Home | Community | Message Board

MagicBag Grow Bags
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: PhytoExtractum Maeng Da Thai Kratom Leaf Powder   Kraken Kratom Red Vein Kratom

Jump to first unread post Pages: 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8  [ show all ]
OfflineGuitarpro1313
Stranger
Male
Registered: 02/14/06
Posts: 106
Loc: Minnesota, USA
Last seen: 14 years, 8 months
ass or tits?
    #5321606 - 02/20/06 08:28 PM (17 years, 11 months ago)

tit guy or ass guy?


--------------------
PEACE

HOW

PEACE

NOwWwWwWwWwWwWwWwWwW


Extras: Filter Print Post Top
InvisibleDNKYD
Turtle!

Registered: 09/23/04
Posts: 12,326
Re: ass or tits? [Re: Guitarpro1313]
    #5321610 - 02/20/06 08:29 PM (17 years, 11 months ago)

I prefer the tits and ass on women, thanks.


Extras: Filter Print Post Top
Offlinehorha
trout
Male User Gallery

Registered: 02/07/06
Posts: 292
Last seen: 17 years, 3 months
Re: ass or tits? [Re: Guitarpro1313]
    #5321612 - 02/20/06 08:30 PM (17 years, 11 months ago)

tits


Extras: Filter Print Post Top
OfflineGenesisOmega
Stranger
Registered: 07/07/05
Posts: 17
Loc: Mobile, Alabama
Last seen: 16 years, 11 months
Re: ass or tits? [Re: horha]
    #5321628 - 02/20/06 08:32 PM (17 years, 11 months ago)

Tits, without a doubt


Extras: Filter Print Post Top
OfflinePinballWizard
Naive and Gullible as usual

Registered: 03/20/04
Posts: 2,804
Last seen: 9 years, 9 months
Re: ass or tits? [Re: Guitarpro1313]
    #5321634 - 02/20/06 08:33 PM (17 years, 11 months ago)

Definately tits. I have my own ass.


Extras: Filter Print Post Top
InvisibleSilversoul
Rhizome
Male User Gallery

Registered: 01/01/05
Posts: 23,576
Loc: The Barricades
Re: ass or tits? [Re: PinballWizard]
    #5321637 - 02/20/06 08:34 PM (17 years, 11 months ago)

Quote:

PinballWizard said:
Definately tits. I have my own ass.




--------------------


Extras: Filter Print Post Top
Offlinepsychonaut_420
psychonaut

Registered: 02/13/06
Posts: 285
Loc: mid atlantic
Last seen: 16 years, 10 months
Re: ass or tits? [Re: PinballWizard]
    #5321643 - 02/20/06 08:34 PM (17 years, 11 months ago)

tits


--------------------


"Life sucks, Shit happens, Smoke weed and forget about it"


Extras: Filter Print Post Top
OfflineGuitarpro1313
Stranger
Male
Registered: 02/14/06
Posts: 106
Loc: Minnesota, USA
Last seen: 14 years, 8 months
Re: ass or tits? [Re: DNKYD]
    #5321649 - 02/20/06 08:35 PM (17 years, 11 months ago)

Quote:

DNKYD said:
I prefer the tits and ass on women, thanks.




smart ass


--------------------
PEACE

HOW

PEACE

NOwWwWwWwWwWwWwWwWwW


Extras: Filter Print Post Top
OfflineBobnasty
Just AppreciateNature
Male

Registered: 01/22/06
Posts: 158
Loc: Murder Mitten
Last seen: 17 years, 7 months
Re: ass or tits? [Re: psychonaut_420]
    #5321652 - 02/20/06 08:36 PM (17 years, 11 months ago)

The twin cities :thumbup: :thumbup:

And I'm not talking Minnesota


Edited by Bobnasty (02/20/06 08:38 PM)


Extras: Filter Print Post Top
OfflineHippieChick
Chicks can do it too!
Female User Gallery

Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
Re: ass or tits? [Re: Bobnasty]
    #5321667 - 02/20/06 08:39 PM (17 years, 11 months ago)

Tits . :grin:

Peace,Love,Happiness and Harmony
:heart: Hippie Chick  :mushroom2:


--------------------
Peace,Love and Happiness
:heart: HC :mushroom2:

Freedoms just another word for nothing left to lose..............

I LUV My Greenhouse
http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848

My First Pans
http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058


Extras: Filter Print Post Top
InvisibleShroomismM
Space Travellin
Male User Gallery
Folding@home Statistics
Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension Flag
Re: ass or tits? [Re: Guitarpro1313]
    #5321678 - 02/20/06 08:42 PM (17 years, 11 months ago)

Tits FTW!


--------------------


Extras: Filter Print Post Top
Invisibleeligal
Noobie

Folding@home Statistics
Registered: 05/25/05
Posts: 7,021
Loc: California
Re: ass or tits? [Re: HippieChick]
    #5321682 - 02/20/06 08:42 PM (17 years, 11 months ago)

Quote:

HippieChick said:
Tits . :grin:

Peace,Love,Happiness and Harmony
:heart: Hippie Chick  :mushroom2:




ehehe! nice.

im an ass guy, but a good pair of tits definately needs to be stared at
:oogle:


--------------------
\m/ Spanksta \m/

"do you have the freedom to do with your nervous system what you want?"

"MolokoMilkPlus said:
I'll respect you if you let me give you a blow job"

"tactik said:
respect the can."



Extras: Filter Print Post Top
Offlinedrtyfrnk
PresidentialCandidate 2008
Male

Folding@home Statistics
Registered: 01/24/05
Posts: 2,961
Loc: Ontario, Canada
Last seen: 14 years, 3 months
Re: ass or tits? [Re: eligal]
    #5321721 - 02/20/06 08:51 PM (17 years, 11 months ago)

Titties...

I'm all about it.


--------------------
It's Krang, Bitch!  :krang:


Extras: Filter Print Post Top
OfflineBlek
Stranger
Male

Registered: 08/17/05
Posts: 983
Loc: The universe
Last seen: 14 years, 2 months
Re: ass or tits? [Re: drtyfrnk]
    #5321728 - 02/20/06 08:53 PM (17 years, 11 months ago)

Belly button.


Extras: Filter Print Post Top
OfflineWhiteBunny
How deep doesthe rabbit hole go?
 User Gallery

Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
Re: ass or tits? [Re: drtyfrnk]
    #5321740 - 02/20/06 08:54 PM (17 years, 11 months ago)

perky tits

WB


--------------------


Extras: Filter Print Post Top
InvisibleNoetical
Flip Horrorshow

Registered: 11/28/04
Posts: 9,230
Re: ass or tits? [Re: Guitarpro1313]
    #5321754 - 02/20/06 08:59 PM (17 years, 11 months ago)

All about the small tight ass, I love tiny girls


Extras: Filter Print Post Top
Invisibleeligal
Noobie

Folding@home Statistics
Registered: 05/25/05
Posts: 7,021
Loc: California
Re: ass or tits? [Re: Noetical]
    #5321761 - 02/20/06 09:00 PM (17 years, 11 months ago)

what about us tiny boys?  :naughty:


--------------------
\m/ Spanksta \m/

"do you have the freedom to do with your nervous system what you want?"

"MolokoMilkPlus said:
I'll respect you if you let me give you a blow job"

"tactik said:
respect the can."



Extras: Filter Print Post Top
Offlinefour_winds
ne-se
Registered: 02/12/06
Posts: 382
Loc: steady
Last seen: 17 years, 10 months
Re: ass or tits? [Re: Guitarpro1313]
    #5321770 - 02/20/06 09:02 PM (17 years, 11 months ago)

Is the eyes or legs of a woman a choice?
Yeah, those two.


Extras: Filter Print Post Top
InvisibleShroomismM
Space Travellin
Male User Gallery
Folding@home Statistics
Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension Flag
Re: ass or tits? [Re: four_winds]
    #5321787 - 02/20/06 09:08 PM (17 years, 11 months ago)



--------------------


Extras: Filter Print Post Top
Invisibleeric_the_redS
Trans-male User Gallery

Registered: 02/28/03
Posts: 13,742
Loc: happy land
Re: ass or tits? [Re: Guitarpro1313]
    #5321793 - 02/20/06 09:10 PM (17 years, 11 months ago)

i enjoy proper proportion of the two, rather than one over the other.


--------------------
Anno cock? is that some kind of Greek liqueur? -Geo's All Knowing Sex Slave


Extras: Filter Print Post Top
InvisibleNoetical
Flip Horrorshow

Registered: 11/28/04
Posts: 9,230
Re: ass or tits? [Re: eligal]
    #5321804 - 02/20/06 09:12 PM (17 years, 11 months ago)

only if she has an ass like a ten year old boy


Extras: Filter Print Post Top
Offlinefour_winds
ne-se
Registered: 02/12/06
Posts: 382
Loc: steady
Last seen: 17 years, 10 months
Re: ass or tits? [Re: Shroomism]
    #5321825 - 02/20/06 09:16 PM (17 years, 11 months ago)

Quote:

Shroomism said:





that was almost a life changing experience. Had there been a crowd of women nearby, at least ten of them would be impregnated with the fire-hose effect.


Extras: Filter Print Post Top
OfflineShroomFan
nn dmt

Registered: 03/12/04
Posts: 866
Last seen: 10 years, 11 months
Re: ass or tits? [Re: four_winds]
    #5321836 - 02/20/06 09:19 PM (17 years, 11 months ago)

ass i a must..i can live with small boobs as long sa the ass is right


--------------------
Fellow Shroomerites, if you Love expressing yourself with a dope tee shirt feast your 3rd eye on www.facebook.com/vicereversa
∞ Conscious Clothing for Conscious Minds ∞ Wear a tee , open a mind
Each shirt is spawned to Arouse Awareness <> We believe in Sustainability & Giving back <> Do you know of a community project or persons in need you feel deserves attention? - Tell us on our page And we just might pick the story > develop a tee > and donate the proceeds to that cause. ∞♥∞ Unget it, VICE REVERSA


Extras: Filter Print Post Top
InvisibleTYL3R
I'm a teapot User Gallery

Registered: 11/19/04
Posts: 17,493
Re: ass or tits? [Re: Guitarpro1313]
    #5321852 - 02/20/06 09:21 PM (17 years, 11 months ago)

I'll choose one tit, and one cheek :wink:


Extras: Filter Print Post Top
Invisiblegoobler
Reanimated
 User Gallery

Folding@home Statistics
Registered: 02/24/03
Posts: 48,909
Re: ass or tits? [Re: ShroomFan]
    #5321854 - 02/20/06 09:22 PM (17 years, 11 months ago)

spelling? tori?


Extras: Filter Print Post Top
OfflineBasidiocarp
Dr. BunsenHoneydew
Male User Gallery

Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
Re: ass or tits? [Re: Guitarpro1313]
    #5321873 - 02/20/06 09:26 PM (17 years, 11 months ago)

Tits on girls (small and perky, none of that double-D over-kill please), and cute butts on guys.    Um, I guess this one ---> :3some:  is appropriate for here...  :cool:


--------------------
"...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."

Visit the Psychonautical Society


Extras: Filter Print Post Top
OfflineHippieChick
Chicks can do it too!
Female User Gallery

Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
Re: ass or tits? [Re: Noetical]
    #5321897 - 02/20/06 09:31 PM (17 years, 11 months ago)

Quote:

noeticbuzz said:
All about the small tight ass, I love tiny girls






You'd love me




LOL

Peace,Love,Happiness and Harmony
:heart: Hippie Chick  :mushroom2:


--------------------
Peace,Love and Happiness
:heart: HC :mushroom2:

Freedoms just another word for nothing left to lose..............

I LUV My Greenhouse
http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848

My First Pans
http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058


Extras: Filter Print Post Top
OfflineBasidiocarp
Dr. BunsenHoneydew
Male User Gallery

Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
Re: ass or tits? [Re: HippieChick]
    #5321926 - 02/20/06 09:37 PM (17 years, 11 months ago)

Quote:

HippieChick said:
Quote:

noeticbuzz said:
All about the small tight ass, I love tiny girls






You'd love me








Holy shite, a girl that would fit into my All American. I am in Lust! *Woot!*


--------------------
"...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."

Visit the Psychonautical Society


Extras: Filter Print Post Top
InvisibleShroomismM
Space Travellin
Male User Gallery
Folding@home Statistics
Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension Flag
Re: ass or tits? [Re: HippieChick]
    #5321933 - 02/20/06 09:39 PM (17 years, 11 months ago)

Any chick that can fit in a PC is alright in my book :thumbup:


--------------------


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: ass or tits? [Re: Basidiocarp]
    #5321938 - 02/20/06 09:39 PM (17 years, 11 months ago)

Yeah, no need to use protection if you sterilize them first. :smile:


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
InvisibleTYL3R
I'm a teapot User Gallery

Registered: 11/19/04
Posts: 17,493
Re: ass or tits? [Re: Shroomism]
    #5321942 - 02/20/06 09:41 PM (17 years, 11 months ago)

Is that a PC ?

I thought it was some kind of pot....


Extras: Filter Print Post Top
InvisibleShroomismM
Space Travellin
Male User Gallery
Folding@home Statistics
Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension Flag
Re: ass or tits? [Re: TYL3R]
    #5321948 - 02/20/06 09:42 PM (17 years, 11 months ago)

Pressure Cooker foolio
'
get down with the myco terminology


--------------------


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: ass or tits? [Re: TYL3R]
    #5321951 - 02/20/06 09:43 PM (17 years, 11 months ago)

Pressure...







Cooker.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineWhiteBunny
How deep doesthe rabbit hole go?
 User Gallery

Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
Re: ass or tits? [Re: Shroomism]
    #5321959 - 02/20/06 09:46 PM (17 years, 11 months ago)

Quote:

Shroomism said:





that first picture is amazing please tell me where i can find this girl in action.

WB


--------------------


Extras: Filter Print Post Top
InvisibleShroomismM
Space Travellin
Male User Gallery
Folding@home Statistics
Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension Flag
Re: ass or tits? [Re: WhiteBunny]
    #5321964 - 02/20/06 09:47 PM (17 years, 11 months ago)

Right here! Right now!













--------------------


Extras: Filter Print Post Top
OfflineBasidiocarp
Dr. BunsenHoneydew
Male User Gallery

Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
Re: ass or tits? [Re: Shroomism]
    #5321975 - 02/20/06 09:50 PM (17 years, 11 months ago)

Well a little too much... what does Austin Powers call them... "jublie" action goin' on there for this Shroomerite, heh.


--------------------
"...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."

Visit the Psychonautical Society


Extras: Filter Print Post Top
OfflineWhiteBunny
How deep doesthe rabbit hole go?
 User Gallery

Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
Re: ass or tits? [Re: Shroomism]
    #5321976 - 02/20/06 09:50 PM (17 years, 11 months ago)

It's late at nite and she might be my bed time medicine  :whacker:  I have to be at work at 7:30 :frown:

please tell me there are more picture of videos of this girl, her tits are amazing!!!

WB


--------------------


Edited by WhiteBunny (02/20/06 09:54 PM)


Extras: Filter Print Post Top
OfflineWhiteBunny
How deep doesthe rabbit hole go?
 User Gallery

Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
Re: ass or tits? [Re: Basidiocarp]
    #5321984 - 02/20/06 09:51 PM (17 years, 11 months ago)

Quote:

Basidiocarp said:
Well a little too much... what does Austin Powers call them... "jublie" action goin' on there for this Shroomerite, heh.




NEVER to much

WB


--------------------


Extras: Filter Print Post Top
InvisibleCorporal Kielbasa

Registered: 05/29/04
Posts: 17,235
Re: ass or tits? [Re: Guitarpro1313]
    #5321987 - 02/20/06 09:52 PM (17 years, 11 months ago)

i would like to one day be able to bounce a quarter off a girls ass. But untill then i will have to say titties, titties n beer titties n beer titties n beer titties n beer titties n beer titties n beer titties n beer titties n beer titties n beer titties n beer


Extras: Filter Print Post Top
InvisibleShroomismM
Space Travellin
Male User Gallery
Folding@home Statistics
Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension Flag
Re: ass or tits? [Re: Corporal Kielbasa]
    #5321991 - 02/20/06 09:53 PM (17 years, 11 months ago)

this man has his priorities straight


--------------------


Extras: Filter Print Post Top
OfflineWhiteBunny
How deep doesthe rabbit hole go?
 User Gallery

Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
Re: ass or tits? [Re: Shroomism]
    #5322000 - 02/20/06 09:55 PM (17 years, 11 months ago)

Are you holding back on your girl Shroomism?

WB


--------------------


Extras: Filter Print Post Top
InvisibleShroomismM
Space Travellin
Male User Gallery
Folding@home Statistics
Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension Flag
Re: ass or tits? [Re: WhiteBunny]
    #5322005 - 02/20/06 09:56 PM (17 years, 11 months ago)

If I had more.. they would have been posted already :frown:


--------------------


Extras: Filter Print Post Top
OfflineBasidiocarp
Dr. BunsenHoneydew
Male User Gallery

Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
Re: ass or tits? [Re: WhiteBunny]
    #5322008 - 02/20/06 09:57 PM (17 years, 11 months ago)

Quote:

WhiteBunny said:
NEVER to much




All a matter of taste.  I go by the handfull rule muhself:  More than a handfull is a waste.  :wink:


--------------------
"...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."

Visit the Psychonautical Society


Extras: Filter Print Post Top
InvisibleCorporal Kielbasa

Registered: 05/29/04
Posts: 17,235
Re: ass or tits? [Re: Shroomism]
    #5322015 - 02/20/06 09:58 PM (17 years, 11 months ago)

I?m mean ?n I?m bad, (y?know I ain?t no sissy)
Got a big-titty girly by the name of ?chrissy?
Talkin? about her ?n my bike ?n me...
?n this ride up the mountain of mystery, (mystery)

(how ?re you doin?? )

I noticed even the crickets
Acted weird up here
And so I figured I might
Just drink a little beer
I said, gimme summa that what yer suckin? on...
But there was no reply
?cause she was gone!

Where?s those titties I like so well,
?n? my goddam beer!
Is what I started to yell, then I heard this noise
Like a crunchin? twig, ?n up jumped the devil!
(he?s about this big!)

He had a red suit on
An? a widow?s peak
An? then a pointed tail
?n like a sulphur reek,
Yes, it was him awright,
I swear I knowed it was!
He had some human flesh
Stuck underneath his claws
You know, it looked to me
Like it was titty skin!
I said, you son-of-a-bitch!
(?cause I was mad at him!)
He just got out his floss
?n started cleanin? his fang
So I shot him with my shooter,
Said: bang! bang! bang!

Then the sucker just laughed ?n said: put it away!
You know, I ate her all up...now what you
Gonna say?
You ate my chrissy?
Yeah! titties ?n all!
Well what about the beer then?
Now, were the cans this tall?
Even her boots?
Would I lie to you?
Shit, you musta been hungry!
Yeah, this is true.
Don?t they pay you good for the
Stuff that you do?
Well, you know, I can?t complain when the checks come through...
Well I want my chrissy,
Oh yeah?
?n I want my beer
Hah!
So you just barf it back up!
Now, devil, do you hear?
Look:
Blow it out your ass, motorcycle man!
I mean, I am the devil, do you understand?
Just what will you give me for your
Titties and beer?
I suppose you noticed this little
Contract here...
Yer goddam right, you son-of-a-whore!
Don?t call me that!
That?s about the only reason
I learned writin? for!
Gimme that paper! bet yer horns I?ll sign!
Because I need a beer, ?n it?s titty-
Squeezin? time!
Man, you can?t fool me! you ain?t that bad!
Oh yeah?
Why you shoulda seen some of the souls that I?ve had!
There was milhous nixon ?n agnew too!
?n both of those suckers was worse ?n you!
Let?s make a deal if you think
That?s true
I mean, you?re supposed to be the devil so...whatcha
Gonna do?
Heh?

Now hold on just a second...
You wanna make a deal with me hah?
Yeah!
Well ah, I don?t know man, you know...
I just don?t know about this...
What?
See, cause i...
Listen, you?re...are you losing your nerve?
No man, it ain?t got nothin? to do with nerve...
You?re supposed to be the devil!
It?s got to do...
You?re supposed to be bad!
It?s got to do with style, fool!
I don?t know if you?ve the right style to get into hell,
You know...
Well, actually, to tell you...tell you the honest to god
Truth,
I?m very short on style as a matter of fact...
Yeah, I know...that?s...that?s what makes me wonder
But I have...i, I think I have something that
You may be interested in...
What is that?
You can have my soul
It?s a mean little sucker
?bout a thousand years old
But once you gets it
You can?t give it back
You gotta keep it forever
An? that?s a natural fact!
Ooh wee!
Do you read me devil?
Oh yeah!
What? am I supposed to be scared, man?
Oh yeah, reety, aw-righty!
Oh yeah, that?s real tough!
I bet you?re real bad!
Listen fool, you?ve got to prove to me that you?re rough
Enough to get into hell
That you?ve got the style enough to get into hell
So start talkin?...
Alright, lemme tell ya somethin?
Alright!
I?ll prove to you that I?m bad enough to go to hell
Yeah!
Because I have been through it!
Yeah!
I have seen it!
Yeah!
It has happened to me!
Yeah!
Remember, I was signed with warner brothers
For eight fuckin? years!!!
Tell me about it!
Now you?re talkin? about something!
Now how bad is that?
That sounds good to me, motherfucker!
So move right along
Tell me what your interests are, you know...
If we?re gonna come to some kind of agreement,
I?ve got to know what you?re all about, you know...
?cause I don?t know if you?re the right type for the...
For the place, you know
Look...lemme tell you what my problem really is, you see
Ok...
My problem is that I don?t belong anywhere
Aha...
You see... I don?t even belong where you are, you see
I hope not!
I, I?m a simple person, you know
I have very small desires in life
Titties ?n beer, you know
No! what?
Titties ?n beer!
No! no man, you?re joking...
Titties ?n beer, titties ?n beer, titties ?n beer...
What? no! no please... no! not that! oh no man, no!
Titties ?n beer, titties ?n beer, titties ?n beer...
No! no! no! no! no! not titties ?n beer!
Oh I can?t stand titties ?n beer!...
Titties ?n beer, titties ?n beer, titties ?n beer...
(I?m in you! I?m in you!)
Oh no! no! no! wait...
Ah! look at this! what am I gonna do with this thing?
...wait, wait, please no!
Hey! look at this!

No! don?t sign it! give me time to think!
...hold on a second, boy, ?cause...that?s
Magic ink!

Then the devil barfed
?n out jumped my girl
They heard the titties plop-ploppin?
All around the world, she said:

I got three beers ?n a fist fulla downs,
An? I?m gonna get ripped, so fuck
You clowns!

Then she gave us the finger!
(it was rigid ?n stiff)
That?s when the devil, she farted
An? she went right over the cliff!
The devil was mad!
(I took off to my pad)
I swear I do declare!
How did she get back there?
I swear I do declare!
How did she get back there?
I swear I do declare!
How did she get back there?
I swear I do declare!
How did she get back there?

Alright!


Extras: Filter Print Post Top
Offlinewhichits
Stranger
Registered: 01/14/06
Posts: 22
Last seen: 16 years, 3 months
Re: ass or tits? [Re: Corporal Kielbasa]
    #5322024 - 02/20/06 10:00 PM (17 years, 11 months ago)

tits and nipples the #1 super sized


Extras: Filter Print Post Top
OfflineWhiteBunny
How deep doesthe rabbit hole go?
 User Gallery

Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
Re: ass or tits? [Re: Basidiocarp]
    #5322029 - 02/20/06 10:01 PM (17 years, 11 months ago)

Quote:

Basidiocarp said:
Quote:

WhiteBunny said:
NEVER to much




All a matter of taste.  I go by the hand full rule muhself:  More than a handfull is a waste.  :wink:




erroneous!!!  If they can keep their composer, the more the merrier.  I have had much more than a hand full before and the were amazing.  Long live the D!

WB


--------------------


Extras: Filter Print Post Top
InvisibleCorporal Kielbasa

Registered: 05/29/04
Posts: 17,235
Re: ass or tits? [Re: HippieChick]
    #5322046 - 02/20/06 10:03 PM (17 years, 11 months ago)

Quote:

HippieChick said:
Quote:

noeticbuzz said:
All about the small tight ass, I love tiny girls






You'd love me




LOL

Peace,Love,Happiness and Harmony
:heart: Hippie Chick  :mushroom2:




ha ha i got the same one! minus the hippychick  :confused:  I think the people that sold it to me ripped me off :mad2:


Extras: Filter Print Post Top
InvisibleShroomismM
Space Travellin
Male User Gallery
Folding@home Statistics
Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension Flag
Re: ass or tits? [Re: Corporal Kielbasa]
    #5322056 - 02/20/06 10:05 PM (17 years, 11 months ago)

yeah.. I'd go demand a refund or a replacement if I were you


--------------------


Extras: Filter Print Post Top
InvisibleCorporal Kielbasa

Registered: 05/29/04
Posts: 17,235
Re: ass or tits? [Re: Shroomism]
    #5322071 - 02/20/06 10:08 PM (17 years, 11 months ago)

i mean for the price it should come with a helper.........ya know!?!


Extras: Filter Print Post Top
InvisibleTM
The Mind, The Many, The Music.
Male User Gallery

Folding@home Statistics
Registered: 06/11/02
Posts: 8,282
Loc: Under The Table And Dream...
Re: ass or tits? [Re: Guitarpro1313]
    #5322080 - 02/20/06 10:10 PM (17 years, 11 months ago)

Face, eyes, sharply angled cheekbones... If all of that is appealing, the rest will be too.

Of ass and tits, I'm more impressed by a nicely shaped ass than boobs of any size.


--------------------
================================================



"Have some congratulatory drugs." - C. Montgomery Burns

I'll probably always do drugs, so that just contributes to the addiction to The Shroomery... It's a vicious circle of bliss. :tongue2:

TM™ :cool:


Extras: Filter Print Post Top
InvisibleVoidOfsPg
Stranger
Female User Gallery
Registered: 05/09/05
Posts: 4,899
Loc: San Antonio, TX
Re: ass or tits? [Re: TM]
    #5322113 - 02/20/06 10:16 PM (17 years, 11 months ago)

I'm all about ass over here.

I like boobs of all sizes, preferably a B or C cup.


Extras: Filter Print Post Top
OfflineHippieChick
Chicks can do it too!
Female User Gallery

Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
Re: ass or tits? [Re: whichits]
    #5322114 - 02/20/06 10:16 PM (17 years, 11 months ago)

Quote:

whichits said:
tits and nipples the #1 super sized





You'd REALLY love me  :wink: LMAO

Just got em pierced too  :grin:

Peace,Love,Happiness and Harmony
:heart: Hippie Chick  :mushroom2:


--------------------
Peace,Love and Happiness
:heart: HC :mushroom2:

Freedoms just another word for nothing left to lose..............

I LUV My Greenhouse
http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848

My First Pans
http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058


Extras: Filter Print Post Top
OfflineHippieChick
Chicks can do it too!
Female User Gallery

Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
Re: ass or tits? [Re: VoidOfsPg]
    #5322123 - 02/20/06 10:18 PM (17 years, 11 months ago)

Quote:

VoidOfsPg said:

I like boobs of all sizes, preferably a B or C cup.






You might not , lol .

Peace,Love,Happiness and Harmony
:heart: Hippie Chick  :mushroom2:


--------------------
Peace,Love and Happiness
:heart: HC :mushroom2:

Freedoms just another word for nothing left to lose..............

I LUV My Greenhouse
http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848

My First Pans
http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058


Extras: Filter Print Post Top
InvisibleSilversoul
Rhizome
Male User Gallery

Registered: 01/01/05
Posts: 23,576
Loc: The Barricades
Re: ass or tits? [Re: HippieChick]
    #5322124 - 02/20/06 10:18 PM (17 years, 11 months ago)

Quote:

HippieChick said:
Just got em pierced too  :grin:



Pics plz


--------------------


Extras: Filter Print Post Top
OfflineHippieChick
Chicks can do it too!
Female User Gallery

Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
Re: ass or tits? [Re: Silversoul]
    #5322165 - 02/20/06 10:27 PM (17 years, 11 months ago)

I've got em , lol . Just can't edit them right now , lost my software in a PC mishap :thumbdown:

Peace,Love,Happiness and Harmony
:heart: Hippie Chick  :mushroom2:


--------------------
Peace,Love and Happiness
:heart: HC :mushroom2:

Freedoms just another word for nothing left to lose..............

I LUV My Greenhouse
http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848

My First Pans
http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058


Extras: Filter Print Post Top
InvisibleShroomismM
Space Travellin
Male User Gallery
Folding@home Statistics
Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension Flag
Re: ass or tits? [Re: HippieChick]
    #5322166 - 02/20/06 10:27 PM (17 years, 11 months ago)

I'll edit them for you :laugh:


--------------------


Extras: Filter Print Post Top
OfflineHippieChick
Chicks can do it too!
Female User Gallery

Registered: 02/20/05
Posts: 5,958
Loc: Midwest
Last seen: 3 years, 13 days
Re: ass or tits? [Re: Shroomism]
    #5322409 - 02/20/06 11:06 PM (17 years, 11 months ago)

LMAO  :grin:


Here . This one doesn't need any






Peace,Love,Happiness and Harmony
:heart: Hippie Chick  :mushroom2:


--------------------
Peace,Love and Happiness
:heart: HC :mushroom2:

Freedoms just another word for nothing left to lose..............

I LUV My Greenhouse
http://www.shroomery.org/forums/showflat.php/Number/5545848#5545848

My First Pans
http://www.shroomery.org/forums/showflat.php/Number/6212058#6212058


Extras: Filter Print Post Top
InvisiblePenguarky Tunguin
f n o r d
Male User Gallery
Registered: 08/08/04
Posts: 17,192
Re: ass or tits? [Re: WhiteBunny]
    #5322417 - 02/20/06 11:08 PM (17 years, 11 months ago)

Quote:

WhiteBunny said:
Quote:

Shroomism said:





that first picture is amazing please tell me where i can find this girl in action.

WB





Sydney Moon.

Youre welcome. Use kleenex.


--------------------
Every mistake, intentional or otherwise, in the above post, is the fault of the reader.


Extras: Filter Print Post Top
OfflineDocPsilocybin
enthusiast

Registered: 04/22/02
Posts: 588
Last seen: 13 years, 1 month
Re: ass or tits? [Re: HippieChick]
    #5322512 - 02/20/06 11:32 PM (17 years, 11 months ago)

Damn! Sexy pic Hippy Chick :laugh:

I'm all about the ass myself.


--------------------
You can't hold a man down without staying down with him.
-- Booker T. Washington


Extras: Filter Print Post Top
OfflineoDin
Registered: 08/12/99
Posts: 5,789
Last seen: 10 years, 7 months
Re: ass or tits? [Re: Guitarpro1313]
    #5322536 - 02/20/06 11:42 PM (17 years, 11 months ago)

whatever one(s) im thinking about at the time


Extras: Filter Print Post Top
InvisibleJonnyOnTheSpot
Sober Surfer
Male User Gallery

Registered: 01/27/02
Posts: 11,527
Loc: North Carolina
Re: ass or tits? [Re: Guitarpro1313]
    #5322653 - 02/21/06 12:19 AM (17 years, 11 months ago)

the booty region is where i stick my penor, so that's where i focus my attention.


Extras: Filter Print Post Top
InvisibleCorporal Kielbasa

Registered: 05/29/04
Posts: 17,235
Re: ass or tits? [Re: JonnyOnTheSpot]
    #5322690 - 02/21/06 12:35 AM (17 years, 11 months ago)

good logic!


Extras: Filter Print Post Top
InvisibleSkorpivoMusterion
Livin in theTwilight Zone...
 User Gallery

Registered: 01/30/03
Posts: 9,954
Loc: You can't spell fungus wi...
Re: ass or tits? [Re: Corporal Kielbasa]
    #5322700 - 02/21/06 12:54 AM (17 years, 11 months ago)



--------------------
Coffee should be black as hell, strong as death, and sweet as love.


Extras: Filter Print Post Top
InvisiblePenguarky Tunguin
f n o r d
Male User Gallery
Registered: 08/08/04
Posts: 17,192
Re: ass or tits? [Re: SkorpivoMusterion]
    #5322714 - 02/21/06 01:04 AM (17 years, 11 months ago)

Thats not Sydney Moon. :grin:


--------------------
Every mistake, intentional or otherwise, in the above post, is the fault of the reader.


Extras: Filter Print Post Top
InvisibleSkorpivoMusterion
Livin in theTwilight Zone...
 User Gallery

Registered: 01/30/03
Posts: 9,954
Loc: You can't spell fungus wi...
Re: ass or tits? [Re: Penguarky Tunguin]
    #5322720 - 02/21/06 01:13 AM (17 years, 11 months ago)

Damn straight, my man. That's the almighty Keyra Agustina. Respekt, the ass.




--------------------
Coffee should be black as hell, strong as death, and sweet as love.


Extras: Filter Print Post Top
OfflineCaRnAgECaNdYS
Tool's groupie
Female User Gallery

Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet Flag
Last seen: 6 months, 23 days
Re: ass or tits? [Re: Koala Koolio]
    #5322777 - 02/21/06 01:49 AM (17 years, 11 months ago)

Quote:

elgr said:
Yeah, no need to use protection if you sterilize them first. :smile:




:thumbup: :wink:


--------------------

The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.


Extras: Filter Print Post Top
InvisibleFungusMan
I81U812
Male User Gallery

Folding@home Statistics
Registered: 08/06/05
Posts: 3,112
Loc: Everywhere
Re: ass or tits? [Re: CaRnAgECaNdY]
    #5322802 - 02/21/06 02:12 AM (17 years, 11 months ago)

Im more of a nipple man. I dont care how big the bewbeez are, as long as the nipple is proportioned right. Im more of an ass guy I guess.


Extras: Filter Print Post Top
OfflinePhluck
Carpal Tunnel
 User Gallery

Registered: 04/10/99
Posts: 11,394
Loc: Canada
Last seen: 3 months, 6 days
Re: ass or tits? [Re: TM]
    #5322868 - 02/21/06 02:52 AM (17 years, 11 months ago)

Quote:

TripMeister said:
Face, eyes, sharply angled cheekbones... If all of that is appealing, the rest will be too.

Of ass and tits, I'm more impressed by a nicely shaped ass than boobs of any size.




I'm with you 100%. The face is easily the most important feature, by far.


--------------------
"I have no valid complaint against hustlers. No rational bitch. But the act of selling is repulsive to me. I harbor a secret urge to whack a salesman in the face, crack his teeth and put red bumps around his eyes." -Hunter S Thompson
http://phluck.is-after.us


Extras: Filter Print Post Top
InvisibleFungusMan
I81U812
Male User Gallery

Folding@home Statistics
Registered: 08/06/05
Posts: 3,112
Loc: Everywhere
Re: ass or tits? [Re: Phluck]
    #5322874 - 02/21/06 02:57 AM (17 years, 11 months ago)

Whats it really matter though. They all feel like pussy in the dark :smile:


Extras: Filter Print Post Top
OfflineBasidiocarp
Dr. BunsenHoneydew
Male User Gallery

Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
Re: ass or tits? [Re: FungusMan]
    #5322888 - 02/21/06 03:09 AM (17 years, 11 months ago)

Quote:

FungusMan said:
Whats it really matter though. They all feel like pussy in the dark :smile:




Well sewer rat might taste like pumpkin pie, to quote a famous Tarantino chracter, but that doesn't mean we run around eatin' just any old pumpkin pie, even if it might be in the dark!


--------------------
"...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."

Visit the Psychonautical Society


Extras: Filter Print Post Top
InvisibleFungusMan
I81U812
Male User Gallery

Folding@home Statistics
Registered: 08/06/05
Posts: 3,112
Loc: Everywhere
Re: ass or tits? [Re: Basidiocarp]
    #5322896 - 02/21/06 03:17 AM (17 years, 11 months ago)

Quote:

Basidiocarp said:
Quote:

FungusMan said:
Whats it really matter though. They all feel like pussy in the dark :smile:




Well sewer rat might taste like pumpkin pie, to quote a famous Tarantino chracter, but that doesn't mean we run around eatin' just any old pumpkin pie, even if it might be in the dark!




Hey, Im one of those guys that, when as a kid, was eating a hotdog and was told what it was made out of. I just kept eating them.


Extras: Filter Print Post Top
OfflineBasidiocarp
Dr. BunsenHoneydew
Male User Gallery

Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
Re: ass or tits? [Re: FungusMan]
    #5322902 - 02/21/06 03:28 AM (17 years, 11 months ago)

Quote:

FungusMan said:
Hey, Im one of those guys that, when as a kid, was eating a hotdog and was told what it was made out of. I just kept eating them.




That's all fine and dandy when we are at Fenway (Yank stadium if I had my way) or pimpin' a dawg off of the guys in the Home Depot parking lot...  But my God man, when it comes to the Holiest of Holies, would you draw such a similar, sweeping conclusion?  :cool:


--------------------
"...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."

Visit the Psychonautical Society


Extras: Filter Print Post Top
InvisibleFungusMan
I81U812
Male User Gallery

Folding@home Statistics
Registered: 08/06/05
Posts: 3,112
Loc: Everywhere
Re: ass or tits? [Re: Basidiocarp]
    #5322917 - 02/21/06 03:46 AM (17 years, 11 months ago)

Hell yeh I would. A bad piece of ass, is better than a good day at work in my book,lol. As long as she dont have STD's or anything.


Extras: Filter Print Post Top
OfflineBasidiocarp
Dr. BunsenHoneydew
Male User Gallery

Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
Re: ass or tits? [Re: FungusMan]
    #5322921 - 02/21/06 03:53 AM (17 years, 11 months ago)

LOL, guys,  aren't we so vulgah?!  Hehe, personallly I'll take muh own hand (ya know, Mary Palm & her Five Sisters) over some skank azz that doesn't do it for my eyes.  I need good and proper visual entertainment as well.  :grin:


--------------------
"...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."

Visit the Psychonautical Society


Extras: Filter Print Post Top
InvisibleFungusMan
I81U812
Male User Gallery

Folding@home Statistics
Registered: 08/06/05
Posts: 3,112
Loc: Everywhere
Re: ass or tits? [Re: Basidiocarp]
    #5322925 - 02/21/06 03:53 AM (17 years, 11 months ago)

Ill just close me eyes, and pork the fatty! LMAO


Extras: Filter Print Post Top
OfflineBasidiocarp
Dr. BunsenHoneydew
Male User Gallery

Registered: 01/17/04
Posts: 395
Loc: Rogue's Island, USA
Last seen: 17 years, 6 months
Re: ass or tits? [Re: FungusMan]
    #5322929 - 02/21/06 03:58 AM (17 years, 11 months ago)

Quote:

FungusMan said:
Ill just close me eyes, and pork the fatty! LMAO




LOL You sik bastid, more power to ya if you can pull it off muh man.  I am cursed by the requisite need of something hot to look at as I work...  :smirk:


--------------------
"...if the mind is actually part of a continuum, a labyrinth that is connected not only to every other mind that exists or has existed, but to every atom, organism, and region in the vastness of space and time itself, the fact that it is able to occasionally make forays into the labyrinth and have transpersonal experiences no longer seems so strange."

Visit the Psychonautical Society


Extras: Filter Print Post Top
OfflineInsaneMetalMan

Registered: 10/12/05
Posts: 66
Last seen: 12 years, 8 months
Re: ass or tits? [Re: Basidiocarp]
    #5323147 - 02/21/06 07:37 AM (17 years, 11 months ago)

I like tits, because they're soft and work as good love pillows. :smile:


--------------------
Bring on the answers, take away the pain.
I fight off the demons, that make me go insane.
Looking through the hourglass, I count down the day,
to look towards the next, to embrace it all the way.


Extras: Filter Print Post Top
Offlinenakors_junk_bag
Lobster Bisque
Male User Gallery

Registered: 11/23/04
Posts: 2,415
Loc: ethereality
Last seen: 15 years, 9 months
Re: ass or tits? [Re: InsaneMetalMan]
    #5323150 - 02/21/06 07:39 AM (17 years, 11 months ago)

fat pussy lips!

an outy, like a roast beef sammich from Arby's


ass and tits!

sex aint nothing but lips and clits.


--------------------
Asshole


Extras: Filter Print Post Top
Offlinekilroy69
POKER GOD
Male User Gallery

Registered: 11/19/00
Posts: 1,303
Loc: Jackson,MI. And not in pr...
Last seen: 8 years, 4 months
Re: ass or tits? [Re: nakors_junk_bag]
    #5323542 - 02/21/06 10:36 AM (17 years, 11 months ago)

There is nothing better than a hottie with a tight ass IMHO.Tits just don't do it for me. I would take a girl with small tits and a nice ass any day of the week.


--------------------
Yeaaa im still alive.


Extras: Filter Print Post Top
Offlineadamj
Superhero
Male User Gallery

Registered: 11/11/03
Posts: 1,562
Loc: Ontario, CAN
Last seen: 3 years, 1 month
Re: ass or tits? [Re: Guitarpro1313]
    #5323557 - 02/21/06 10:39 AM (17 years, 11 months ago)

Titties. Especially when you're rubbing your face in them.


Extras: Filter Print Post Top
Offlinekilroy69
POKER GOD
Male User Gallery

Registered: 11/19/00
Posts: 1,303
Loc: Jackson,MI. And not in pr...
Last seen: 8 years, 4 months
Re: ass or tits? [Re: adamj]
    #5323566 - 02/21/06 10:41 AM (17 years, 11 months ago)

and besides, girls with big tits seem to end up fat in the long run.


--------------------
Yeaaa im still alive.


Extras: Filter Print Post Top
InvisibleVoidOfsPg
Stranger
Female User Gallery
Registered: 05/09/05
Posts: 4,899
Loc: San Antonio, TX
Re: ass or tits? [Re: kilroy69]
    #5323632 - 02/21/06 10:57 AM (17 years, 11 months ago)

Quote:

kilroy69 said:
There is nothing better than a hottie with a tight ass IMHO.Tits just don't do it for me. I would take a girl with small tits and a nice ass any day of the week.




:thumbup: :grin:


Extras: Filter Print Post Top
OfflineAngeloWish
Sr. Mydriasis

Registered: 07/13/05
Posts: 595
Loc: MEXICO-Mushroom Capital
Last seen: 4 years, 3 months
Re: ass or tits? [Re: VoidOfsPg]
    #5323850 - 02/21/06 12:18 PM (17 years, 11 months ago)

I will always preffer a nice, smooth and considerably big ass than a big pair of tits (aslong as she has tits... maybe 'cause i've had enough of big titted women already).

Big butts -not fat- make me feel respect for a woman.


--------------------
+'this' reality is the one i like the most+


Extras: Filter Print Post Top
InvisibleSilversoul
Rhizome
Male User Gallery

Registered: 01/01/05
Posts: 23,576
Loc: The Barricades
Re: ass or tits? [Re: JonnyOnTheSpot]
    #5323893 - 02/21/06 12:33 PM (17 years, 11 months ago)

Quote:

JonnyOnTheSpot said:
the booty region is where i stick my penor, so that's where i focus my attention.



My penor is down there, but my eyes are up there watching the titties bounce.


--------------------


Extras: Filter Print Post Top
Offlinemediman0078
Stilllooking.....

Registered: 11/14/05
Posts: 1,379
Loc: Here, there, EVERYWHERE
Last seen: 17 years, 10 months
Re: ass or tits? [Re: Silversoul]
    #5324029 - 02/21/06 01:19 PM (17 years, 11 months ago)

Arseses... I like a nice booty. Tits are fun, but there's just nothing like a nice ass to hang onto when hitting it doggy style. :grin:


--------------------
........someday I'll find it.


Extras: Filter Print Post Top
InvisiblePenguarky Tunguin
f n o r d
Male User Gallery
Registered: 08/08/04
Posts: 17,192
Re: ass or tits? [Re: Basidiocarp]
    #5325470 - 02/21/06 07:14 PM (17 years, 11 months ago)

Quote:

Basidiocarp said:
LOL, guys,  aren't we so vulgah?!  Hehe, personallly I'll take muh own hand (ya know, Mary Palm & her Five Sisters) over some skank azz that doesn't do it for my eyes.  I need good and proper visual entertainment as well.  :grin:





Exactly, I know for certain my hand doesn't have any STDs.  Thank you.


--------------------
Every mistake, intentional or otherwise, in the above post, is the fault of the reader.


Extras: Filter Print Post Top
InvisibleKingOftheThing
the cool fool
 User Gallery

Registered: 11/17/02
Posts: 27,397
Loc: USA
Re: ass or tits? [Re: Guitarpro1313]
    #5325515 - 02/21/06 07:25 PM (17 years, 11 months ago)

ass i guess, just because i dont like fat chicks. i really do love boobs though


Extras: Filter Print Post Top
InvisibleAliceDee
-L S D-
Male
Registered: 08/10/03
Posts: 3,957
Re: ass or tits? [Re: Penguarky Tunguin]
    #5325531 - 02/21/06 07:28 PM (17 years, 11 months ago)

ASS!!! if shes got a nice ass i dont even care about the size of her tits... girls with nice tits dont always have nice bodies, but girls with nice ass's are ALWAYS good all around.... two words.. VIDA GUERRA


Extras: Filter Print Post Top
OfflineEkstaza
stranger than most
 User Gallery

Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 9 months, 23 days
Re: ass or tits? [Re: AliceDee]
    #5325595 - 02/21/06 07:39 PM (17 years, 11 months ago)

I'm definately not a fan of big tits. I like 'em small. Big tits are gonna end up around the womans waste in the end after all is said and done. Give me a chick with a nice ass and small tits and I'm a happy man.

Above all, though, I love beautiful eyes. I once freaked a stripper out because I stared at her eyes while she was trying to get me to buy a lap dance. She asked me what I was looking at and I told her that she had the most beautiful eyes. Then I said that I didn't want a lap dance.


--------------------
YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.


Extras: Filter Print Post Top
InvisiblePenguarky Tunguin
f n o r d
Male User Gallery
Registered: 08/08/04
Posts: 17,192
Re: ass or tits? [Re: AliceDee]
    #5325623 - 02/21/06 07:43 PM (17 years, 11 months ago)

Quote:

AliceDee said:
ASS!!! if shes got a nice ass i dont even care about the size of her tits... girls with nice tits dont always have nice bodies, but girls with nice ass's are ALWAYS good all around.... two words.. VIDA GUERRA





Two words...breast implants.


--------------------
Every mistake, intentional or otherwise, in the above post, is the fault of the reader.


Extras: Filter Print Post Top
OfflineEkstaza
stranger than most
 User Gallery

Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 9 months, 23 days
Re: ass or tits? [Re: Penguarky Tunguin]
    #5325645 - 02/21/06 07:47 PM (17 years, 11 months ago)

Quote:

McKennaDMT said:
Two words...breast implants.



No way girls, leave 'em be.


However, if breasts are gonna be big, I prefer them fake.


--------------------
YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.


Extras: Filter Print Post Top
InvisiblePenguarky Tunguin
f n o r d
Male User Gallery
Registered: 08/08/04
Posts: 17,192
Re: ass or tits? [Re: Ekstaza]
    #5325654 - 02/21/06 07:50 PM (17 years, 11 months ago)

I meant that to AliceDee, Vida has breast implants, so his theory isn't correct.  :wink:


--------------------
Every mistake, intentional or otherwise, in the above post, is the fault of the reader.


Extras: Filter Print Post Top
OfflineGrapeSoda
Green Raindrop

Registered: 08/17/05
Posts: 37
Loc: France
Last seen: 17 years, 9 months
Re: ass or tits? [Re: Penguarky Tunguin]
    #5325740 - 02/21/06 08:11 PM (17 years, 11 months ago)

Ass. A girl with a toned body, and a solid ass is hot on so many levels... whereas a girl with big tits.. is usually just a girl with big tits. The facial structure of course is the most noticable part of a woman.. but when it comes to the body.. ass wins over tits.


Extras: Filter Print Post Top
Offlinenakors_junk_bag
Lobster Bisque
Male User Gallery

Registered: 11/23/04
Posts: 2,415
Loc: ethereality
Last seen: 15 years, 9 months
Re: ass or tits? [Re: Ekstaza]
    #5327308 - 02/22/06 07:39 AM (17 years, 11 months ago)

Quote:

Ekstaza said:
I'm definately not a fan of big tits. I like 'em small. Big tits are gonna end up around the womans waste in the end after all is said and done. Give me a chick with a nice ass and small tits and I'm a happy man.

Above all, though, I love beautiful eyes. I once freaked a stripper out because I stared at her eyes while she was trying to get me to buy a lap dance. She asked me what I was looking at and I told her that she had the most beautiful eyes. Then I said that I didn't want a lap dance.




Yeha nice round full small to slightly smaller than medium tits are nice, but most important is the ass, the way it bounces up and down when I stare at it while she fucks my brains out reverse cowgirl style. then the nice plump pussy lips are chilling.

Gotta go with the ass, but not a fat ass, a full round perfect ass.


--------------------
Asshole


Edited by nakors_junk_bag (02/22/06 01:57 PM)


Extras: Filter Print Post Top
OfflineTodcasil
rogue DMT elf
Female User Gallery

Registered: 08/08/99
Posts: 16,381
Loc: Crawling on the floor...
Last seen: 9 years, 4 months
Re: ass or tits? [Re: nakors_junk_bag]
    #5327352 - 02/22/06 08:15 AM (17 years, 11 months ago)

neither. seperatly they are nothing.


--------------------
Men look at themselves and they see flawed humans, we look at women and we see perfect
GODDESSES
Women look at themselves and they seem utterly human, when looking at men they see proud
GODS.


~Casil



:cactus:


Extras: Filter Print Post Top
OfflineJack_Flash
604
Male User Gallery

Registered: 03/17/05
Posts: 619
Loc: richmond, BC
Last seen: 9 years, 5 months
Re: ass or tits? [Re: Todcasil]
    #5327518 - 02/22/06 10:14 AM (17 years, 11 months ago)

i like a tight poosy
its all about the whole thing


Extras: Filter Print Post Top
OfflineSneezingPenis
ACHOOOOOOOOO!!!!!111!
 User Gallery
Registered: 01/15/05
Posts: 15,427
Last seen: 6 years, 8 months
Re: ass or tits? [Re: Jack_Flash]
    #5327531 - 02/22/06 10:21 AM (17 years, 11 months ago)



ass, by far.


Extras: Filter Print Post Top
Invisibleit stars saddam
Satan

Registered: 05/19/05
Posts: 15,571
Loc: Spahn Ranch
Re: ass or tits? [Re: Guitarpro1313]
    #5327542 - 02/22/06 10:26 AM (17 years, 11 months ago)

I'M A BACKDOOR MAN!


Extras: Filter Print Post Top
Invisibleeligal
Noobie

Folding@home Statistics
Registered: 05/25/05
Posts: 7,021
Loc: California
Re: ass or tits? [Re: SneezingPenis]
    #5327627 - 02/22/06 11:07 AM (17 years, 11 months ago)

Quote:

psilocyberin said:


ass, by far.





:drooling:


--------------------
\m/ Spanksta \m/

"do you have the freedom to do with your nervous system what you want?"

"MolokoMilkPlus said:
I'll respect you if you let me give you a blow job"

"tactik said:
respect the can."



Extras: Filter Print Post Top
Offlinemediman0078
Stilllooking.....

Registered: 11/14/05
Posts: 1,379
Loc: Here, there, EVERYWHERE
Last seen: 17 years, 10 months
Re: ass or tits? [Re: eligal]
    #5327677 - 02/22/06 11:26 AM (17 years, 11 months ago)

Now that's some nice cheeks. :drooling:


--------------------
........someday I'll find it.


Extras: Filter Print Post Top
Offlineduggan18
Stranger
Registered: 08/02/05
Posts: 166
Last seen: 16 years, 4 months
Re: ass or tits? [Re: Ekstaza]
    #5327712 - 02/22/06 11:43 AM (17 years, 11 months ago)

ass.


Extras: Filter Print Post Top
InvisibleRoadkillM
Retired Shroomery Mod
Male User Gallery

Registered: 12/11/01
Posts: 22,674
Loc: Montana
Re: ass or tits? [Re: Guitarpro1313]
    #5327746 - 02/22/06 11:56 AM (17 years, 11 months ago)

Hooters!~



--------------------
Laterz, Road

Who the hell you callin crazy?
You wouldn't know what crazy was if Charles Manson was eating froot loops on your front porch!


Brainiac said:
PM the names with on there names, that means they have mushrooms for sale.



Extras: Filter Print Post Top
OfflineJack_Flash
604
Male User Gallery

Registered: 03/17/05
Posts: 619
Loc: richmond, BC
Last seen: 9 years, 5 months
Re: ass or tits? [Re: Roadkill]
    #5327902 - 02/22/06 12:36 PM (17 years, 11 months ago)

i gaurantee you that chick doesnt smoke, but i do find it attractive, thinking its a blunt


Extras: Filter Print Post Top
Offlineabsolute zero
The Hero
Male User Gallery
Registered: 11/04/01
Posts: 796
Loc: 127.0.0.1
Last seen: 11 years, 8 months
Re: ass or tits? [Re: Guitarpro1313]
    #5327935 - 02/22/06 12:47 PM (17 years, 11 months ago)

Quote:

Guitarpro1313 said:
tit guy or ass guy?





I have two hands... why choose?


--------------------


Extras: Filter Print Post Top
Offlinenakors_junk_bag
Lobster Bisque
Male User Gallery

Registered: 11/23/04
Posts: 2,415
Loc: ethereality
Last seen: 15 years, 9 months
Re: ass or tits? [Re: absolute zero]
    #5328148 - 02/22/06 01:59 PM (17 years, 11 months ago)

Quote:

Zero__Glass said:
Quote:

Guitarpro1313 said:
tit guy or ass guy?





I have two hands... why choose?




cause u can only put your face in one of them at a time,,,,,    :crazy2:


--------------------
Asshole


Extras: Filter Print Post Top
Invisibledownforpot
Stranger
Male
Registered: 06/25/01
Posts: 5,715
Re: ass or tits? [Re: nakors_junk_bag]
    #5328187 - 02/22/06 02:11 PM (17 years, 11 months ago)

ass


--------------------



http://www.myspace.com/4th25


"And I don't care if he was handcuffed
Then shot in his head
All I know is dead bodies
Can't fuck with me again"


Extras: Filter Print Post Top
Invisibleirascible_raunch
Stranger
Male User Gallery

Registered: 10/18/05
Posts: 1,111
Re: ass or tits? [Re: downforpot]
    #5328218 - 02/22/06 02:18 PM (17 years, 11 months ago)

Seriously. Both.


Extras: Filter Print Post Top
OfflineKamek
Male User Gallery

Registered: 01/08/05
Posts: 2,923
Last seen: 8 months, 6 days
Re: ass or tits? [Re: irascible_raunch]
    #5328306 - 02/22/06 02:53 PM (17 years, 11 months ago)

ASS


Extras: Filter Print Post Top
Offlineshirley knott
not my real name
 User Gallery
Registered: 11/11/02
Posts: 9,105
Loc: London Flag
Last seen: 7 years, 28 days
Re: ass or tits? [Re: Guitarpro1313]
    #5328370 - 02/22/06 03:14 PM (17 years, 11 months ago)

tits



--------------------
buh


Extras: Filter Print Post Top
Offlinenotapillow
I want to be a fisherman
 User Gallery

Registered: 09/29/03
Posts: 31,129
Loc: A rare and different tune
Last seen: 3 years, 11 months
Re: ass or tits? [Re: shirley knott]
    #5328445 - 02/22/06 03:47 PM (17 years, 11 months ago)

i gotta go with the tats


--------------------




Extras: Filter Print Post Top
Invisiblevinsue
Grand Old Fart
Male User Gallery

Registered: 02/17/04
Posts: 17,953
Loc: The Garden State(NJ) Flag
Re: ass or tits? [Re: Guitarpro1313]
    #5328464 - 02/22/06 03:53 PM (17 years, 11 months ago)

I didn't read the whole thread, but I'm kinda partial to pussy. :shrug:  T & A is OK to me, but the pussy is where I like to be... :grin:


--------------------

"All mushrooms are edible; but some only once." Croatian proverb. BTW ...
  Have You Rated Ythans Mom Yet ?? ... :taser:  ... HERE'S HOW ... (be nice) .  :mod: ... :peace:


Extras: Filter Print Post Top
OfflineHimejime
Learning the way

Registered: 12/25/05
Posts: 158
Loc: Northern Cali
Last seen: 16 years, 2 months
Re: ass or tits? [Re: vinsue]
    #5328475 - 02/22/06 04:00 PM (17 years, 11 months ago)

id rather have a girl with small titties and a perfect ass then some big tities and a flat ass ewwww


Extras: Filter Print Post Top
InvisibleAcidic_SlothM
Acidic poly-Sided Di-slothamide
 User Gallery

Registered: 05/29/02
Posts: 43,732
Loc: ainrofilac Flag
Re: ass or tits? [Re: Himejime]
    #5857246 - 07/14/06 07:54 AM (17 years, 6 months ago)

what if they have big tits and a nice ass?


i personally like tits. but i like ass too. i guess it really depends.


--------------------
-- Accept my heart warming gift of TREE SCRATCHIES!!! I absolve thee!! --

JaP: 30,000 lines of gay, cock, and fag can't be wrong
Ped: only in #shroomery is "smuggle opium in her ass" followed by "i don't want shitty opium" which is followed by " *** Joins: PENISSQUAD"
--
JaP: What would this place be without random sluts?
JaP: Nothing, I tell you.


:heart: :todcasil: :heart:


Extras: Filter Print Post Top
Invisiblegoobler
Reanimated
 User Gallery

Folding@home Statistics
Registered: 02/24/03
Posts: 48,909
Re: ass or tits? [Re: Acidic_Sloth]
    #5857251 - 07/14/06 07:55 AM (17 years, 6 months ago)

show me both, then I'll decide


Extras: Filter Print Post Top
OfflineScarfmeister
Thrill Seeker
Registered: 10/31/02
Posts: 8,127
Loc: The will to power
Last seen: 4 years, 6 months
Re: ass or tits? [Re: Guitarpro1313]
    #5857254 - 07/14/06 07:57 AM (17 years, 6 months ago)

TITS!


--------------------
--------------------
We're the lowest of the low, the scum of the fucking earth!


Extras: Filter Print Post Top
InvisibleAcidic_SlothM
Acidic poly-Sided Di-slothamide
 User Gallery

Registered: 05/29/02
Posts: 43,732
Loc: ainrofilac Flag
Re: ass or tits? [Re: goobler]
    #5857276 - 07/14/06 08:09 AM (17 years, 6 months ago)

:smirk:


--------------------
-- Accept my heart warming gift of TREE SCRATCHIES!!! I absolve thee!! --

JaP: 30,000 lines of gay, cock, and fag can't be wrong
Ped: only in #shroomery is "smuggle opium in her ass" followed by "i don't want shitty opium" which is followed by " *** Joins: PENISSQUAD"
--
JaP: What would this place be without random sluts?
JaP: Nothing, I tell you.


:heart: :todcasil: :heart:


Extras: Filter Print Post Top
Offlinedrtyfrnk
PresidentialCandidate 2008
Male

Folding@home Statistics
Registered: 01/24/05
Posts: 2,961
Loc: Ontario, Canada
Last seen: 14 years, 3 months
Re: ass or tits? [Re: Guitarpro1313]
    #5857346 - 07/14/06 08:40 AM (17 years, 6 months ago)

:boobs:


--------------------
It's Krang, Bitch!  :krang:


Extras: Filter Print Post Top
Invisiblemycoprog
Modular Heretic
 User Gallery

Registered: 01/12/06
Posts: 797
Loc: N. America
Re: ass or tits? [Re: Guitarpro1313]
    #5857347 - 07/14/06 08:40 AM (17 years, 6 months ago)

definately love a great ass....titties are dope, but its not that often you get that perfect onion booty.


word.


--------------------


Extras: Filter Print Post Top
Offlineunbeliever
Yo Daddy!
 User Gallery
Registered: 05/22/04
Posts: 5,158
Loc: Gallifrey
Last seen: 14 years, 10 months
Re: ass or tits? [Re: Guitarpro1313]
    #5857350 - 07/14/06 08:40 AM (17 years, 6 months ago)

Big or small, proportion and shape are key.. and that applies to T & A both. It's impossible to say that one likes all tits over all asses or whatever. Like the best feature of whichever person you're looking at. Duh. :P


--------------------
Happiness is a warm gun...


Extras: Filter Print Post Top
Offlineflibius
Stranger
Registered: 07/11/06
Posts: 101
Last seen: 11 years, 10 months
Re: ass or tits? [Re: Acidic_Sloth]
    #5857353 - 07/14/06 08:41 AM (17 years, 6 months ago)

tits, natural perky tits!


Extras: Filter Print Post Top
Invisiblegema
Freedom from the Known

Registered: 10/24/04
Posts: 1,767
Loc: t(here)
Re: ass or tits? [Re: AliceDee]
    #5857389 - 07/14/06 08:54 AM (17 years, 6 months ago)

Quote:

AliceDee said:
two words.. VIDA GUERRA




Extras: Filter Print Post Top
OfflineAzen
Legalize ALL!
Male

Registered: 10/04/05
Posts: 309
Loc: Seattle, Wa
Last seen: 10 years, 4 months
Re: ass or tits? [Re: Guitarpro1313]
    #5857420 - 07/14/06 09:09 AM (17 years, 6 months ago)

Definitely ass.  Tits can be fixed with the right doctor :smile:.  The second thing I look at on a lady is her ass after her face of course.

Azen


Extras: Filter Print Post Top
Offlinegrphish
the Modern dayPacman

Registered: 04/01/02
Posts: 1,687
Last seen: 9 years, 2 months
Re: ass or tits? [Re: gema]
    #5857423 - 07/14/06 09:10 AM (17 years, 6 months ago)

not enough pictures of finely shaped asses and tits
and we need amature stuff we've seen enough of the pro-model pornstars they're getting old


--------------------
BoUnCy BaLL IS All SoUrCe OF LIGhT AnD HaPPiNeSS!!~! *bEEP* *beEP*


Extras: Filter Print Post Top
InvisibleLegend
RIP Sasha
Male


Registered: 03/29/10
Posts: 28,336
Loc: TX Flag
Re: ass or tits? [Re: eric_the_red]
    #13075235 - 08/19/10 06:08 PM (13 years, 5 months ago)

ass


--------------------
No sympathy for the devil, keep that in mind.
[url=
]Buy the ticket, take the ride. [/url]
Are you lost?


Extras: Filter Print Post Top
Offlinetwighead
mͯó
I'm a teapot


Registered: 08/27/08
Posts: 29,556
Loc: Glenn Gould's Fuck Windmill Flag
Last seen: 4 hours, 37 minutes
Re: ass or tits? [Re: Legend] * 1
    #13075343 - 08/19/10 06:32 PM (13 years, 5 months ago)

Anus, specifically


--------------------
¿Check out some art m8?



Extras: Filter Print Post Top
OfflineFrost
Inside a locked room
Male User Gallery

Registered: 02/24/07
Posts: 5,947
Loc: Florida Flag
Last seen: 8 years, 7 months
Re: ass or tits? [Re: twighead]
    #13075675 - 08/19/10 07:53 PM (13 years, 5 months ago)

Booty, no question



--------------------
“I have lived on the lip of insanity, wanting to know reasons, knocking on a door. It opens.
I've been knocking from the inside.” - Rumi

“The nitrogen in our DNA, the calcium in our teeth, the iron in our blood, the carbon in our apple pies were made in the interiors of collapsing stars. We are made of starstuff.” - Carl Sagan


Extras: Filter Print Post Top
Invisibleninja cat 09
A paranoid android
Male User Gallery


Registered: 10/11/09
Posts: 4,170
Loc: Mexico Flag
Re: ass or tits? [Re: Frost]
    #13075727 - 08/19/10 08:07 PM (13 years, 5 months ago)

:oldthread:


--------------------
             :crazykitty:


Extras: Filter Print Post Top
InvisibleAcidic_SlothM
Acidic poly-Sided Di-slothamide
 User Gallery

Registered: 05/29/02
Posts: 43,732
Loc: ainrofilac Flag
Re: ass or tits? [Re: Frost]
    #13075742 - 08/19/10 08:09 PM (13 years, 5 months ago)

Quote:

Frost said:
Booty, no question







both.

the bitch in the striped bikini definitely has both, too.


--------------------
-- Accept my heart warming gift of TREE SCRATCHIES!!! I absolve thee!! --

JaP: 30,000 lines of gay, cock, and fag can't be wrong
Ped: only in #shroomery is "smuggle opium in her ass" followed by "i don't want shitty opium" which is followed by " *** Joins: PENISSQUAD"
--
JaP: What would this place be without random sluts?
JaP: Nothing, I tell you.


:heart: :todcasil: :heart:


Extras: Filter Print Post Top
Offlinex Ju x
Aubergine Of The Sun
Male


Registered: 10/07/08
Posts: 6,511
Loc: Shpongleland, Canada Flag
Last seen: 2 years, 11 months
Re: ass or tits? [Re: Acidic_Sloth]
    #13075746 - 08/19/10 08:09 PM (13 years, 5 months ago)

I'm an ass man :thumbup:


--------------------


Extras: Filter Print Post Top
InvisibleAcidic_SlothM
Acidic poly-Sided Di-slothamide
 User Gallery

Registered: 05/29/02
Posts: 43,732
Loc: ainrofilac Flag
Re: ass or tits? [Re: x Ju x]
    #13075755 - 08/19/10 08:10 PM (13 years, 5 months ago)

okok, i'll concede ... ass over tits. but i love both.


--------------------
-- Accept my heart warming gift of TREE SCRATCHIES!!! I absolve thee!! --

JaP: 30,000 lines of gay, cock, and fag can't be wrong
Ped: only in #shroomery is "smuggle opium in her ass" followed by "i don't want shitty opium" which is followed by " *** Joins: PENISSQUAD"
--
JaP: What would this place be without random sluts?
JaP: Nothing, I tell you.


:heart: :todcasil: :heart:


Extras: Filter Print Post Top
Offlineusefulidiot13
Dark Passenger
Male User Gallery


Registered: 05/22/07
Posts: 11,583
Loc: Death From Above
Last seen: 11 years, 7 months
Re: ass or tits? [Re: Acidic_Sloth]
    #13075762 - 08/19/10 08:12 PM (13 years, 5 months ago)

asss for sure.


--------------------
What Would Dexter Do?


Extras: Filter Print Post Top
InvisibleLegend
RIP Sasha
Male


Registered: 03/29/10
Posts: 28,336
Loc: TX Flag
Re: ass or tits? [Re: usefulidiot13]
    #13076145 - 08/19/10 09:54 PM (13 years, 5 months ago)

fuck tits unless your hugging or sleeping.
as long as i gotta good ass im good.


--------------------
No sympathy for the devil, keep that in mind.
[url=
]Buy the ticket, take the ride. [/url]
Are you lost?


Extras: Filter Print Post Top
OfflineFrost
Inside a locked room
Male User Gallery

Registered: 02/24/07
Posts: 5,947
Loc: Florida Flag
Last seen: 8 years, 7 months
Re: ass or tits? [Re: Acidic_Sloth]
    #13076210 - 08/19/10 10:09 PM (13 years, 5 months ago)

Quote:

Acidic_Sloth said:
Quote:

Frost said:
Booty, no question







both.

the bitch in the striped bikini definitely has both, too.




Why she gotta be a bitch? :awesome:


--------------------
“I have lived on the lip of insanity, wanting to know reasons, knocking on a door. It opens.
I've been knocking from the inside.” - Rumi

“The nitrogen in our DNA, the calcium in our teeth, the iron in our blood, the carbon in our apple pies were made in the interiors of collapsing stars. We are made of starstuff.” - Carl Sagan


Extras: Filter Print Post Top
InvisibleLegend
RIP Sasha
Male


Registered: 03/29/10
Posts: 28,336
Loc: TX Flag
Re: ass or tits? [Re: Frost]
    #13076214 - 08/19/10 10:10 PM (13 years, 5 months ago)

they all bitch's :vaped:


--------------------
No sympathy for the devil, keep that in mind.
[url=
]Buy the ticket, take the ride. [/url]
Are you lost?


Extras: Filter Print Post Top
OfflineAll We Perceive
Sea Cucumber
Male


Registered: 09/24/07
Posts: 10,491
Last seen: 7 months, 4 days
Re: ass or tits? [Re: Guitarpro1313]
    #13076343 - 08/19/10 10:39 PM (13 years, 5 months ago)

Ass.  Gives you something to grab onto when doing doggie style.  Plus, when you slap it, it jiggles in an enticing sexy manner.  Win win.  :awehigh:


--------------------


"plus they atually think jambands are good or sumthing, so they clearly know absolutely nothing about music, clearly lol" -Bassfreak


Extras: Filter Print Post Top
Offlinetha_doctor
student of the Plant Teachers
Male User Gallery


Registered: 10/24/09
Posts: 1,346
Loc: Melbourne
Last seen: 13 years, 14 days
Re: ass or tits? [Re: All We Perceive]
    #13076387 - 08/19/10 10:48 PM (13 years, 5 months ago)

True that:awesome:

Arses:headbanger:


Extras: Filter Print Post Top
OfflineThe Boat
Stoner with a boner


Registered: 02/20/10
Posts: 1,173
Last seen: 10 years, 11 months
Re: ass or tits? [Re: tha_doctor]
    #13076438 - 08/19/10 11:00 PM (13 years, 5 months ago)

Tits just for fun and messing around. Ass is for business time.
:tarantino:


--------------------


01:21:35 ‹Enlil› I know how to handle the cock


Extras: Filter Print Post Top
Offlinekirilan
dued
Female User Gallery

Registered: 03/08/10
Posts: 3,791
Loc: Flag
Last seen: 4 years, 15 days
Re: ass or tits? [Re: Frost]
    #13076567 - 08/19/10 11:32 PM (13 years, 5 months ago)

Quote:

Frost said:
Booty, no question






Tits.
But she has one nice ass.


--------------------
"The beauty of a living thing is not the atoms that go into it, but the way those atoms are put together"
Carl Sagan
:heart:


Extras: Filter Print Post Top
Invisibletiny_rabid_birds
Nocturnal
 User Gallery


Registered: 11/08/05
Posts: 15,653
Loc: estados unidos Flag
Re: ass or tits? [Re: kirilan]
    #13076573 - 08/19/10 11:34 PM (13 years, 5 months ago)

ass.  no question about it.  a nice ass has mind-numbing capabilities on me.  it induces a state on non-functionality on my brain zone.


--------------------


Extras: Filter Print Post Top
Invisibleeveryman
The Rza-rector
Male


Registered: 07/01/10
Posts: 386
Re: ass or tits? [Re: tiny_rabid_birds]
    #13076606 - 08/19/10 11:41 PM (13 years, 5 months ago)

Ass


--------------------


Extras: Filter Print Post Top
Offlineteaparty
Don'tHaveaCowMan
 User Gallery


Registered: 12/03/07
Posts: 671
Loc: The Steele City
Last seen: 11 years, 1 month
Re: ass or tits? [Re: Guitarpro1313]
    #13076658 - 08/19/10 11:59 PM (13 years, 5 months ago)

mmmm...ass  :awesomenod:


--------------------
I'm so ahead of my time, my parents haven't met yet.


Extras: Filter Print Post Top
InvisibleLegend
RIP Sasha
Male


Registered: 03/29/10
Posts: 28,336
Loc: TX Flag
Re: ass or tits? [Re: teaparty]
    #13076773 - 08/20/10 12:47 AM (13 years, 5 months ago)

what about pussy?
ass tits or pussy


--------------------
No sympathy for the devil, keep that in mind.
[url=
]Buy the ticket, take the ride. [/url]
Are you lost?


Extras: Filter Print Post Top
Invisibleninja cat 09
A paranoid android
Male User Gallery


Registered: 10/11/09
Posts: 4,170
Loc: Mexico Flag
Re: ass or tits? [Re: Legend]
    #13079574 - 08/20/10 04:46 PM (13 years, 5 months ago)

Pussy if tight.


--------------------
             :crazykitty:


Extras: Filter Print Post Top
OfflineThe24HourMC
Master Of Ceremonies
Male User Gallery


Registered: 10/16/09
Posts: 7,704
Loc: Gone
Last seen: 8 years, 11 months
Re: ass or tits? [Re: ninja cat 09]
    #13079593 - 08/20/10 04:50 PM (13 years, 5 months ago)

it totally depends on the woman. She might have something to match with the highlighted part of her body but the rest dont fit together correctly and it just looks odd. If I absolutely had to choose though it would be ass without question.


--------------------


My Baby In MCLA


Fuckin Shit

Fuck that stay high


Extras: Filter Print Post Top
InvisibleNiffla
Male User Gallery

Registered: 06/09/08
Posts: 46,484
Loc: Texas
Re: ass or tits? [Re: The24HourMC]
    #13079594 - 08/20/10 04:51 PM (13 years, 5 months ago)

Both.


--------------------


HAIL OUR NEW OTD KING


Extras: Filter Print Post Top
OfflineLearyfanS
It's the psychedelic movement!
Male User Gallery


Registered: 04/20/01
Posts: 34,086
Loc: High pride!
Last seen: 2 hours, 5 minutes
Re: ass or tits? [Re: Guitarpro1313]
    #13079601 - 08/20/10 04:52 PM (13 years, 5 months ago)

Ass man.  I like a small ass. 











--------------------
--------------------------------


Mp3 of the month:  The Apple-Glass Cyndrome - Someday



Extras: Filter Print Post Top
InvisibleBiG_StroOnZ
Male User Gallery


Registered: 04/19/06
Posts: 3,323
Re: ass or tits? [Re: Learyfan]
    #13079674 - 08/20/10 05:12 PM (13 years, 5 months ago)

ass


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8  [ show all ]

Shop: PhytoExtractum Maeng Da Thai Kratom Leaf Powder   Kraken Kratom Red Vein Kratom


Similar ThreadsPosterViewsRepliesLast post
* Lets see the TITS(and tats)!
( 1 2 all )
40oz 4,892 37 08/14/04 12:21 PM
by KAR0LiNAXXXX
* I swear my ass (butt) plays jokes on me
( 1 2 all )
Cracked Egg 837 27 05/05/21 06:52 AM
by christopera
* ASS HAIR
( 1 2 all )
Pumpkin_Blythe 3,844 25 08/13/04 03:08 PM
by luckytriple6
* 6666 posts...is that like Super Devil? YouEnjoyMyself 1,056 18 08/25/04 03:27 AM
by MOTH
* bb in hand RespectTheFungus 876 9 11/07/03 06:41 AM
by Anonymous
* The Devil funkymonk 859 4 03/13/03 03:32 AM
by funkymonk
* lets see some tits and tats
( 1 2 all )
beejay 3,479 35 10/22/04 03:09 AM
by TODAY
* who camed and saved your ass in WW2
( 1 2 3 4 all )
shriek 8,156 69 07/19/04 09:52 PM
by chinadoll

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Entire Staff
13,376 topic views. 3 members, 63 guests and 67 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.076 seconds spending 0.013 seconds on 14 queries.