|
shirley knott
not my real name

Registered: 11/11/02
Posts: 9,105
Loc: London
Last seen: 7 years, 28 days
|
another A to Z pictures thread
#5332068 - 02/23/06 03:17 PM (17 years, 11 months ago) |
|
|
-------------------- buh
|
SoulSurfer
Killer of Giants


Registered: 10/23/03
Posts: 1,138
Loc: Canada
Last seen: 16 years, 6 months
|
Re: another A to Z pictures thread [Re: shirley knott]
#5332085 - 02/23/06 03:23 PM (17 years, 11 months ago) |
|
|
Boobiez!!
|
shirley knott
not my real name

Registered: 11/11/02
Posts: 9,105
Loc: London
Last seen: 7 years, 28 days
|
Re: another A to Z pictures thread [Re: shirley knott]
#5332086 - 02/23/06 03:23 PM (17 years, 11 months ago) |
|
|
that's A for Ambergris, by the way. a sperm whale secretion used in perfumes.
B, anyone?
-------------------- buh
|
poke smot!
floccinocci floofinator


Registered: 01/08/03
Posts: 5,248
|
Re: another A to Z pictures thread *DELETED* [Re: shirley knott]
#5332089 - 02/23/06 03:24 PM (17 years, 11 months ago) |
|
|
Post deleted by poke smot!Reason for deletion: x
|
poke smot!
floccinocci floofinator


Registered: 01/08/03
Posts: 5,248
|
Re: another A to Z pictures thread *DELETED* [Re: poke smot!]
#5332092 - 02/23/06 03:25 PM (17 years, 11 months ago) |
|
|
Post deleted by poke smot!Reason for deletion: x
|
shriek
*********

Registered: 12/13/03
Posts: 3,274
|
Re: another A to Z pictures thread [Re: poke smot!]
#5332097 - 02/23/06 03:26 PM (17 years, 11 months ago) |
|
|

c for cannabis
|
poke smot!
floccinocci floofinator


Registered: 01/08/03
Posts: 5,248
|
Re: another A to Z pictures thread *DELETED* [Re: shriek]
#5332111 - 02/23/06 03:31 PM (17 years, 11 months ago) |
|
|
Post deleted by poke smot!Reason for deletion: x
|
Prisoner#1
Even Dumber ThanAdvertized!


Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: another A to Z pictures thread [Re: poke smot!]
#5332119 - 02/23/06 03:34 PM (17 years, 11 months ago) |
|
|
E is for Everything and we own it 
|
poke smot!
floccinocci floofinator


Registered: 01/08/03
Posts: 5,248
|
Re: another A to Z pictures thread *DELETED* [Re: Prisoner#1]
#5332123 - 02/23/06 03:37 PM (17 years, 11 months ago) |
|
|
Post deleted by poke smot!Reason for deletion: x
|
Scarfmeister
Thrill Seeker
Registered: 10/31/02
Posts: 8,127
Loc: The will to power
Last seen: 4 years, 6 months
|
Re: another A to Z pictures thread [Re: poke smot!]
#5332132 - 02/23/06 03:41 PM (17 years, 11 months ago) |
|
|
-------------------- -------------------- We're the lowest of the low, the scum of the fucking earth!
Edited by Shroomnoob (02/23/06 03:44 PM)
|
Liz
Owl Lady



Registered: 11/16/04
Posts: 6,962
Loc: Massachusetts
|
Re: another A to Z pictures thread [Re: poke smot!]
#5332140 - 02/23/06 03:42 PM (17 years, 11 months ago) |
|
|

G is for Gay.
-------------------- Remember, remember the fifth of November The gunpowder treason and plot. I see no reason why gunpowder treason Should ever be forgot.
|
poke smot!
floccinocci floofinator


Registered: 01/08/03
Posts: 5,248
|
Re: another A to Z pictures thread *DELETED* [Re: Scarfmeister]
#5332146 - 02/23/06 03:44 PM (17 years, 11 months ago) |
|
|
Post deleted by poke smot!Reason for deletion: x
|
shirley knott
not my real name

Registered: 11/11/02
Posts: 9,105
Loc: London
Last seen: 7 years, 28 days
|
Re: another A to Z pictures thread [Re: poke smot!]
#5332175 - 02/23/06 04:00 PM (17 years, 11 months ago) |
|
|
J is for Jambalaya

what is that great pic of a girl getting her ass grabbed all about? (not that it matters, the more the merrier as far as i'm concerned )
-------------------- buh
|
Idiot
I Am Moron!


Registered: 11/27/05
Posts: 6,554
Loc: 41.90231, 12.45390
Last seen: 8 days, 2 hours
|
Re: another A to Z pictures thread [Re: poke smot!]
#5332176 - 02/23/06 04:00 PM (17 years, 11 months ago) |
|
|
-------------------- Customize your Shroomery experience! Do not argue with an idiot. He will drag you down to his level and beat you with experience.
Edited by Idiot (02/23/06 04:02 PM)
|
Scarfmeister
Thrill Seeker
Registered: 10/31/02
Posts: 8,127
Loc: The will to power
Last seen: 4 years, 6 months
|
Re: another A to Z pictures thread [Re: shirley knott]
#5332209 - 02/23/06 04:18 PM (17 years, 11 months ago) |
|
|
G-string
-------------------- -------------------- We're the lowest of the low, the scum of the fucking earth!
|
shirley knott
not my real name

Registered: 11/11/02
Posts: 9,105
Loc: London
Last seen: 7 years, 28 days
|
Re: another A to Z pictures thread [Re: Scarfmeister]
#5332233 - 02/23/06 04:33 PM (17 years, 11 months ago) |
|
|
oh yeah
who's got K? for fuck's sake post K (to me)
-------------------- buh
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: another A to Z pictures thread [Re: shirley knott]
#5332241 - 02/23/06 04:38 PM (17 years, 11 months ago) |
|
|
I think you're on L, with two G's , and two B's.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
vinsue
Grand Old Fart


Registered: 02/17/04
Posts: 17,953
Loc: The Garden State(NJ)
|
Re: another A to Z pictures thread [Re: shirley knott]
#5332307 - 02/23/06 05:02 PM (17 years, 11 months ago) |
|
|
--------------------
"All mushrooms are edible; but some only once." Croatian proverb. BTW ... Have You Rated Ythans Mom Yet ?? ... ... HERE'S HOW ... (be nice) . ...
|
poke smot!
floccinocci floofinator


Registered: 01/08/03
Posts: 5,248
|
Re: another A to Z pictures thread *DELETED* [Re: vinsue]
#5332340 - 02/23/06 05:11 PM (17 years, 11 months ago) |
|
|
Post deleted by poke smot!Reason for deletion: x
|
Prisoner#1
Even Dumber ThanAdvertized!


Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: another A to Z pictures thread [Re: poke smot!]
#5332355 - 02/23/06 05:17 PM (17 years, 11 months ago) |
|
|
J is for Jackoff
|
Cubenisseur
Mad Props


Registered: 12/04/05
Posts: 1,392
Loc: Indian Land
Last seen: 13 years, 10 months
|
Re: another A to Z pictures thread [Re: Prisoner#1]
#5332898 - 02/23/06 08:09 PM (17 years, 11 months ago) |
|
|
N for Noah's Ark.
|
blissedout


Registered: 11/11/04
Posts: 22,320
Loc: Yonder
|
Re: another A to Z pictures thread [Re: Cubenisseur]
#5332954 - 02/23/06 08:24 PM (17 years, 11 months ago) |
|
|
Whatt happened to M?
--------------------
|
Prisoner#1
Even Dumber ThanAdvertized!


Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: another A to Z pictures thread [Re: blissedout]
#5333030 - 02/23/06 08:49 PM (17 years, 11 months ago) |
|
|
you forgot L fo lusty lady lapping luxurious load lober
|
blissedout


Registered: 11/11/04
Posts: 22,320
Loc: Yonder
|
Re: another A to Z pictures thread [Re: Prisoner#1]
#5333037 - 02/23/06 08:52 PM (17 years, 11 months ago) |
|
|
Nu uh!
Vinsue posted a sheet of L!
--------------------
|
Boom
just a tester

Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
|
Re: another A to Z pictures thread [Re: blissedout]
#5333088 - 02/23/06 09:05 PM (17 years, 11 months ago) |
|
|
O -- orangutan
|
blissedout


Registered: 11/11/04
Posts: 22,320
Loc: Yonder
|
Re: another A to Z pictures thread [Re: Boom]
#5333141 - 02/23/06 09:20 PM (17 years, 11 months ago) |
|
|
Prague
--------------------
|
DieCommie

Registered: 12/11/03
Posts: 29,258
|
Re: another A to Z pictures thread [Re: blissedout]
#5333283 - 02/23/06 09:52 PM (17 years, 11 months ago) |
|
|
quantum physicist
|
Boom
just a tester

Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
|
Re: another A to Z pictures thread [Re: DieCommie]
#5333293 - 02/23/06 09:54 PM (17 years, 11 months ago) |
|
|
'roids
|
DieCommie

Registered: 12/11/03
Posts: 29,258
|
Re: another A to Z pictures thread [Re: Boom]
#5333314 - 02/23/06 09:58 PM (17 years, 11 months ago) |
|
|
stoning
|
Boom
just a tester

Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
|
Re: another A to Z pictures thread [Re: DieCommie]
#5333343 - 02/23/06 10:01 PM (17 years, 11 months ago) |
|
|
Tijuana!!
|
Boom
just a tester

Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
|
Re: another A to Z pictures thread [Re: Boom]
#5333356 - 02/23/06 10:04 PM (17 years, 11 months ago) |
|
|
UAE!

NJ
|
blissedout


Registered: 11/11/04
Posts: 22,320
Loc: Yonder
|
Re: another A to Z pictures thread [Re: Boom]
#5333381 - 02/23/06 10:08 PM (17 years, 11 months ago) |
|
|
Vlad
--------------------
|
Boom
just a tester

Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
|
Re: another A to Z pictures thread [Re: blissedout]
#5333386 - 02/23/06 10:09 PM (17 years, 11 months ago) |
|
|
Waco
|
Kerr
Who else would I be

Registered: 02/05/05
Posts: 1,611
Loc: My roots in the Koots
Last seen: 5 years, 3 months
|
Re: another A to Z pictures thread [Re: Boom]
#5333408 - 02/23/06 10:13 PM (17 years, 11 months ago) |
|
|
Xylophone
I loved playing these in school as a kid
-------------------- "Easy going and organic thoughts bent on self experimentation and knowledge and growth for the betterment of self and those around us" -Playdo the philosophiser
|
Boom
just a tester

Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
|
Re: another A to Z pictures thread [Re: Kerr]
#5333416 - 02/23/06 10:15 PM (17 years, 11 months ago) |
|
|
Zorb

What NOW/?????
|
DieCommie

Registered: 12/11/03
Posts: 29,258
|
Re: another A to Z pictures thread [Re: Boom]
#5333476 - 02/23/06 10:24 PM (17 years, 11 months ago) |
|
|
alpha particle
|
DieCommie

Registered: 12/11/03
Posts: 29,258
|
Re: another A to Z pictures thread [Re: DieCommie]
#5333487 - 02/23/06 10:25 PM (17 years, 11 months ago) |
|
|
beta fish
|
fresh313
journeyman


Registered: 09/01/03
Posts: 2,537
Last seen: 12 years, 9 months
|
Re: another A to Z pictures thread [Re: DieCommie]
#5333523 - 02/23/06 10:35 PM (17 years, 11 months ago) |
|
|
 cpu core
|
DieCommie

Registered: 12/11/03
Posts: 29,258
|
Re: another A to Z pictures thread [Re: fresh313]
#5333529 - 02/23/06 10:37 PM (17 years, 11 months ago) |
|
|
duuuudz! gamma comes after beta
|
DieCommie

Registered: 12/11/03
Posts: 29,258
|
Re: another A to Z pictures thread [Re: DieCommie]
#5333534 - 02/23/06 10:38 PM (17 years, 11 months ago) |
|
|
gamma irradiated monster
|
fresh313
journeyman


Registered: 09/01/03
Posts: 2,537
Last seen: 12 years, 9 months
|
Re: another A to Z pictures thread [Re: DieCommie]
#5333589 - 02/23/06 10:52 PM (17 years, 11 months ago) |
|
|
|
DocPsilocybin
enthusiast

Registered: 04/22/02
Posts: 588
Last seen: 13 years, 1 month
|
Re: another A to Z pictures thread [Re: fresh313]
#5333693 - 02/23/06 11:36 PM (17 years, 11 months ago) |
|
|
Intron
-------------------- You can't hold a man down without staying down with him. -- Booker T. Washington
Edited by DocPsilocybin (02/23/06 11:36 PM)
|
fresh313
journeyman


Registered: 09/01/03
Posts: 2,537
Last seen: 12 years, 9 months
|
Re: another A to Z pictures thread [Re: DocPsilocybin]
#5333796 - 02/24/06 12:29 AM (17 years, 11 months ago) |
|
|
|
|