|
Guitarpro1313
Stranger

Registered: 02/14/06
Posts: 106
Loc: Minnesota, USA
Last seen: 14 years, 8 months
|
ass or tits?
#5321606 - 02/20/06 08:28 PM (17 years, 11 months ago) |
|
|
tit guy or ass guy?
-------------------- PEACE HOW PEACE NOwWwWwWwWwWwWwWwWwW
|
DNKYD
Turtle!

Registered: 09/23/04
Posts: 12,326
|
|
I prefer the tits and ass on women, thanks.
|
horha
trout


Registered: 02/07/06
Posts: 292
Last seen: 17 years, 3 months
|
|
tits
|
GenesisOmega
Stranger
Registered: 07/07/05
Posts: 17
Loc: Mobile, Alabama
Last seen: 16 years, 11 months
|
Re: ass or tits? [Re: horha]
#5321628 - 02/20/06 08:32 PM (17 years, 11 months ago) |
|
|
Tits, without a doubt
|
PinballWizard
Naive and Gullible as usual

Registered: 03/20/04
Posts: 2,804
Last seen: 9 years, 9 months
|
|
Definately tits. I have my own ass.
|
Silversoul
Rhizome


Registered: 01/01/05
Posts: 23,576
Loc: The Barricades
|
|
Quote:
PinballWizard said: Definately tits. I have my own ass.
--------------------
|
psychonaut_420
psychonaut

Registered: 02/13/06
Posts: 285
Loc: mid atlantic
Last seen: 16 years, 10 months
|
|
tits
--------------------
"Life sucks, Shit happens, Smoke weed and forget about it"
|
Guitarpro1313
Stranger

Registered: 02/14/06
Posts: 106
Loc: Minnesota, USA
Last seen: 14 years, 8 months
|
Re: ass or tits? [Re: DNKYD]
#5321649 - 02/20/06 08:35 PM (17 years, 11 months ago) |
|
|
Quote:
DNKYD said: I prefer the tits and ass on women, thanks.
smart ass
-------------------- PEACE HOW PEACE NOwWwWwWwWwWwWwWwWwW
|
Bobnasty
Just AppreciateNature


Registered: 01/22/06
Posts: 158
Loc: Murder Mitten
Last seen: 17 years, 7 months
|
|
The twin cities 
And I'm not talking Minnesota
Edited by Bobnasty (02/20/06 08:38 PM)
|
HippieChick
Chicks can do it too!


Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
|
Re: ass or tits? [Re: Bobnasty]
#5321667 - 02/20/06 08:39 PM (17 years, 11 months ago) |
|
|
Tits . 
Peace,Love,Happiness and Harmony Hippie Chick
-------------------- Peace,Love and Happiness HC Freedoms just another word for nothing left to lose.............. I LUV My Greenhouse http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848 My First Pans http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058
|
Shroomism
Space Travellin


Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension
|
|
Tits FTW!
--------------------
|
eligal
Noobie


Registered: 05/25/05
Posts: 7,021
Loc: California
|
|
Quote:
HippieChick said: Tits . 
Peace,Love,Happiness and Harmony Hippie Chick
ehehe! nice.
im an ass guy, but a good pair of tits definately needs to be stared at
-------------------- \m/ Spanksta \m/ "do you have the freedom to do with your nervous system what you want?" "MolokoMilkPlus said: I'll respect you if you let me give you a blow job" "tactik said: respect the can."
|
drtyfrnk
PresidentialCandidate 2008



Registered: 01/24/05
Posts: 2,961
Loc: Ontario, Canada
Last seen: 14 years, 3 months
|
Re: ass or tits? [Re: eligal]
#5321721 - 02/20/06 08:51 PM (17 years, 11 months ago) |
|
|
Titties...
I'm all about it.
-------------------- It's Krang, Bitch!
|
Blek
Stranger


Registered: 08/17/05
Posts: 983
Loc: The universe
Last seen: 14 years, 2 months
|
Re: ass or tits? [Re: drtyfrnk]
#5321728 - 02/20/06 08:53 PM (17 years, 11 months ago) |
|
|
Belly button.
|
WhiteBunny
How deep doesthe rabbit hole go?


Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
|
Re: ass or tits? [Re: drtyfrnk]
#5321740 - 02/20/06 08:54 PM (17 years, 11 months ago) |
|
|
perky tits
WB
--------------------
|
Noetical
Flip Horrorshow

Registered: 11/28/04
Posts: 9,230
|
|
All about the small tight ass, I love tiny girls
|
eligal
Noobie


Registered: 05/25/05
Posts: 7,021
Loc: California
|
Re: ass or tits? [Re: Noetical]
#5321761 - 02/20/06 09:00 PM (17 years, 11 months ago) |
|
|
what about us tiny boys?
-------------------- \m/ Spanksta \m/ "do you have the freedom to do with your nervous system what you want?" "MolokoMilkPlus said: I'll respect you if you let me give you a blow job" "tactik said: respect the can."
|
four_winds
ne-se
Registered: 02/12/06
Posts: 382
Loc: steady
Last seen: 17 years, 10 months
|
|
Is the eyes or legs of a woman a choice? Yeah, those two.
|
Shroomism
Space Travellin


Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension
|
|
--------------------
|
eric_the_red


Registered: 02/28/03
Posts: 13,742
Loc: happy land
|
|
i enjoy proper proportion of the two, rather than one over the other.
-------------------- Anno cock? is that some kind of Greek liqueur? -Geo's All Knowing Sex Slave
|
Noetical
Flip Horrorshow

Registered: 11/28/04
Posts: 9,230
|
Re: ass or tits? [Re: eligal]
#5321804 - 02/20/06 09:12 PM (17 years, 11 months ago) |
|
|
only if she has an ass like a ten year old boy
|
four_winds
ne-se
Registered: 02/12/06
Posts: 382
Loc: steady
Last seen: 17 years, 10 months
|
Re: ass or tits? [Re: Shroomism]
#5321825 - 02/20/06 09:16 PM (17 years, 11 months ago) |
|
|
Quote:
Shroomism said:
   
that was almost a life changing experience. Had there been a crowd of women nearby, at least ten of them would be impregnated with the fire-hose effect.
|
ShroomFan
nn dmt

Registered: 03/12/04
Posts: 866
Last seen: 10 years, 11 months
|
|
ass i a must..i can live with small boobs as long sa the ass is right
-------------------- Fellow Shroomerites, if you Love expressing yourself with a dope tee shirt feast your 3rd eye on www.facebook.com/vicereversa ∞ Conscious Clothing for Conscious Minds ∞ Wear a tee , open a mind Each shirt is spawned to Arouse Awareness <> We believe in Sustainability & Giving back <> Do you know of a community project or persons in need you feel deserves attention? - Tell us on our page And we just might pick the story > develop a tee > and donate the proceeds to that cause. ∞♥∞ Unget it, VICE REVERSA
|
TYL3R


Registered: 11/19/04
Posts: 17,493
|
|
I'll choose one tit, and one cheek
|
goobler
Reanimated



Registered: 02/24/03
Posts: 48,909
|
Re: ass or tits? [Re: ShroomFan]
#5321854 - 02/20/06 09:22 PM (17 years, 11 months ago) |
|
|
spelling? tori?
|
Basidiocarp
Dr. BunsenHoneydew


Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
|
|
Tits on girls (small and perky, none of that double-D over-kill please), and cute butts on guys. Um, I guess this one ---> is appropriate for here...
-------------------- "...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."
Visit the Psychonautical Society
|
HippieChick
Chicks can do it too!


Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
|
Re: ass or tits? [Re: Noetical]
#5321897 - 02/20/06 09:31 PM (17 years, 11 months ago) |
|
|
Quote:
noeticbuzz said: All about the small tight ass, I love tiny girls
You'd love me

LOL
Peace,Love,Happiness and Harmony Hippie Chick
-------------------- Peace,Love and Happiness HC Freedoms just another word for nothing left to lose.............. I LUV My Greenhouse http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848 My First Pans http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058
|
Basidiocarp
Dr. BunsenHoneydew


Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
|
|
Quote:
HippieChick said:
Quote:
noeticbuzz said: All about the small tight ass, I love tiny girls
You'd love me

Holy shite, a girl that would fit into my All American. I am in Lust! *Woot!*
-------------------- "...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."
Visit the Psychonautical Society
|
Shroomism
Space Travellin


Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension
|
|
Any chick that can fit in a PC is alright in my book
--------------------
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
Yeah, no need to use protection if you sterilize them first.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
TYL3R


Registered: 11/19/04
Posts: 17,493
|
Re: ass or tits? [Re: Shroomism]
#5321942 - 02/20/06 09:41 PM (17 years, 11 months ago) |
|
|
Is that a PC ?
I thought it was some kind of pot....
|
Shroomism
Space Travellin


Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension
|
Re: ass or tits? [Re: TYL3R]
#5321948 - 02/20/06 09:42 PM (17 years, 11 months ago) |
|
|
Pressure Cooker foolio ' get down with the myco terminology
--------------------
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: ass or tits? [Re: TYL3R]
#5321951 - 02/20/06 09:43 PM (17 years, 11 months ago) |
|
|
Pressure...
Cooker.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
WhiteBunny
How deep doesthe rabbit hole go?


Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
|
Re: ass or tits? [Re: Shroomism]
#5321959 - 02/20/06 09:46 PM (17 years, 11 months ago) |
|
|
Quote:
Shroomism said:
   
that first picture is amazing please tell me where i can find this girl in action.
WB
--------------------
|
Shroomism
Space Travellin


Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension
|
|
--------------------
|
Basidiocarp
Dr. BunsenHoneydew


Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
|
Re: ass or tits? [Re: Shroomism]
#5321975 - 02/20/06 09:50 PM (17 years, 11 months ago) |
|
|
Well a little too much... what does Austin Powers call them... "jublie" action goin' on there for this Shroomerite, heh.
-------------------- "...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."
Visit the Psychonautical Society
|
WhiteBunny
How deep doesthe rabbit hole go?


Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
|
Re: ass or tits? [Re: Shroomism]
#5321976 - 02/20/06 09:50 PM (17 years, 11 months ago) |
|
|
It's late at nite and she might be my bed time medicine I have to be at work at 7:30 
please tell me there are more picture of videos of this girl, her tits are amazing!!!
WB
--------------------
Edited by WhiteBunny (02/20/06 09:54 PM)
|
WhiteBunny
How deep doesthe rabbit hole go?


Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
|
|
Quote:
Basidiocarp said: Well a little too much... what does Austin Powers call them... "jublie" action goin' on there for this Shroomerite, heh.
NEVER to much
WB
--------------------
|
Corporal Kielbasa

Registered: 05/29/04
Posts: 17,235
|
|
i would like to one day be able to bounce a quarter off a girls ass. But untill then i will have to say titties, titties n beer titties n beer titties n beer titties n beer titties n beer titties n beer titties n beer titties n beer titties n beer titties n beer
|
Shroomism
Space Travellin


Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension
|
|
this man has his priorities straight
--------------------
|
WhiteBunny
How deep doesthe rabbit hole go?


Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
|
Re: ass or tits? [Re: Shroomism]
#5322000 - 02/20/06 09:55 PM (17 years, 11 months ago) |
|
|
Are you holding back on your girl Shroomism?
WB
--------------------
|
Shroomism
Space Travellin


Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension
|
|
If I had more.. they would have been posted already
--------------------
|
Basidiocarp
Dr. BunsenHoneydew


Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
|
|
Quote:
WhiteBunny said: NEVER to much
All a matter of taste. I go by the handfull rule muhself: More than a handfull is a waste.
-------------------- "...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."
Visit the Psychonautical Society
|
Corporal Kielbasa

Registered: 05/29/04
Posts: 17,235
|
Re: ass or tits? [Re: Shroomism]
#5322015 - 02/20/06 09:58 PM (17 years, 11 months ago) |
|
|
I?m mean ?n I?m bad, (y?know I ain?t no sissy) Got a big-titty girly by the name of ?chrissy? Talkin? about her ?n my bike ?n me... ?n this ride up the mountain of mystery, (mystery)
(how ?re you doin?? )
I noticed even the crickets Acted weird up here And so I figured I might Just drink a little beer I said, gimme summa that what yer suckin? on... But there was no reply ?cause she was gone!
Where?s those titties I like so well, ?n? my goddam beer! Is what I started to yell, then I heard this noise Like a crunchin? twig, ?n up jumped the devil! (he?s about this big!)
He had a red suit on An? a widow?s peak An? then a pointed tail ?n like a sulphur reek, Yes, it was him awright, I swear I knowed it was! He had some human flesh Stuck underneath his claws You know, it looked to me Like it was titty skin! I said, you son-of-a-bitch! (?cause I was mad at him!) He just got out his floss ?n started cleanin? his fang So I shot him with my shooter, Said: bang! bang! bang!
Then the sucker just laughed ?n said: put it away! You know, I ate her all up...now what you Gonna say? You ate my chrissy? Yeah! titties ?n all! Well what about the beer then? Now, were the cans this tall? Even her boots? Would I lie to you? Shit, you musta been hungry! Yeah, this is true. Don?t they pay you good for the Stuff that you do? Well, you know, I can?t complain when the checks come through... Well I want my chrissy, Oh yeah? ?n I want my beer Hah! So you just barf it back up! Now, devil, do you hear? Look: Blow it out your ass, motorcycle man! I mean, I am the devil, do you understand? Just what will you give me for your Titties and beer? I suppose you noticed this little Contract here... Yer goddam right, you son-of-a-whore! Don?t call me that! That?s about the only reason I learned writin? for! Gimme that paper! bet yer horns I?ll sign! Because I need a beer, ?n it?s titty- Squeezin? time! Man, you can?t fool me! you ain?t that bad! Oh yeah? Why you shoulda seen some of the souls that I?ve had! There was milhous nixon ?n agnew too! ?n both of those suckers was worse ?n you! Let?s make a deal if you think That?s true I mean, you?re supposed to be the devil so...whatcha Gonna do? Heh?
Now hold on just a second... You wanna make a deal with me hah? Yeah! Well ah, I don?t know man, you know... I just don?t know about this... What? See, cause i... Listen, you?re...are you losing your nerve? No man, it ain?t got nothin? to do with nerve... You?re supposed to be the devil! It?s got to do... You?re supposed to be bad! It?s got to do with style, fool! I don?t know if you?ve the right style to get into hell, You know... Well, actually, to tell you...tell you the honest to god Truth, I?m very short on style as a matter of fact... Yeah, I know...that?s...that?s what makes me wonder But I have...i, I think I have something that You may be interested in... What is that? You can have my soul It?s a mean little sucker ?bout a thousand years old But once you gets it You can?t give it back You gotta keep it forever An? that?s a natural fact! Ooh wee! Do you read me devil? Oh yeah! What? am I supposed to be scared, man? Oh yeah, reety, aw-righty! Oh yeah, that?s real tough! I bet you?re real bad! Listen fool, you?ve got to prove to me that you?re rough Enough to get into hell That you?ve got the style enough to get into hell So start talkin?... Alright, lemme tell ya somethin? Alright! I?ll prove to you that I?m bad enough to go to hell Yeah! Because I have been through it! Yeah! I have seen it! Yeah! It has happened to me! Yeah! Remember, I was signed with warner brothers For eight fuckin? years!!! Tell me about it! Now you?re talkin? about something! Now how bad is that? That sounds good to me, motherfucker! So move right along Tell me what your interests are, you know... If we?re gonna come to some kind of agreement, I?ve got to know what you?re all about, you know... ?cause I don?t know if you?re the right type for the... For the place, you know Look...lemme tell you what my problem really is, you see Ok... My problem is that I don?t belong anywhere Aha... You see... I don?t even belong where you are, you see I hope not! I, I?m a simple person, you know I have very small desires in life Titties ?n beer, you know No! what? Titties ?n beer! No! no man, you?re joking... Titties ?n beer, titties ?n beer, titties ?n beer... What? no! no please... no! not that! oh no man, no! Titties ?n beer, titties ?n beer, titties ?n beer... No! no! no! no! no! not titties ?n beer! Oh I can?t stand titties ?n beer!... Titties ?n beer, titties ?n beer, titties ?n beer... (I?m in you! I?m in you!) Oh no! no! no! wait... Ah! look at this! what am I gonna do with this thing? ...wait, wait, please no! Hey! look at this!
No! don?t sign it! give me time to think! ...hold on a second, boy, ?cause...that?s Magic ink!
Then the devil barfed ?n out jumped my girl They heard the titties plop-ploppin? All around the world, she said:
I got three beers ?n a fist fulla downs, An? I?m gonna get ripped, so fuck You clowns!
Then she gave us the finger! (it was rigid ?n stiff) That?s when the devil, she farted An? she went right over the cliff! The devil was mad! (I took off to my pad) I swear I do declare! How did she get back there? I swear I do declare! How did she get back there? I swear I do declare! How did she get back there? I swear I do declare! How did she get back there?
Alright!
|
whichits
Stranger
Registered: 01/14/06
Posts: 22
Last seen: 16 years, 3 months
|
|
tits and nipples the #1 super sized
|
WhiteBunny
How deep doesthe rabbit hole go?


Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
|
|
Quote:
Basidiocarp said:
Quote:
WhiteBunny said: NEVER to much
All a matter of taste. I go by the hand full rule muhself: More than a handfull is a waste.
erroneous!!! If they can keep their composer, the more the merrier. I have had much more than a hand full before and the were amazing. Long live the D!
WB
--------------------
|
Corporal Kielbasa

Registered: 05/29/04
Posts: 17,235
|
|
Quote:
HippieChick said:
Quote:
noeticbuzz said: All about the small tight ass, I love tiny girls
You'd love me

LOL
Peace,Love,Happiness and Harmony Hippie Chick
ha ha i got the same one! minus the hippychick I think the people that sold it to me ripped me off
|
Shroomism
Space Travellin


Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension
|
|
yeah.. I'd go demand a refund or a replacement if I were you
--------------------
|
Corporal Kielbasa

Registered: 05/29/04
Posts: 17,235
|
Re: ass or tits? [Re: Shroomism]
#5322071 - 02/20/06 10:08 PM (17 years, 11 months ago) |
|
|
i mean for the price it should come with a helper.........ya know!?!
|
TM
The Mind, The Many, The Music.



Registered: 06/11/02
Posts: 8,282
Loc: Under The Table And Dream...
|
|
Face, eyes, sharply angled cheekbones... If all of that is appealing, the rest will be too.
Of ass and tits, I'm more impressed by a nicely shaped ass than boobs of any size.
-------------------- ================================================
"Have some congratulatory drugs." - C. Montgomery Burns I'll probably always do drugs, so that just contributes to the addiction to The Shroomery... It's a vicious circle of bliss. TM™
|
VoidOfsPg
Stranger

Registered: 05/09/05
Posts: 4,899
Loc: San Antonio, TX
|
Re: ass or tits? [Re: TM]
#5322113 - 02/20/06 10:16 PM (17 years, 11 months ago) |
|
|
I'm all about ass over here.
I like boobs of all sizes, preferably a B or C cup.
|
HippieChick
Chicks can do it too!


Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
|
Re: ass or tits? [Re: whichits]
#5322114 - 02/20/06 10:16 PM (17 years, 11 months ago) |
|
|
Quote:
whichits said: tits and nipples the #1 super sized
You'd REALLY love me LMAO
Just got em pierced too 
Peace,Love,Happiness and Harmony Hippie Chick
-------------------- Peace,Love and Happiness HC Freedoms just another word for nothing left to lose.............. I LUV My Greenhouse http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848 My First Pans http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058
|
HippieChick
Chicks can do it too!


Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
|
Re: ass or tits? [Re: VoidOfsPg]
#5322123 - 02/20/06 10:18 PM (17 years, 11 months ago) |
|
|
Quote:
VoidOfsPg said:
I like boobs of all sizes, preferably a B or C cup.
You might not , lol .
Peace,Love,Happiness and Harmony Hippie Chick
-------------------- Peace,Love and Happiness HC Freedoms just another word for nothing left to lose.............. I LUV My Greenhouse http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848 My First Pans http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058
|
Silversoul
Rhizome


Registered: 01/01/05
Posts: 23,576
Loc: The Barricades
|
|
Quote:
HippieChick said: Just got em pierced too 
Pics plz
--------------------
|
HippieChick
Chicks can do it too!


Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
|
|
I've got em , lol . Just can't edit them right now , lost my software in a PC mishap 
Peace,Love,Happiness and Harmony Hippie Chick
-------------------- Peace,Love and Happiness HC Freedoms just another word for nothing left to lose.............. I LUV My Greenhouse http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848 My First Pans http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058
|
Shroomism
Space Travellin


Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension
|
|
I'll edit them for you
--------------------
|
HippieChick
Chicks can do it too!


Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
|
Re: ass or tits? [Re: Shroomism]
#5322409 - 02/20/06 11:06 PM (17 years, 11 months ago) |
|
|
LMAO 
Here . This one doesn't need any

Peace,Love,Happiness and Harmony Hippie Chick
-------------------- Peace,Love and Happiness HC Freedoms just another word for nothing left to lose.............. I LUV My Greenhouse http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848 My First Pans http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058
|
Penguarky Tunguin
f n o r d

Registered: 08/08/04
Posts: 17,192
|
|
Quote:
WhiteBunny said:
Quote:
Shroomism said:
   
that first picture is amazing please tell me where i can find this girl in action.
WB
Sydney Moon.
Youre welcome. Use kleenex.
-------------------- Every mistake, intentional or otherwise, in the above post, is the fault of the reader.
|
DocPsilocybin
enthusiast

Registered: 04/22/02
Posts: 588
Last seen: 13 years, 1 month
|
|
Damn! Sexy pic Hippy Chick
I'm all about the ass myself.
-------------------- You can't hold a man down without staying down with him. -- Booker T. Washington
|
oDin
Registered: 08/12/99
Posts: 5,789
Last seen: 10 years, 7 months
|
|
whatever one(s) im thinking about at the time
|
JonnyOnTheSpot
Sober Surfer


Registered: 01/27/02
Posts: 11,527
Loc: North Carolina
|
|
the booty region is where i stick my penor, so that's where i focus my attention.
|
Corporal Kielbasa

Registered: 05/29/04
Posts: 17,235
|
|
good logic!
|
SkorpivoMusterion
Livin in theTwilight Zone...


Registered: 01/30/03
Posts: 9,954
Loc: You can't spell fungus wi...
|
|
-------------------- Coffee should be black as hell, strong as death, and sweet as love.
|
Penguarky Tunguin
f n o r d

Registered: 08/08/04
Posts: 17,192
|
|
Thats not Sydney Moon.
-------------------- Every mistake, intentional or otherwise, in the above post, is the fault of the reader.
|
SkorpivoMusterion
Livin in theTwilight Zone...


Registered: 01/30/03
Posts: 9,954
Loc: You can't spell fungus wi...
|
|
Damn straight, my man. That's the almighty Keyra Agustina. Respekt, the ass.
-------------------- Coffee should be black as hell, strong as death, and sweet as love.
|
CaRnAgECaNdY
Tool's groupie


Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet
Last seen: 6 months, 23 days
|
|
Quote:
elgr said: Yeah, no need to use protection if you sterilize them first.
--------------------
The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.
|
FungusMan
I81U812



Registered: 08/06/05
Posts: 3,112
Loc: Everywhere
|
|
Im more of a nipple man. I dont care how big the bewbeez are, as long as the nipple is proportioned right. Im more of an ass guy I guess.
|
Phluck
Carpal Tunnel


Registered: 04/10/99
Posts: 11,394
Loc: Canada
Last seen: 3 months, 6 days
|
Re: ass or tits? [Re: TM]
#5322868 - 02/21/06 02:52 AM (17 years, 11 months ago) |
|
|
Quote:
TripMeister said: Face, eyes, sharply angled cheekbones... If all of that is appealing, the rest will be too.
Of ass and tits, I'm more impressed by a nicely shaped ass than boobs of any size.
I'm with you 100%. The face is easily the most important feature, by far.
-------------------- "I have no valid complaint against hustlers. No rational bitch. But the act of selling is repulsive to me. I harbor a secret urge to whack a salesman in the face, crack his teeth and put red bumps around his eyes." -Hunter S Thompson http://phluck.is-after.us
|
FungusMan
I81U812



Registered: 08/06/05
Posts: 3,112
Loc: Everywhere
|
Re: ass or tits? [Re: Phluck]
#5322874 - 02/21/06 02:57 AM (17 years, 11 months ago) |
|
|
Whats it really matter though. They all feel like pussy in the dark
|
Basidiocarp
Dr. BunsenHoneydew


Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
|
Re: ass or tits? [Re: FungusMan]
#5322888 - 02/21/06 03:09 AM (17 years, 11 months ago) |
|
|
Quote:
FungusMan said: Whats it really matter though. They all feel like pussy in the dark
Well sewer rat might taste like pumpkin pie, to quote a famous Tarantino chracter, but that doesn't mean we run around eatin' just any old pumpkin pie, even if it might be in the dark!
-------------------- "...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."
Visit the Psychonautical Society
|
FungusMan
I81U812



Registered: 08/06/05
Posts: 3,112
Loc: Everywhere
|
|
Quote:
Basidiocarp said:
Quote:
FungusMan said: Whats it really matter though. They all feel like pussy in the dark
Well sewer rat might taste like pumpkin pie, to quote a famous Tarantino chracter, but that doesn't mean we run around eatin' just any old pumpkin pie, even if it might be in the dark!
Hey, Im one of those guys that, when as a kid, was eating a hotdog and was told what it was made out of. I just kept eating them.
|
Basidiocarp
Dr. BunsenHoneydew


Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
|
Re: ass or tits? [Re: FungusMan]
#5322902 - 02/21/06 03:28 AM (17 years, 11 months ago) |
|
|
Quote:
FungusMan said: Hey, Im one of those guys that, when as a kid, was eating a hotdog and was told what it was made out of. I just kept eating them.
That's all fine and dandy when we are at Fenway (Yank stadium if I had my way) or pimpin' a dawg off of the guys in the Home Depot parking lot... But my God man, when it comes to the Holiest of Holies, would you draw such a similar, sweeping conclusion?
-------------------- "...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."
Visit the Psychonautical Society
|
FungusMan
I81U812



Registered: 08/06/05
Posts: 3,112
Loc: Everywhere
|
|
Hell yeh I would. A bad piece of ass, is better than a good day at work in my book,lol. As long as she dont have STD's or anything.
|
Basidiocarp
Dr. BunsenHoneydew


Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
|
Re: ass or tits? [Re: FungusMan]
#5322921 - 02/21/06 03:53 AM (17 years, 11 months ago) |
|
|
LOL, guys, aren't we so vulgah?! Hehe, personallly I'll take muh own hand (ya know, Mary Palm & her Five Sisters) over some skank azz that doesn't do it for my eyes. I need good and proper visual entertainment as well.
-------------------- "...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."
Visit the Psychonautical Society
|
FungusMan
I81U812



Registered: 08/06/05
Posts: 3,112
Loc: Everywhere
|
|
Ill just close me eyes, and pork the fatty! LMAO
|
Basidiocarp
Dr. BunsenHoneydew


Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
|
Re: ass or tits? [Re: FungusMan]
#5322929 - 02/21/06 03:58 AM (17 years, 11 months ago) |
|
|
Quote:
FungusMan said: Ill just close me eyes, and pork the fatty! LMAO
LOL You sik bastid, more power to ya if you can pull it off muh man. I am cursed by the requisite need of something hot to look at as I work...
-------------------- "...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."
Visit the Psychonautical Society
|
InsaneMetalMan

Registered: 10/12/05
Posts: 66
Last seen: 12 years, 8 months
|
|
I like tits, because they're soft and work as good love pillows.
-------------------- Bring on the answers, take away the pain. I fight off the demons, that make me go insane. Looking through the hourglass, I count down the day, to look towards the next, to embrace it all the way.
|
nakors_junk_bag
Lobster Bisque


Registered: 11/23/04
Posts: 2,415
Loc: ethereality
Last seen: 15 years, 9 months
|
|
fat pussy lips!
an outy, like a roast beef sammich from Arby's
ass and tits!
sex aint nothing but lips and clits.
-------------------- Asshole
|
kilroy69
POKER GOD


Registered: 11/19/00
Posts: 1,303
Loc: Jackson,MI. And not in pr...
Last seen: 8 years, 4 months
|
|
There is nothing better than a hottie with a tight ass IMHO.Tits just don't do it for me. I would take a girl with small tits and a nice ass any day of the week.
-------------------- Yeaaa im still alive.
|
adamj
Superhero


Registered: 11/11/03
Posts: 1,562
Loc: Ontario, CAN
Last seen: 3 years, 1 month
|
|
Titties. Especially when you're rubbing your face in them.
|
kilroy69
POKER GOD


Registered: 11/19/00
Posts: 1,303
Loc: Jackson,MI. And not in pr...
Last seen: 8 years, 4 months
|
Re: ass or tits? [Re: adamj]
#5323566 - 02/21/06 10:41 AM (17 years, 11 months ago) |
|
|
and besides, girls with big tits seem to end up fat in the long run.
-------------------- Yeaaa im still alive.
|
VoidOfsPg
Stranger

Registered: 05/09/05
Posts: 4,899
Loc: San Antonio, TX
|
Re: ass or tits? [Re: kilroy69]
#5323632 - 02/21/06 10:57 AM (17 years, 11 months ago) |
|
|
Quote:
kilroy69 said: There is nothing better than a hottie with a tight ass IMHO.Tits just don't do it for me. I would take a girl with small tits and a nice ass any day of the week.
|
AngeloWish
Sr. Mydriasis

Registered: 07/13/05
Posts: 595
Loc: MEXICO-Mushroom Capital
Last seen: 4 years, 3 months
|
Re: ass or tits? [Re: VoidOfsPg]
#5323850 - 02/21/06 12:18 PM (17 years, 11 months ago) |
|
|
I will always preffer a nice, smooth and considerably big ass than a big pair of tits (aslong as she has tits... maybe 'cause i've had enough of big titted women already).
Big butts -not fat- make me feel respect for a woman.
-------------------- +'this' reality is the one i like the most+
|
Silversoul
Rhizome


Registered: 01/01/05
Posts: 23,576
Loc: The Barricades
|
|
Quote:
JonnyOnTheSpot said: the booty region is where i stick my penor, so that's where i focus my attention.
My penor is down there, but my eyes are up there watching the titties bounce.
--------------------
|
mediman0078
Stilllooking.....

Registered: 11/14/05
Posts: 1,379
Loc: Here, there, EVERYWHERE
Last seen: 17 years, 10 months
|
|
Arseses... I like a nice booty. Tits are fun, but there's just nothing like a nice ass to hang onto when hitting it doggy style.
-------------------- ........someday I'll find it.
|
Penguarky Tunguin
f n o r d

Registered: 08/08/04
Posts: 17,192
|
|
Quote:
Basidiocarp said: LOL, guys, aren't we so vulgah?! Hehe, personallly I'll take muh own hand (ya know, Mary Palm & her Five Sisters) over some skank azz that doesn't do it for my eyes. I need good and proper visual entertainment as well.
Exactly, I know for certain my hand doesn't have any STDs. Thank you.
-------------------- Every mistake, intentional or otherwise, in the above post, is the fault of the reader.
|
KingOftheThing
the cool fool


Registered: 11/17/02
Posts: 27,397
Loc: USA
|
|
ass i guess, just because i dont like fat chicks. i really do love boobs though
|
AliceDee
-L S D-

Registered: 08/10/03
Posts: 3,957
|
|
ASS!!! if shes got a nice ass i dont even care about the size of her tits... girls with nice tits dont always have nice bodies, but girls with nice ass's are ALWAYS good all around.... two words.. VIDA GUERRA
|
Ekstaza
stranger than most


Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 9 months, 23 days
|
Re: ass or tits? [Re: AliceDee]
#5325595 - 02/21/06 07:39 PM (17 years, 11 months ago) |
|
|
I'm definately not a fan of big tits. I like 'em small. Big tits are gonna end up around the womans waste in the end after all is said and done. Give me a chick with a nice ass and small tits and I'm a happy man.
Above all, though, I love beautiful eyes. I once freaked a stripper out because I stared at her eyes while she was trying to get me to buy a lap dance. She asked me what I was looking at and I told her that she had the most beautiful eyes. Then I said that I didn't want a lap dance.
-------------------- YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.
|
Penguarky Tunguin
f n o r d

Registered: 08/08/04
Posts: 17,192
|
Re: ass or tits? [Re: AliceDee]
#5325623 - 02/21/06 07:43 PM (17 years, 11 months ago) |
|
|
Quote:
AliceDee said: ASS!!! if shes got a nice ass i dont even care about the size of her tits... girls with nice tits dont always have nice bodies, but girls with nice ass's are ALWAYS good all around.... two words.. VIDA GUERRA
Two words...breast implants.
-------------------- Every mistake, intentional or otherwise, in the above post, is the fault of the reader.
|
Ekstaza
stranger than most


Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 9 months, 23 days
|
|
Quote:
McKennaDMT said: Two words...breast implants.
No way girls, leave 'em be.
However, if breasts are gonna be big, I prefer them fake.
-------------------- YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.
|
Penguarky Tunguin
f n o r d

Registered: 08/08/04
Posts: 17,192
|
Re: ass or tits? [Re: Ekstaza]
#5325654 - 02/21/06 07:50 PM (17 years, 11 months ago) |
|
|
I meant that to AliceDee, Vida has breast implants, so his theory isn't correct.
-------------------- Every mistake, intentional or otherwise, in the above post, is the fault of the reader.
|
GrapeSoda
Green Raindrop

Registered: 08/17/05
Posts: 37
Loc: France
Last seen: 17 years, 9 months
|
|
Ass. A girl with a toned body, and a solid ass is hot on so many levels... whereas a girl with big tits.. is usually just a girl with big tits. The facial structure of course is the most noticable part of a woman.. but when it comes to the body.. ass wins over tits.
|
nakors_junk_bag
Lobster Bisque


Registered: 11/23/04
Posts: 2,415
Loc: ethereality
Last seen: 15 years, 9 months
|
Re: ass or tits? [Re: Ekstaza]
#5327308 - 02/22/06 07:39 AM (17 years, 11 months ago) |
|
|
Quote:
Ekstaza said: I'm definately not a fan of big tits. I like 'em small. Big tits are gonna end up around the womans waste in the end after all is said and done. Give me a chick with a nice ass and small tits and I'm a happy man.
Above all, though, I love beautiful eyes. I once freaked a stripper out because I stared at her eyes while she was trying to get me to buy a lap dance. She asked me what I was looking at and I told her that she had the most beautiful eyes. Then I said that I didn't want a lap dance.
Yeha nice round full small to slightly smaller than medium tits are nice, but most important is the ass, the way it bounces up and down when I stare at it while she fucks my brains out reverse cowgirl style. then the nice plump pussy lips are chilling.
Gotta go with the ass, but not a fat ass, a full round perfect ass.
-------------------- Asshole
Edited by nakors_junk_bag (02/22/06 01:57 PM)
|
Todcasil
rogue DMT elf


Registered: 08/08/99
Posts: 16,381
Loc: Crawling on the floor...
Last seen: 9 years, 4 months
|
|
neither. seperatly they are nothing.
-------------------- Men look at themselves and they see flawed humans, we look at women and we see perfect GODDESSES Women look at themselves and they seem utterly human, when looking at men they see proud GODS. ~Casil
|
Jack_Flash
604


Registered: 03/17/05
Posts: 619
Loc: richmond, BC
Last seen: 9 years, 5 months
|
Re: ass or tits? [Re: Todcasil]
#5327518 - 02/22/06 10:14 AM (17 years, 11 months ago) |
|
|
i like a tight poosy its all about the whole thing
|
SneezingPenis
ACHOOOOOOOOO!!!!!111!

Registered: 01/15/05
Posts: 15,427
Last seen: 6 years, 8 months
|
|
ass, by far.
|
it stars saddam
Satan

Registered: 05/19/05
Posts: 15,571
Loc: Spahn Ranch
|
|
I'M A BACKDOOR MAN!
|
eligal
Noobie


Registered: 05/25/05
Posts: 7,021
Loc: California
|
|
Quote:
psilocyberin said:
ass, by far.
-------------------- \m/ Spanksta \m/ "do you have the freedom to do with your nervous system what you want?" "MolokoMilkPlus said: I'll respect you if you let me give you a blow job" "tactik said: respect the can."
|
mediman0078
Stilllooking.....

Registered: 11/14/05
Posts: 1,379
Loc: Here, there, EVERYWHERE
Last seen: 17 years, 10 months
|
Re: ass or tits? [Re: eligal]
#5327677 - 02/22/06 11:26 AM (17 years, 11 months ago) |
|
|
Now that's some nice cheeks.
-------------------- ........someday I'll find it.
|
duggan18
Stranger
Registered: 08/02/05
Posts: 166
Last seen: 16 years, 4 months
|
Re: ass or tits? [Re: Ekstaza]
#5327712 - 02/22/06 11:43 AM (17 years, 11 months ago) |
|
|
ass.
|
Roadkill
Retired Shroomery Mod


Registered: 12/11/01
Posts: 22,674
Loc: Montana
|
|
Hooters!~
-------------------- Laterz, Road Who the hell you callin crazy? You wouldn't know what crazy was if Charles Manson was eating froot loops on your front porch! Brainiac said: PM the names with on there names, that means they have mushrooms for sale.
|
Jack_Flash
604


Registered: 03/17/05
Posts: 619
Loc: richmond, BC
Last seen: 9 years, 5 months
|
Re: ass or tits? [Re: Roadkill]
#5327902 - 02/22/06 12:36 PM (17 years, 11 months ago) |
|
|
i gaurantee you that chick doesnt smoke, but i do find it attractive, thinking its a blunt
|
absolute zero
The Hero

Registered: 11/04/01
Posts: 796
Loc: 127.0.0.1
Last seen: 11 years, 8 months
|
|
Quote:
Guitarpro1313 said: tit guy or ass guy?
I have two hands... why choose?
--------------------
|
nakors_junk_bag
Lobster Bisque


Registered: 11/23/04
Posts: 2,415
Loc: ethereality
Last seen: 15 years, 9 months
|
|
Quote:
Zero__Glass said:
Quote:
Guitarpro1313 said: tit guy or ass guy?
I have two hands... why choose?
cause u can only put your face in one of them at a time,,,,,
-------------------- Asshole
|
downforpot
Stranger

Registered: 06/25/01
Posts: 5,715
|
|
ass
--------------------
http://www.myspace.com/4th25 "And I don't care if he was handcuffed Then shot in his head All I know is dead bodies Can't fuck with me again"
|
irascible_raunch
Stranger


Registered: 10/18/05
Posts: 1,111
|
|
Seriously. Both.
|
Kamek


Registered: 01/08/05
Posts: 2,923
Last seen: 8 months, 6 days
|
|
ASS
|
shirley knott
not my real name

Registered: 11/11/02
Posts: 9,105
Loc: London
Last seen: 7 years, 28 days
|
|
tits
-------------------- buh
|
notapillow
I want to be a fisherman


Registered: 09/29/03
Posts: 31,129
Loc: A rare and different tune
Last seen: 3 years, 11 months
|
|
i gotta go with the tats
--------------------
|
vinsue
Grand Old Fart


Registered: 02/17/04
Posts: 17,953
Loc: The Garden State(NJ)
|
|
I didn't read the whole thread, but I'm kinda partial to pussy. T & A is OK to me, but the pussy is where I like to be...
--------------------
"All mushrooms are edible; but some only once." Croatian proverb. BTW ... Have You Rated Ythans Mom Yet ?? ... ... HERE'S HOW ... (be nice) . ...
|
Himejime
Learning the way

Registered: 12/25/05
Posts: 158
Loc: Northern Cali
Last seen: 16 years, 2 months
|
Re: ass or tits? [Re: vinsue]
#5328475 - 02/22/06 04:00 PM (17 years, 11 months ago) |
|
|
id rather have a girl with small titties and a perfect ass then some big tities and a flat ass ewwww
|
Acidic_Sloth
Acidic poly-Sided Di-slothamide


Registered: 05/29/02
Posts: 43,732
Loc: ainrofilac
|
Re: ass or tits? [Re: Himejime]
#5857246 - 07/14/06 07:54 AM (17 years, 6 months ago) |
|
|
what if they have big tits and a nice ass?
i personally like tits. but i like ass too. i guess it really depends.
-------------------- -- Accept my heart warming gift of TREE SCRATCHIES!!! I absolve thee!! --
JaP: 30,000 lines of gay, cock, and fag can't be wrong Ped: only in #shroomery is "smuggle opium in her ass" followed by "i don't want shitty opium" which is followed by " *** Joins: PENISSQUAD" -- JaP: What would this place be without random sluts? JaP: Nothing, I tell you.
|
goobler
Reanimated



Registered: 02/24/03
Posts: 48,909
|
|
show me both, then I'll decide
|
Scarfmeister
Thrill Seeker
Registered: 10/31/02
Posts: 8,127
Loc: The will to power
Last seen: 4 years, 6 months
|
|
TITS!
-------------------- -------------------- We're the lowest of the low, the scum of the fucking earth!
|
Acidic_Sloth
Acidic poly-Sided Di-slothamide


Registered: 05/29/02
Posts: 43,732
Loc: ainrofilac
|
Re: ass or tits? [Re: goobler]
#5857276 - 07/14/06 08:09 AM (17 years, 6 months ago) |
|
|
-------------------- -- Accept my heart warming gift of TREE SCRATCHIES!!! I absolve thee!! --
JaP: 30,000 lines of gay, cock, and fag can't be wrong Ped: only in #shroomery is "smuggle opium in her ass" followed by "i don't want shitty opium" which is followed by " *** Joins: PENISSQUAD" -- JaP: What would this place be without random sluts? JaP: Nothing, I tell you.
|
drtyfrnk
PresidentialCandidate 2008



Registered: 01/24/05
Posts: 2,961
Loc: Ontario, Canada
Last seen: 14 years, 3 months
|
|
-------------------- It's Krang, Bitch!
|
mycoprog
Modular Heretic


Registered: 01/12/06
Posts: 797
Loc: N. America
|
|
definately love a great ass....titties are dope, but its not that often you get that perfect onion booty.
word.
--------------------
|
unbeliever
Yo Daddy!

Registered: 05/22/04
Posts: 5,158
Loc: Gallifrey
Last seen: 14 years, 10 months
|
|
Big or small, proportion and shape are key.. and that applies to T & A both. It's impossible to say that one likes all tits over all asses or whatever. Like the best feature of whichever person you're looking at. Duh. :P
-------------------- Happiness is a warm gun...
|
flibius
Stranger
Registered: 07/11/06
Posts: 101
Last seen: 11 years, 10 months
|
|
tits, natural perky tits!
|
gema
Freedom from the Known

Registered: 10/24/04
Posts: 1,767
Loc: t(here)
|
Re: ass or tits? [Re: AliceDee]
#5857389 - 07/14/06 08:54 AM (17 years, 6 months ago) |
|
|
Quote:
AliceDee said: two words.. VIDA GUERRA
|
Azen
Legalize ALL!


Registered: 10/04/05
Posts: 309
Loc: Seattle, Wa
Last seen: 10 years, 4 months
|
|
Definitely ass. Tits can be fixed with the right doctor . The second thing I look at on a lady is her ass after her face of course.
Azen
|
grphish
the Modern dayPacman

Registered: 04/01/02
Posts: 1,687
Last seen: 9 years, 2 months
|
Re: ass or tits? [Re: gema]
#5857423 - 07/14/06 09:10 AM (17 years, 6 months ago) |
|
|
not enough pictures of finely shaped asses and tits and we need amature stuff we've seen enough of the pro-model pornstars they're getting old
-------------------- BoUnCy BaLL IS All SoUrCe OF LIGhT AnD HaPPiNeSS!!~! *bEEP* *beEP*
|
Legend
RIP Sasha



Registered: 03/29/10
Posts: 28,336
Loc: TX
|
|
ass
--------------------
No sympathy for the devil, keep that in mind. [url=]Buy the ticket, take the ride. [/url]Are you lost?
|
twighead
mͯó



Registered: 08/27/08
Posts: 29,556
Loc: Glenn Gould's Fuck Windmill
Last seen: 4 hours, 37 minutes
|
Re: ass or tits? [Re: Legend] 1
#13075343 - 08/19/10 06:32 PM (13 years, 5 months ago) |
|
|
Anus, specifically
|
Frost
Inside a locked room


Registered: 02/24/07
Posts: 5,947
Loc: Florida
Last seen: 8 years, 7 months
|
Re: ass or tits? [Re: twighead]
#13075675 - 08/19/10 07:53 PM (13 years, 5 months ago) |
|
|
Booty, no question
-------------------- “I have lived on the lip of insanity, wanting to know reasons, knocking on a door. It opens. I've been knocking from the inside.” - Rumi “The nitrogen in our DNA, the calcium in our teeth, the iron in our blood, the carbon in our apple pies were made in the interiors of collapsing stars. We are made of starstuff.” - Carl Sagan
|
ninja cat 09
A paranoid android



Registered: 10/11/09
Posts: 4,170
Loc: Mexico
|
Re: ass or tits? [Re: Frost]
#13075727 - 08/19/10 08:07 PM (13 years, 5 months ago) |
|
|
--------------------
|
Acidic_Sloth
Acidic poly-Sided Di-slothamide


Registered: 05/29/02
Posts: 43,732
Loc: ainrofilac
|
Re: ass or tits? [Re: Frost]
#13075742 - 08/19/10 08:09 PM (13 years, 5 months ago) |
|
|
Quote:
Frost said: Booty, no question
both.
the bitch in the striped bikini definitely has both, too.
-------------------- -- Accept my heart warming gift of TREE SCRATCHIES!!! I absolve thee!! --
JaP: 30,000 lines of gay, cock, and fag can't be wrong Ped: only in #shroomery is "smuggle opium in her ass" followed by "i don't want shitty opium" which is followed by " *** Joins: PENISSQUAD" -- JaP: What would this place be without random sluts? JaP: Nothing, I tell you.
|
x Ju x
Aubergine Of The Sun



Registered: 10/07/08
Posts: 6,511
Loc: Shpongleland, Canada
Last seen: 2 years, 11 months
|
|
I'm an ass man
--------------------
|
Acidic_Sloth
Acidic poly-Sided Di-slothamide


Registered: 05/29/02
Posts: 43,732
Loc: ainrofilac
|
Re: ass or tits? [Re: x Ju x]
#13075755 - 08/19/10 08:10 PM (13 years, 5 months ago) |
|
|
okok, i'll concede ... ass over tits. but i love both.
-------------------- -- Accept my heart warming gift of TREE SCRATCHIES!!! I absolve thee!! --
JaP: 30,000 lines of gay, cock, and fag can't be wrong Ped: only in #shroomery is "smuggle opium in her ass" followed by "i don't want shitty opium" which is followed by " *** Joins: PENISSQUAD" -- JaP: What would this place be without random sluts? JaP: Nothing, I tell you.
|
usefulidiot13
Dark Passenger



Registered: 05/22/07
Posts: 11,583
Loc: Death From Above
Last seen: 11 years, 7 months
|
|
asss for sure.
-------------------- What Would Dexter Do?
|
Legend
RIP Sasha



Registered: 03/29/10
Posts: 28,336
Loc: TX
|
|
fuck tits unless your hugging or sleeping. as long as i gotta good ass im good.
--------------------
No sympathy for the devil, keep that in mind. [url=]Buy the ticket, take the ride. [/url]Are you lost?
|
Frost
Inside a locked room


Registered: 02/24/07
Posts: 5,947
Loc: Florida
Last seen: 8 years, 7 months
|
|
Quote:
Acidic_Sloth said:
Quote:
Frost said: Booty, no question
both.
the bitch in the striped bikini definitely has both, too.
Why she gotta be a bitch?
-------------------- “I have lived on the lip of insanity, wanting to know reasons, knocking on a door. It opens. I've been knocking from the inside.” - Rumi “The nitrogen in our DNA, the calcium in our teeth, the iron in our blood, the carbon in our apple pies were made in the interiors of collapsing stars. We are made of starstuff.” - Carl Sagan
|
Legend
RIP Sasha



Registered: 03/29/10
Posts: 28,336
Loc: TX
|
Re: ass or tits? [Re: Frost]
#13076214 - 08/19/10 10:10 PM (13 years, 5 months ago) |
|
|
they all bitch's
--------------------
No sympathy for the devil, keep that in mind. [url=]Buy the ticket, take the ride. [/url]Are you lost?
|
All We Perceive
Sea Cucumber



Registered: 09/24/07
Posts: 10,491
Last seen: 7 months, 4 days
|
|
Ass. Gives you something to grab onto when doing doggie style. Plus, when you slap it, it jiggles in an enticing sexy manner. Win win.
--------------------
"plus they atually think jambands are good or sumthing, so they clearly know absolutely nothing about music, clearly lol" -Bassfreak
|
tha_doctor
student of the Plant Teachers



Registered: 10/24/09
Posts: 1,346
Loc: Melbourne
Last seen: 13 years, 14 days
|
|
True that
Arses
|
The Boat
Stoner with a boner


Registered: 02/20/10
Posts: 1,173
Last seen: 10 years, 11 months
|
|
Tits just for fun and messing around. Ass is for business time.
--------------------
01:21:35 ‹Enlil› I know how to handle the cock
|
kirilan
dued


Registered: 03/08/10
Posts: 3,791
Loc:
Last seen: 4 years, 15 days
|
Re: ass or tits? [Re: Frost]
#13076567 - 08/19/10 11:32 PM (13 years, 5 months ago) |
|
|
Quote:
Frost said: Booty, no question

Tits. But she has one nice ass.
-------------------- "The beauty of a living thing is not the atoms that go into it, but the way those atoms are put together" Carl Sagan
|
tiny_rabid_birds
Nocturnal



Registered: 11/08/05
Posts: 15,653
Loc: estados unidos
|
Re: ass or tits? [Re: kirilan]
#13076573 - 08/19/10 11:34 PM (13 years, 5 months ago) |
|
|
ass. no question about it. a nice ass has mind-numbing capabilities on me. it induces a state on non-functionality on my brain zone.
--------------------
|
everyman
The Rza-rector



Registered: 07/01/10
Posts: 386
|
|
Ass
--------------------
|
teaparty
Don'tHaveaCowMan



Registered: 12/03/07
Posts: 671
Loc: The Steele City
Last seen: 11 years, 1 month
|
|
mmmm...ass
-------------------- I'm so ahead of my time, my parents haven't met yet.
|
Legend
RIP Sasha



Registered: 03/29/10
Posts: 28,336
Loc: TX
|
Re: ass or tits? [Re: teaparty]
#13076773 - 08/20/10 12:47 AM (13 years, 5 months ago) |
|
|
what about pussy? ass tits or pussy
--------------------
No sympathy for the devil, keep that in mind. [url=]Buy the ticket, take the ride. [/url]Are you lost?
|
ninja cat 09
A paranoid android



Registered: 10/11/09
Posts: 4,170
Loc: Mexico
|
Re: ass or tits? [Re: Legend]
#13079574 - 08/20/10 04:46 PM (13 years, 5 months ago) |
|
|
Pussy if tight.
--------------------
|
The24HourMC
Master Of Ceremonies



Registered: 10/16/09
Posts: 7,704
Loc: Gone
Last seen: 8 years, 11 months
|
|
it totally depends on the woman. She might have something to match with the highlighted part of her body but the rest dont fit together correctly and it just looks odd. If I absolutely had to choose though it would be ass without question.
--------------------
My Baby In MCLA Fuckin Shit Fuck that stay high
|
Niffla


Registered: 06/09/08
Posts: 46,484
Loc: Texas
|
|
Both.
--------------------
HAIL OUR NEW OTD KING
|
Learyfan
It's the psychedelic movement!



Registered: 04/20/01
Posts: 34,086
Loc: High pride!
Last seen: 2 hours, 5 minutes
|
|
Ass man. I like a small ass.
-------------------- -------------------------------- Mp3 of the month: The Apple-Glass Cyndrome - Someday
|
BiG_StroOnZ



Registered: 04/19/06
Posts: 3,323
|
Re: ass or tits? [Re: Learyfan]
#13079674 - 08/20/10 05:12 PM (13 years, 5 months ago) |
|
|
ass
|
|