Home | Community | Message Board

Cannabis Seeds - Original Sensible Seeds
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   Bridgetown Botanicals Bridgetown Botanicals   Original Sensible Seeds Autoflowering Cannabis Seeds   PhytoExtractum Maeng Da Thai Kratom Leaf Powder

Jump to first unread post Pages: 1 | 2 | 3  [ show all ]
Offlineshirley knott
not my real name
 User Gallery
Registered: 11/11/02
Posts: 9,105
Loc: London Flag
Last seen: 7 years, 28 days
another A to Z pictures thread
    #5332068 - 02/23/06 03:17 PM (17 years, 11 months ago)



--------------------
buh


Extras: Filter Print Post Top
OfflineSoulSurfer
Killer of Giants
Male

Registered: 10/23/03
Posts: 1,138
Loc: Canada
Last seen: 16 years, 6 months
Re: another A to Z pictures thread [Re: shirley knott]
    #5332085 - 02/23/06 03:23 PM (17 years, 11 months ago)



Boobiez!!  :laugh:


--------------------
:sunny: :sunny::sunny:


Extras: Filter Print Post Top
Offlineshirley knott
not my real name
 User Gallery
Registered: 11/11/02
Posts: 9,105
Loc: London Flag
Last seen: 7 years, 28 days
Re: another A to Z pictures thread [Re: shirley knott]
    #5332086 - 02/23/06 03:23 PM (17 years, 11 months ago)

that's A for Ambergris, by the way. a sperm whale secretion used in perfumes.

B, anyone?


--------------------
buh


Extras: Filter Print Post Top
Invisiblepoke smot!
floccinocci floofinator
Male

Registered: 01/08/03
Posts: 5,248
Re: another A to Z pictures thread *DELETED* [Re: shirley knott]
    #5332089 - 02/23/06 03:24 PM (17 years, 11 months ago)

Post deleted by poke smot!

Reason for deletion: x



Extras: Filter Print Post Top
Invisiblepoke smot!
floccinocci floofinator
Male

Registered: 01/08/03
Posts: 5,248
Re: another A to Z pictures thread *DELETED* [Re: poke smot!]
    #5332092 - 02/23/06 03:25 PM (17 years, 11 months ago)

Post deleted by poke smot!

Reason for deletion: x



Extras: Filter Print Post Top
Invisibleshriek
*********

Registered: 12/13/03
Posts: 3,274
Re: another A to Z pictures thread [Re: poke smot!]
    #5332097 - 02/23/06 03:26 PM (17 years, 11 months ago)



c for cannabis


Extras: Filter Print Post Top
Invisiblepoke smot!
floccinocci floofinator
Male

Registered: 01/08/03
Posts: 5,248
Re: another A to Z pictures thread *DELETED* [Re: shriek]
    #5332111 - 02/23/06 03:31 PM (17 years, 11 months ago)

Post deleted by poke smot!

Reason for deletion: x



Extras: Filter Print Post Top
InvisiblePrisoner#1
Even Dumber ThanAdvertized!
 User Gallery

Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
Re: another A to Z pictures thread [Re: poke smot!]
    #5332119 - 02/23/06 03:34 PM (17 years, 11 months ago)

E is for Everything
and we own it  :smirk:



Extras: Filter Print Post Top
Invisiblepoke smot!
floccinocci floofinator
Male

Registered: 01/08/03
Posts: 5,248
Re: another A to Z pictures thread *DELETED* [Re: Prisoner#1]
    #5332123 - 02/23/06 03:37 PM (17 years, 11 months ago)

Post deleted by poke smot!

Reason for deletion: x



Extras: Filter Print Post Top
OfflineScarfmeister
Thrill Seeker
Registered: 10/31/02
Posts: 8,127
Loc: The will to power
Last seen: 4 years, 6 months
Re: another A to Z pictures thread [Re: poke smot!]
    #5332132 - 02/23/06 03:41 PM (17 years, 11 months ago)



--------------------
--------------------
We're the lowest of the low, the scum of the fucking earth!


Edited by Shroomnoob (02/23/06 03:44 PM)


Extras: Filter Print Post Top
InvisibleLiz
Owl Lady
Female User Gallery

Folding@home Statistics
Registered: 11/16/04
Posts: 6,962
Loc: Massachusetts
Re: another A to Z pictures thread [Re: poke smot!]
    #5332140 - 02/23/06 03:42 PM (17 years, 11 months ago)



G is for Gay.


--------------------
Remember, remember the fifth of November
The gunpowder treason and plot.
I see no reason why gunpowder treason
Should ever be forgot.




Extras: Filter Print Post Top
Invisiblepoke smot!
floccinocci floofinator
Male

Registered: 01/08/03
Posts: 5,248
Re: another A to Z pictures thread *DELETED* [Re: Scarfmeister]
    #5332146 - 02/23/06 03:44 PM (17 years, 11 months ago)

Post deleted by poke smot!

Reason for deletion: x



Extras: Filter Print Post Top
Offlineshirley knott
not my real name
 User Gallery
Registered: 11/11/02
Posts: 9,105
Loc: London Flag
Last seen: 7 years, 28 days
Re: another A to Z pictures thread [Re: poke smot!]
    #5332175 - 02/23/06 04:00 PM (17 years, 11 months ago)

J is for Jambalaya



what is that great pic of a girl getting her ass grabbed all about?
(not that it matters, the more the merrier as far as i'm concerned  :thumbup: :tongue:)


--------------------
buh


Extras: Filter Print Post Top
OfflineIdiot
I Am Moron!
Male User Gallery

Registered: 11/27/05
Posts: 6,554
Loc: 41.90231, 12.45390 Flag
Last seen: 8 days, 2 hours
Re: another A to Z pictures thread [Re: poke smot!]
    #5332176 - 02/23/06 04:00 PM (17 years, 11 months ago)



--------------------

Customize your Shroomery experience!
Do not argue with an idiot. He will drag you down to his level and beat you with experience.


Edited by Idiot (02/23/06 04:02 PM)


Extras: Filter Print Post Top
OfflineScarfmeister
Thrill Seeker
Registered: 10/31/02
Posts: 8,127
Loc: The will to power
Last seen: 4 years, 6 months
Re: another A to Z pictures thread [Re: shirley knott]
    #5332209 - 02/23/06 04:18 PM (17 years, 11 months ago)

G-string


--------------------
--------------------
We're the lowest of the low, the scum of the fucking earth!


Extras: Filter Print Post Top
Offlineshirley knott
not my real name
 User Gallery
Registered: 11/11/02
Posts: 9,105
Loc: London Flag
Last seen: 7 years, 28 days
Re: another A to Z pictures thread [Re: Scarfmeister]
    #5332233 - 02/23/06 04:33 PM (17 years, 11 months ago)

oh yeah

who's got K? for fuck's sake post K (to me)


--------------------
buh


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: another A to Z pictures thread [Re: shirley knott]
    #5332241 - 02/23/06 04:38 PM (17 years, 11 months ago)

I think you're on L, with two G's , and two B's.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Invisiblevinsue
Grand Old Fart
Male User Gallery

Registered: 02/17/04
Posts: 17,953
Loc: The Garden State(NJ) Flag
Re: another A to Z pictures thread [Re: shirley knott]
    #5332307 - 02/23/06 05:02 PM (17 years, 11 months ago)



--------------------

"All mushrooms are edible; but some only once." Croatian proverb. BTW ...
  Have You Rated Ythans Mom Yet ?? ... :taser:  ... HERE'S HOW ... (be nice) .  :mod: ... :peace:


Extras: Filter Print Post Top
Invisiblepoke smot!
floccinocci floofinator
Male

Registered: 01/08/03
Posts: 5,248
Re: another A to Z pictures thread *DELETED* [Re: vinsue]
    #5332340 - 02/23/06 05:11 PM (17 years, 11 months ago)

Post deleted by poke smot!

Reason for deletion: x



Extras: Filter Print Post Top
InvisiblePrisoner#1
Even Dumber ThanAdvertized!
 User Gallery

Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
Re: another A to Z pictures thread [Re: poke smot!]
    #5332355 - 02/23/06 05:17 PM (17 years, 11 months ago)

J is for Jackoff



Extras: Filter Print Post Top
OfflineCubenisseur
Mad Props
Male

Registered: 12/04/05
Posts: 1,392
Loc: Indian Land
Last seen: 13 years, 10 months
Re: another A to Z pictures thread [Re: Prisoner#1]
    #5332898 - 02/23/06 08:09 PM (17 years, 11 months ago)

N for Noah's Ark.



Extras: Filter Print Post Top
Invisibleblissedout
Male User Gallery

Registered: 11/11/04
Posts: 22,320
Loc: Yonder
Re: another A to Z pictures thread [Re: Cubenisseur]
    #5332954 - 02/23/06 08:24 PM (17 years, 11 months ago)

Whatt happened to M?



--------------------



:murray:


Extras: Filter Print Post Top
InvisiblePrisoner#1
Even Dumber ThanAdvertized!
 User Gallery

Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
Re: another A to Z pictures thread [Re: blissedout]
    #5333030 - 02/23/06 08:49 PM (17 years, 11 months ago)

you forgot L fo lusty lady lapping luxurious load lober



Extras: Filter Print Post Top
Invisibleblissedout
Male User Gallery

Registered: 11/11/04
Posts: 22,320
Loc: Yonder
Re: another A to Z pictures thread [Re: Prisoner#1]
    #5333037 - 02/23/06 08:52 PM (17 years, 11 months ago)

Nu uh!

Vinsue posted a sheet of L!:razz:


--------------------



:murray:


Extras: Filter Print Post Top
InvisibleBoom
just a tester
Male
Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
Re: another A to Z pictures thread [Re: blissedout]
    #5333088 - 02/23/06 09:05 PM (17 years, 11 months ago)

O -- orangutan



Extras: Filter Print Post Top
Invisibleblissedout
Male User Gallery

Registered: 11/11/04
Posts: 22,320
Loc: Yonder
Re: another A to Z pictures thread [Re: Boom]
    #5333141 - 02/23/06 09:20 PM (17 years, 11 months ago)

Prague



--------------------



:murray:


Extras: Filter Print Post Top
InvisibleDieCommie

Registered: 12/11/03
Posts: 29,258
Re: another A to Z pictures thread [Re: blissedout]
    #5333283 - 02/23/06 09:52 PM (17 years, 11 months ago)

quantum physicist


Extras: Filter Print Post Top
InvisibleBoom
just a tester
Male
Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
Re: another A to Z pictures thread [Re: DieCommie]
    #5333293 - 02/23/06 09:54 PM (17 years, 11 months ago)

'roids



Extras: Filter Print Post Top
InvisibleDieCommie

Registered: 12/11/03
Posts: 29,258
Re: another A to Z pictures thread [Re: Boom]
    #5333314 - 02/23/06 09:58 PM (17 years, 11 months ago)

stoning



Extras: Filter Print Post Top
InvisibleBoom
just a tester
Male
Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
Re: another A to Z pictures thread [Re: DieCommie]
    #5333343 - 02/23/06 10:01 PM (17 years, 11 months ago)

Tijuana!!



Extras: Filter Print Post Top
InvisibleBoom
just a tester
Male
Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
Re: another A to Z pictures thread [Re: Boom]
    #5333356 - 02/23/06 10:04 PM (17 years, 11 months ago)

UAE!



NJ :smirk:


Extras: Filter Print Post Top
Invisibleblissedout
Male User Gallery

Registered: 11/11/04
Posts: 22,320
Loc: Yonder
Re: another A to Z pictures thread [Re: Boom]
    #5333381 - 02/23/06 10:08 PM (17 years, 11 months ago)

Vlad


--------------------



:murray:


Extras: Filter Print Post Top
InvisibleBoom
just a tester
Male
Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
Re: another A to Z pictures thread [Re: blissedout]
    #5333386 - 02/23/06 10:09 PM (17 years, 11 months ago)

Waco



Extras: Filter Print Post Top
OfflineKerr
Who else would I be

Registered: 02/05/05
Posts: 1,611
Loc: My roots in the Koots
Last seen: 5 years, 3 months
Re: another A to Z pictures thread [Re: Boom]
    #5333408 - 02/23/06 10:13 PM (17 years, 11 months ago)

Xylophone



I loved playing these in school as a kid :grin:


--------------------
"Easy going and organic thoughts bent on self experimentation and knowledge and growth for the betterment of self and those around us"
-Playdo the philosophiser


Extras: Filter Print Post Top
InvisibleBoom
just a tester
Male
Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
Re: another A to Z pictures thread [Re: Kerr]
    #5333416 - 02/23/06 10:15 PM (17 years, 11 months ago)

Zorb




What NOW/?????


Extras: Filter Print Post Top
InvisibleDieCommie

Registered: 12/11/03
Posts: 29,258
Re: another A to Z pictures thread [Re: Boom]
    #5333476 - 02/23/06 10:24 PM (17 years, 11 months ago)

alpha particle



Extras: Filter Print Post Top
InvisibleDieCommie

Registered: 12/11/03
Posts: 29,258
Re: another A to Z pictures thread [Re: DieCommie]
    #5333487 - 02/23/06 10:25 PM (17 years, 11 months ago)

beta fish



Extras: Filter Print Post Top
Offlinefresh313
journeyman
 User Gallery

Registered: 09/01/03
Posts: 2,537
Last seen: 12 years, 9 months
Re: another A to Z pictures thread [Re: DieCommie]
    #5333523 - 02/23/06 10:35 PM (17 years, 11 months ago)


cpu core


Extras: Filter Print Post Top
InvisibleDieCommie

Registered: 12/11/03
Posts: 29,258
Re: another A to Z pictures thread [Re: fresh313]
    #5333529 - 02/23/06 10:37 PM (17 years, 11 months ago)

duuuudz!  gamma comes after beta    :eyeball:


Extras: Filter Print Post Top
InvisibleDieCommie

Registered: 12/11/03
Posts: 29,258
Re: another A to Z pictures thread [Re: DieCommie]
    #5333534 - 02/23/06 10:38 PM (17 years, 11 months ago)

gamma irradiated monster



Extras: Filter Print Post Top
Offlinefresh313
journeyman
 User Gallery

Registered: 09/01/03
Posts: 2,537
Last seen: 12 years, 9 months
Re: another A to Z pictures thread [Re: DieCommie]
    #5333589 - 02/23/06 10:52 PM (17 years, 11 months ago)



Extras: Filter Print Post Top
OfflineDocPsilocybin
enthusiast

Registered: 04/22/02
Posts: 588
Last seen: 13 years, 1 month
Re: another A to Z pictures thread [Re: fresh313]
    #5333693 - 02/23/06 11:36 PM (17 years, 11 months ago)

Intron



--------------------
You can't hold a man down without staying down with him.
-- Booker T. Washington


Edited by DocPsilocybin (02/23/06 11:36 PM)


Extras: Filter Print Post Top
Offlinefresh313
journeyman
 User Gallery

Registered: 09/01/03
Posts: 2,537
Last seen: 12 years, 9 months
Re: another A to Z pictures thread [Re: DocPsilocybin]
    #5333796 - 02/24/06 12:29 AM (17 years, 11 months ago)



Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3  [ show all ]

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   Bridgetown Botanicals Bridgetown Botanicals   Original Sensible Seeds Autoflowering Cannabis Seeds   PhytoExtractum Maeng Da Thai Kratom Leaf Powder


Similar ThreadsPosterViewsRepliesLast post
* Another dog picture thread.
( 1 2 all )
Hanky 4,368 27 05/08/04 09:45 PM
by Merkin
* The Random Picture Thread
( 1 2 all )
daba 2,714 21 12/30/03 12:10 AM
by moana123
* Put a face on the shroomery! Pictures!!
( 1 2 3 4 ... 37 38 )
OuchITripped 57,183 752 05/19/05 05:53 AM
by CaRnAgECaNdY
* Post some pictures... (A quasi-narcissistic thread)
( 1 2 3 4 5 6 all )
Adamist 20,184 114 01/06/04 04:17 PM
by notapillow
* Picture Time... Show Your Stuff!!!
( 1 2 3 4 ... 63 64 )
RebelSteve33 135,391 1,266 08/27/04 10:31 PM
by CaRnAgECaNdY
* 9 headless bodies found in Tijuana
( 1 2 all )
LobsterSauceDiscord 1,298 20 12/02/08 08:07 PM
by KrishnaDreamer
* Missing Friend, San Diego Mexico/Tijuana border area. nofind_um 3,574 9 03/12/08 10:57 AM
by Cakes
* The Confession thread.....
( 1 2 3 4 all )
OldSpice 8,328 79 09/23/07 04:31 PM
by Nemo_Hoes

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Entire Staff
2,285 topic views. 6 members, 53 guests and 30 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.04 seconds spending 0.01 seconds on 14 queries.