more 'death' will turn out to be painful. From what I have seen. Its always better to shut yourself down as soon as you know you can. I say orgasmic. It's not like actual sex orgasm , but its like perfect love falling goin through you, a perfect vibration .

'analysis of the feeling might lead to ego less thought'

I dont quite understand. but the analysis of the feeling keeps you from vanishing in it, it keeps you away from 'truth'. This is what made me badtrip the first time. I could have let go but it was so intense I thought this feeling was gradual physical death and I fought it. Boy was it pathetic.

Some people don't like goin into ego death though. They want to continue as intense as it can be, and it must be mindblowing for them, but I can't be in this state, it is panic for me.

Maybe im off and missing the thread starters point though :p


Edited by Grapefruity (02/25/06 06:04 PM)


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: acid question [Re: Grapefruity]
    #5338877 - 02/25/06 07:10 PM (17 years, 11 months ago)

How you're able to handle, analyze, and deal with it is largely dependant on the substance. Acid, when not in huge amounts, can be much more painless than mushrooms for me. And DMT can do it the easy way or the hardway, but neither is too rough. The easy way doesn't take you all the way, and the hardway is too quick to have a clue what's going on. :smile:

I hear 2C-E is a little closer to the rough transition that you get with mushrooms.

But as far as the "buzz" itself, it can certainly exist independantly of ego death. Ego death was never even remotely in sight for me with DOC.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineTangerines
 User Gallery

Folding@home Statistics
Registered: 04/17/05
Posts: 17,918
Loc: woodwork Flag
Last seen: 4 years, 23 days
Re: acid question [Re: Koala Koolio]
    #5339806 - 02/25/06 11:41 PM (17 years, 11 months ago)

Last time I tripped on acid I closed my eyes and got this sudden rush of information or something. IT was a UNIQUE and real feeling. I could not understand one single part of it I just felt its presence and wanted to know more. I never did though. I know exactly what you mean by the taste. I didn't so much as hear a noise but I felt the presence.

Then I looked at my hands and there was this almost multi dimensional 'film' around my whole body. ITs like I was seeing part of myself but in another dimension not just space and time. T

hat also makes me think that sound can be multi dimensional and what we hear is somethign totally different in another dimension that we can never hope to comprehend. Our brains are just not set up for that kind of information. I wish to unlock it but I don't even know where to start.


Extras: Filter Print Post Top
Invisiblekaniz
That one, overthere.
Male

Registered: 07/23/04
Posts: 4,166
Loc: Ontario
Re: acid question [Re: Tangerines]
    #5339819 - 02/25/06 11:53 PM (17 years, 11 months ago)

I think I get it - but not quite. I get the same sensation of "everything is chaos, but your mind accepts it", but its not so much of a sound, I think.

Actually, now that I think about it - its hard to really say. It's almost as if I stop caring, as if I give up, as if everything is chaos and I accept it, as if I am on the brink of losing my mind and sanity - but that is OK.

Its not so much a "thought" that I am thinking - it is just what it is.


Extras: Filter Print Post Top
OfflineGrapefruity
Lawn Gnome
Registered: 08/07/03
Posts: 601
Last seen: 12 years, 11 months
Re: acid question [Re: kaniz]
    #5340371 - 02/26/06 09:09 AM (17 years, 10 months ago)

When this feeling comes, try to go to sleep, at least try it once :smile:

And Elgr ok I understand yourt point. This can happen without it being you on the edge of ego death...Ive only had it with solid dosage of acid though...But the transitiion, are you talkin about the moment it does it? Like you know, when you come apart. Do you always end up in the same 'place' regardless of substance?


Edited by Grapefruity (02/26/06 12:01 PM)


Extras: Filter Print Post Top
OfflineExplosiveMango
HallucinogenusDigitallus
Male User Gallery

Registered: 07/12/05
Posts: 3,222
Last seen: 14 years, 2 months
Re: acid question [Re: jenerikcairet]
    #5340546 - 02/26/06 10:29 AM (17 years, 10 months ago)

(reply to the poster)
The way you describe the feeling evokes memories of feelings I've had on LSA.

Although in my personal experience the chaotic element hasn't been as recognizable/prevalent... I get the feeling that some extra perceptual sense (or neural process or whatever) is going into overdrive to an extent that it blocks out reality. Personally I have a little bit of audio hallucination but I also perceive rays of light flowing through me.

I find the feeling very relaxing and euphoric, and I'm totally comfortable with letting go and closing my eyes or whatever when it comes on.


--------------------
Know your self.
Know your substance.
Know your source.

The most distorted perspective possible is the perspective that yours is not distorted.


Extras: Filter Print Post Top
OfflineCerebralFlower
whats left?

Registered: 02/09/04
Posts: 1,326
Loc: only the truth is left
Last seen: 14 years, 7 months
Re: acid question [Re: ExplosiveMango]
    #5340700 - 02/26/06 11:32 AM (17 years, 10 months ago)

Does it come for a second, like a ZAP or does it persists like a humming?
Ive gotten it once on a trip when i was falling asleep, it would be like a ZAP in my head, like a sound and a feeling, and i would twitch hard.
Not pleasant


--------------------
God says dance with your heart
And shake free of you desire

Where theres a will theres always a way
When you get confused listen to the music play



Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: acid question [Re: CerebralFlower]
    #5341078 - 02/26/06 01:25 PM (17 years, 10 months ago)

Oh, it persists. It persists to the point where you can sit there, realize it's happening and try to put your finger on where you've felt it before. When you were sick? Hmm. Maybe that's not it, etc. It's always very deja vous without an answer. But perhaps, like deja vous, it's triggering part of the mind to remember it as familliar, when it is indeed not.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
InvisibleLakefingers

Registered: 08/26/05
Posts: 6,440
Loc: mumuland
Re: acid question [Re: Koala Koolio]
    #5341768 - 02/26/06 04:40 PM (17 years, 10 months ago)

I've read the whole thread and I'm not sure if you're talking about the same things. Are you still trying to chat about the chaotic noise rush?

High doses of mushrooms will put me there -- if it's your there, I don't know. It's a metallic chord wavering through my...all, as if I'm located in a large convex vault and some massive, accelerating noise picks up, always flanging upward in tone, but always steady. Loud and far off, but there. Perplexing and my head will turn in wonderment. A music of all else. Somehow. Stunning.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: acid question [Re: Lakefingers]
    #5341815 - 02/26/06 04:57 PM (17 years, 10 months ago)

"it's your there, I don't know. It's a metallic chord wavering through my...all"

So far that's the closest I've heard anyone besides the two of us get to describing it. I've just found that it's a bit more than a noise, after persuing it further. It's sharp... and it's in the mind, and it can take hold of any of the senses in the same way that you experienced it as sound.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinejenerikcairet
cognitivelibertist
 User Gallery

Registered: 02/17/06
Posts: 546
Last seen: 11 years, 8 months
Re: acid question [Re: Koala Koolio]
    #5341829 - 02/26/06 05:00 PM (17 years, 10 months ago)

its a persisting noise...

um, its funny that you say that, because i have also gotten the zap,actually quite often i get the zap and twitch when im tripping... its very strange...but not the same as the persisting droning buzz.


--------------------
Yes, ordinary water. Laced with nothing more than a few spoons full of LSD- professor farsnworth


Extras: Filter Print Post Top
Offlinejenerikcairet
cognitivelibertist
 User Gallery

Registered: 02/17/06
Posts: 546
Last seen: 11 years, 8 months
Re: acid question [Re: jenerikcairet]
    #5341833 - 02/26/06 05:02 PM (17 years, 10 months ago)

i would agree that it is also a taste...it seems to switch between any given sense that it pleases...taste...smell...sound...


--------------------
Yes, ordinary water. Laced with nothing more than a few spoons full of LSD- professor farsnworth


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: acid question [Re: jenerikcairet]
    #5341924 - 02/26/06 05:23 PM (17 years, 10 months ago)

The last zap I got was when I got electrocuted on DOC. :frown:

But yes, I know the *other* buzz too. :smile: Very much so on dmt or lsd.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineGrapefruity
Lawn Gnome
Registered: 08/07/03
Posts: 601
Last seen: 12 years, 11 months
Re: acid question [Re: Koala Koolio]
    #5341961 - 02/26/06 05:28 PM (17 years, 10 months ago)

Damn...

I think lots of ppl are talkin bout different stuff :smile:


Extras: Filter Print Post Top
Invisiblekaniz
That one, overthere.
Male

Registered: 07/23/04
Posts: 4,166
Loc: Ontario
Re: acid question [Re: Koala Koolio]
    #5341962 - 02/26/06 05:29 PM (17 years, 10 months ago)

Another weird thing from my rescent LSD trips, is this 'uncomfortable' feeling - it's almost a pain, but it's a pain that I enjoy and welcome. It's not a physical body-pain or anything like that. It's more like a pain on the conciousness/psyche level.

For some reason, the lyrics from Plastikmans - Disconnect seem to ring true to what I'm feeling.

Quote:


i try in vain
to disconnect my brain
i don't know if i can handle it
handle so much pain


i don't know what's left to gain
all the guilt and now the blame
i don't want to stop this game
i'm starting to enjoy the pain


i don't care what you claim
i still hear your voice replaying
the only thing that remains
is to disconnect my brain

i try to disinfect
and sanitize my brain
perhaps i won't be satisfied
until i go insane

disconnect
disconnect
disconnect my brain
disconnect
disconnect
disconnect my pain





Bolded the lines which seem to stick with me the most. Combined with the actual music in the song - it kinda taps into what I'm feeling quite a bit (I'd recomend downloading the song if you can find it)


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2  [ show all ]

Shop: Left Coast Kratom Buy Kratom Extract   Mushroom-Hut Liquid Cultures   Bridgetown Botanicals Bridgetown Botanicals   Kraken Kratom Red Vein Kratom   Unfolding Nature Unfolding Nature: Being in the Implicate Order   North Spore Injection Grain Bag


Similar ThreadsPosterViewsRepliesLast post
* acid question red1 801 5 06/11/02 07:07 AM
by Gmiadlicher
* Another Acid Question Mortician 950 2 06/02/01 08:32 AM
by Intox
* Re: Acid Question DXMHEAD420 925 1 03/04/01 08:35 PM
by Anonymous
* important question!! to much shrooms in a weekend? getmyshroomon 1,567 4 11/08/02 04:35 PM
by Strumpling
* acid and studying esin 1,997 9 01/31/03 06:23 PM
by u4ia
* Shrooms and acid Oook 1,328 13 10/31/05 01:27 AM
by Footprint
* Shroom Newbie - 2 Questions crazypsycho 1,809 3 08/15/01 11:03 PM
by HB
* First Acid Trip Addict 5,433 7 09/04/02 11:48 AM
by mickey_rourke

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
2,348 topic views. 1 members, 68 guests and 25 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.029 seconds spending 0.006 seconds on 12 queries.