|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Quoiyaien
><<<<0>>>><


Registered: 06/08/04
Posts: 1,409
Last seen: 3 years, 1 month
|
One Psychedelic
#5316310 - 02/19/06 12:18 PM (17 years, 11 months ago) |
|
|
Hi, if you could pick only one psychedlic to do for the rest of your life, what would it be? Any why?
Peace
|
donkey2
Stranger

Registered: 02/03/06
Posts: 54
Loc: Northeast
Last seen: 17 years, 7 months
|
Re: One Psychedelic [Re: Quoiyaien]
#5316369 - 02/19/06 12:38 PM (17 years, 11 months ago) |
|
|
LSD, its the greatest all around drug discovered yet :]
-------------------- Peace and Happiness to all.
|
Trippy_Search
I'm trippin' man

Registered: 12/09/05
Posts: 201
Loc: TX
Last seen: 17 years, 3 months
|
Re: One Psychedelic [Re: donkey2]
#5316376 - 02/19/06 12:39 PM (17 years, 11 months ago) |
|
|
--------------------

|
TMonk
PsychadelicStudent


Registered: 01/25/05
Posts: 127
Loc: Humboldt State University
Last seen: 16 years, 1 month
|
Re: One Psychedelic [Re: donkey2]
#5316384 - 02/19/06 12:42 PM (17 years, 11 months ago) |
|
|
Mescaline.
I would choose LSD just because of it's versatility and awesome potential, but I can see an LSD experience as being too stressful when I get older.
One day when I am an older man with a family and a place, I'm going to have a modes cacti garden somewhere in my yard. Once, maybe twice a year I'll cut down a stock and prepare some tea without really telling anybody about it
-------------------- "Let me tell some one about this dream: The sky was filled with stars, while the sun, kissed the mountains blue. And eleven moons ran across the rainbows above me and you..." -One Rainy Wish
|
keefboy
a friendly parkranger
Registered: 10/29/05
Posts: 535
Last seen: 9 years, 19 days
|
Re: One Psychedelic [Re: TMonk]
#5316418 - 02/19/06 12:54 PM (17 years, 11 months ago) |
|
|
mushrooms.
no contest.
but i'm really glad i dont have to choose. i would hate giving up lsd or weed forever.
-------------------- "A friend of mine was famous for holding his hits until his face swelled up and turned bright red. The veins in his neck and forehead would bulge and he'd get bug-eyed. He'd start sweating. Then he'd belch the hit out violently, along with plenty of spit, and gasp for air." ~UBAKO
|
giz
daydreamer


Registered: 02/08/06
Posts: 651
Loc: EU
|
Re: One Psychedelic [Re: keefboy]
#5316421 - 02/19/06 12:56 PM (17 years, 11 months ago) |
|
|
That would be mushroom for me as well.
|
gdman
badger, badger,badger...


Registered: 12/10/02
Posts: 16,286
Loc: Dancing In the Streets
|
Re: One Psychedelic [Re: keefboy]
#5316423 - 02/19/06 12:56 PM (17 years, 11 months ago) |
|
|
acid
--------------------
Got a question about a substance? Erowid might already have your answer! Have questions about the mushroom experience? The Tripper's FAQ may have your answer or someone else might have had your question before. I know up on the top you are seeing great sights, but down at the bottom we, too, should have rights. - Theodor Seuss Geisel Dr. Suess "I didn't come here to be easily understood" - Steve
|
mecreateme
YoUisMEEMsiUoY


Registered: 05/13/04
Posts: 2,727
Loc: Memphrica
|
Re: One Psychedelic [Re: Quoiyaien]
#5316433 - 02/19/06 01:03 PM (17 years, 11 months ago) |
|
|
Gotta be acid.
I mean hell if you wanna chip, just bite off a little. LSD has got to be my supreme pizza.
-------------------- No ONE wants to know the ultimate TRUTH, as soon as YOU find IT out, YOU want to forget IT. You are everything's way of feeling itself. Happy Schwag, everygodly!
|
didjin_d
mmm....


Registered: 11/02/04
Posts: 662
Loc: PNW
Last seen: 3 years, 7 months
|
Re: One Psychedelic [Re: mecreateme]
#5316478 - 02/19/06 01:32 PM (17 years, 11 months ago) |
|
|
I would choose marijuana ...it is classified as a psychadelic. The reason for my choice:
Mushrooms/LSD/Tryptamines/etc... can be a bit too taxing on the brain. I have done my fair share of strong hallucinogens, and now I have a pretty low tolerance.
-DD
Hey GIZ! I see the datura in your avatar..ever try it?
-------------------- " learning how to cook will save you money, usually make you healthier, and occasionally get you laid. " -Shags420 "Most of the people who ask the question 'Do any psilocybin mushrooms grow around here?' would rather change their way of looking at reality rather than face the difficult and discouraging task of transforming reality itself" -David Aurora, Mushrooms Demystified
|
kaniz
That one, overthere.


Registered: 07/23/04
Posts: 4,166
Loc: Ontario
|
Re: One Psychedelic [Re: didjin_d]
#5316524 - 02/19/06 01:53 PM (17 years, 11 months ago) |
|
|
To many that I havnt tried yet to want to limit myself to just one :P
|
MOTH
Wild Woman


Registered: 06/06/03
Posts: 23,431
Loc: In the jungle
|
|
Quote:
Trippy_Search said:
|
SouthPArk
C'est La Vie


Registered: 05/11/05
Posts: 740
Loc: SouthPArk
Last seen: 11 years, 5 months
|
Re: One Psychedelic [Re: MOTH]
#5316562 - 02/19/06 02:08 PM (17 years, 11 months ago) |
|
|
How About Favorite Psychedelic and Drink? 
--------------------
Live as if you were to die tomorrow. Learn as if you were to live forever.
|
chuck_lanuck
More Strange


Registered: 01/16/06
Posts: 70
Last seen: 17 years, 8 months
|
Re: One Psychedelic [Re: SouthPArk]
#5316682 - 02/19/06 02:41 PM (17 years, 11 months ago) |
|
|
shrooms for sure, they never get old, as long as you space apart your trips.
-------------------- We're all mad here.
|
drSE
Pseudo Reality



Registered: 12/19/03
Posts: 4,432
Loc: Twighlight Zone
|
|
Sounds like acid is the majority vote. I also choose LSD, now if only i could get it easier, heh. acid is only too much fun, except for the back pain.
--------------------
Grow Room
|
Penguarky Tunguin
f n o r d

Registered: 08/08/04
Posts: 17,192
|
Re: One Psychedelic [Re: Quoiyaien]
#5316732 - 02/19/06 02:56 PM (17 years, 11 months ago) |
|
|
Mushrooms. Easy answer. A year ago I would have said marijuana, but I'm starting to get the paranoia now, which I never thought I would.
With mushrooms, I blast right past the paranoia.
-------------------- Every mistake, intentional or otherwise, in the above post, is the fault of the reader.
|
Chikitta
Registered: 03/12/05
Posts: 632
|
Re: One Psychedelic [Re: kaniz]
#5316957 - 02/19/06 04:07 PM (17 years, 11 months ago) |
|
|
Quote:
kaniz said: To many that I havnt tried yet to want to limit myself to just one :P
|
keefboy
a friendly parkranger
Registered: 10/29/05
Posts: 535
Last seen: 9 years, 19 days
|
|
ya i love that about the s. super low paranoia compared to weed.
-------------------- "A friend of mine was famous for holding his hits until his face swelled up and turned bright red. The veins in his neck and forehead would bulge and he'd get bug-eyed. He'd start sweating. Then he'd belch the hit out violently, along with plenty of spit, and gasp for air." ~UBAKO
|
thedudenj
Man of the Woods

Registered: 08/18/04
Posts: 14,684
|
Re: One Psychedelic [Re: keefboy]
#5317241 - 02/19/06 05:57 PM (17 years, 11 months ago) |
|
|
DMT smoked and huasca cause you could trip for a month straight with out it lossing intensity
--------------------
  "You all are just puppets... You have no heart...and cannot feel any pain..."" you may think thats pain you feel but you must have a heart to feel true pain and that pain wont be yours
|
Konnrade
↑↑↓↓<--><-->BA



Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 8 months, 26 days
|
Re: One Psychedelic [Re: thedudenj]
#5317255 - 02/19/06 06:03 PM (17 years, 11 months ago) |
|
|
Quote:
thedudenj said: DMT smoked and huasca cause you could trip for a month straight with out it lossing intensity
Wouldn't that make it hard to, you know, have an actual life?
I'd have to go for mescaline if I had to settle for just one psychedellic for the rest of my life. It's just so damn great.
--------------------
I find your lack of faith disturbing
|
psychonaut_420
psychonaut

Registered: 02/13/06
Posts: 285
Loc: mid atlantic
Last seen: 16 years, 10 months
|
Re: One Psychedelic [Re: Konnrade]
#5317271 - 02/19/06 06:08 PM (17 years, 11 months ago) |
|
|
shrooms
because they make everything fun
--------------------
"Life sucks, Shit happens, Smoke weed and forget about it"
|
UncleTank
Hitting Headies

Registered: 11/26/05
Posts: 34
Last seen: 16 years, 9 months
|
|
I haven't done LSD before so I can't speak for that, but I sure do love my shroomies. They are just so much fun
-------------------- "Prohibition will work great injury to the cause of temperance. It is a species of intemperance within itself, for it goes beyond the bounds of reason in that it attempts to control a man's appetite by legislation, and makes a crime out of things that are not crimes. A Prohibition law strikes a blow at the very principles upon which our government was founded." -- Abraham Lincoln, 1840.
Edited by UncleTank (02/19/06 06:37 PM)
|
Quoiyaien
><<<<0>>>><


Registered: 06/08/04
Posts: 1,409
Last seen: 3 years, 1 month
|
|
Cool 
Thanks for the replies so far.
I would have to say Shrooms. I dont like having to go through dealers, and they are so easy to grow. Plus availability is decided by me 
Then theres the actual trip:






Peace

Edited by Quoiyaien (02/19/06 06:59 PM)
|
kija
Stranger


Registered: 12/12/05
Posts: 557
|
|
DMT the place to be!
-------------------- Am I breathing up or down? says the speaking fictional character.
|
Help on the Way
Slipknot420

Registered: 08/12/00
Posts: 2,893
Loc: Another World
|
Re: One Psychedelic [Re: kija]
#5317730 - 02/19/06 08:34 PM (17 years, 11 months ago) |
|
|
DMT!
nothing else has ever taken me that far
--------------------
*Divine Moments of Truth* "Limitless undying love which shines around me like a million suns - it calls me on and on across the universe" ~ John Lennon "Once in a while you get shown the light in the strangest of places if you look at it right" ~The Grateful Dead "Religionists, with their guaranteed eventual paradise, of which they know nothing, taking it all on 'faith,' can't be expected to understand or sympathize with those with a yen to storm the Gate of Heaven and see for themselves what all the praying's about!" ~Robert Hunter
|
drloomis82
Walks with Kings


Registered: 08/15/03
Posts: 260
Loc: Limbo
Last seen: 10 years, 4 months
|
Re: One Psychedelic [Re: Quoiyaien]
#5317905 - 02/19/06 09:08 PM (17 years, 11 months ago) |
|
|
Cannabis -- and, yes, it IS a psychedelic.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: One Psychedelic [Re: drloomis82]
#5318028 - 02/19/06 09:46 PM (17 years, 11 months ago) |
|
|
I'd say DMT if I hadn't done it before. It simply is something I needed to experience in my life. But as far as relying on it as the ONLY one for the rest of my life, I don't think so. Too short, and I haven't tried aya. Smoked DMT is a fantastic journey, but not so insightful for many including myself, just the most fantastic show you'll ever see.
So, I'd have to narrow it down to the classics: Mescaline, LSD, and psilocybin. I'll give those a bit more thought now...
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
stemmer
Stranger


Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
|
|
Id choose lsd or ayahuasca.
Really though, If I had one choice given the fact that I have learned all that I can know about hallucinogens, or what I wanted to know, Id choose Marijuana.
Edited by stemmer (02/19/06 10:19 PM)
|
InTheFlesh714
Drunk

Registered: 10/19/05
Posts: 958
Loc: (714)
Last seen: 9 years, 2 months
|
Re: One Psychedelic [Re: stemmer]
#5318151 - 02/19/06 10:30 PM (17 years, 11 months ago) |
|
|
I have learned so much from marijuana, its just so good. either that or LSD.
|
Mr. Afterglow
An Old Soul


Registered: 09/18/08
Posts: 70
Last seen: 14 years, 7 months
|
Re: One Psychedelic [Re: Quoiyaien]
#9023434 - 10/03/08 12:25 PM (15 years, 3 months ago) |
|
|
I'd have to say mescaline. reason being is that i can function very well on it mentally and physically. the body feelings are amazing and the wisdom is also there.
-------------------- DMT provides regular, repeated, and reliable access to `other' channels. The other planes of existence are always there. . . . But we cannot perceive them because we are not designed to do so; our hard-wiring keeps us tuned in to Channel Normal. It takes only a second or two--the few heartbeats the spirit molecule requires to make its way to the brain--to change the channel, to open our mind to these other planes of existence"-from DMT: the Spirit Molecule by Rick Strassman M.D.
|
Dudeyourgone
Gone...

Registered: 05/06/06
Posts: 1,623
Loc: California
Last seen: 3 years, 2 months
|
|
i need to try mescaline and have little lsd experience and no dmt experience. so i'd say LSD
|
dwtk
it all rolls into one


Registered: 02/24/07
Posts: 4,482
Loc: Franklin's Tower
Last seen: 5 years, 3 months
|
|
Very hard to choose.. but acid 
mesc or mush being a close second
Edited by dwtk (10/03/08 01:01 PM)
|
QuantumReality
Mycopath 🗡


Registered: 05/20/07
Posts: 3,197
Loc: BoobyTraps
|
Re: One Psychedelic [Re: dwtk]
#9023853 - 10/03/08 02:12 PM (15 years, 3 months ago) |
|
|
definately shrooms, purely for the fact that it puts you in a great love state
|
skatealex2
////////////////


Registered: 07/04/08
Posts: 18,699
Last seen: 3 months, 25 days
|
Re: One Psychedelic [Re: dwtk]
#9023857 - 10/03/08 02:13 PM (15 years, 3 months ago) |
|
|
I have only tried acid and I think it's amazing with the right setting. but if I would have to say marijuana by far.
|
PilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 12 years, 9 months
|
Re: One Psychedelic [Re: skatealex2]
#9023884 - 10/03/08 02:18 PM (15 years, 3 months ago) |
|
|
the only psychedelic i havent tried is mescaline. still waiting for a good time to take it. i dont eat a lot of mushrooms anymore, its just been lsd for the past year, so im going to say acid...
awesome trip, easy to conceal, you can take it anywhere.
-------------------- "The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live." If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules...
|
wildchild68
lion in a coma



Registered: 11/19/07
Posts: 5,115
Last seen: 9 years, 8 months
|
Re: One Psychedelic [Re: PilzeEssen]
#9023969 - 10/03/08 02:38 PM (15 years, 3 months ago) |
|
|
Mushrooms for sure.
--------------------
|
QuantumReality
Mycopath 🗡


Registered: 05/20/07
Posts: 3,197
Loc: BoobyTraps
|
Re: One Psychedelic [Re: PilzeEssen]
#9024056 - 10/03/08 02:52 PM (15 years, 3 months ago) |
|
|
Quote:
PilzeEssen said: the only psychedelic i havent tried is mescaline. still waiting for a good time to take it. i dont eat a lot of mushrooms anymore, its just been lsd for the past year, so im going to say acid...
awesome trip, easy to conceal, you can take it anywhere.
So you've tried Harmala, Leonurine and Bufotenine?
|
JacquesCousteau
Being.



Registered: 06/10/03
Posts: 7,825
Loc: Everywhere, Everytime.
Last seen: 1 year, 8 months
|
Re: One Psychedelic [Re: Quoiyaien]
#9024078 - 10/03/08 02:55 PM (15 years, 3 months ago) |
|
|
If I can teach myself to use it respectfully, high grade marijuana would perhaps fill this role.
However, given my history of abuse with it, I am leaning towards mushrooms.
However, I have never experienced Mescaline or DMT, both of which I feel have the potential to dethrone mushrooms as my ideal psychedelic catalyst.
Edited by JacquesCousteau (10/03/08 05:13 PM)
|
plasma
ɹoʇɐɹǝpoɯ


Registered: 09/17/08
Posts: 10,001
|
|
mushrooms hands down, i love lsd but shrooms gives you that spiritual connection that lsd cant
|
redgreenvines
irregular verb


Registered: 04/08/04
Posts: 37,534
|
Re: One Psychedelic [Re: Quoiyaien]
#9024483 - 10/03/08 04:16 PM (15 years, 3 months ago) |
|
|
Mushrooms have more nutrition and a better legal context at least at the spore level. But lsd blotters show up in more dreams for me. I guess that tells something.
--------------------
_ 🧠 _
|
TheBandit
Infidel



Registered: 03/03/08
Posts: 1,655
Last seen: 13 years, 3 months
|
|
one trip to rule them all...
--------------------
[quote]RogerRabbit said: Ah, that explains it. Typical know-it-all noob. We get a few thousand just like you register here every year. They try a few grows, fail miserably and then after a few months or one bad trip, go back to sniffing glue, never to be seen again. We have a basic pf tek that's idiot proof enough for noobs to get fucked up with their friends. Mycologists on the other hand grow for the love of growing. They want to experiment with various species, substrates, and fruiting environments. They'll move on to isolate strains, attempt hybridization, and in general treat cultivation as an artform, rather than a chore that must be performed as a means to an end. They'll work twice as hard for a ten percent gain, just for the love of perfection. These are the ones who will isolate strains, not the dumb fucks who treat mushrooms as a drug, or even worse, a pathogen, as if mushrooms cause disease. RR [/quote]
Edited by TheBandit (10/03/08 04:24 PM)
|
PilzeEssen


Registered: 12/24/07
Posts: 7,312
Loc: USA
Last seen: 12 years, 9 months
|
|
Quote:
Dizzwizzle said:
Quote:
PilzeEssen said: the only psychedelic i havent tried is mescaline. still waiting for a good time to take it. i dont eat a lot of mushrooms anymore, its just been lsd for the past year, so im going to say acid...
awesome trip, easy to conceal, you can take it anywhere.
So you've tried Harmala, Leonurine and Bufotenine?
theres tons that i havent tried. you only named 3. i have no want to try those.
i guess i should have been more specific. ive done everything i want to do except mescaline, and now that i think of it, ayahuasca.
-------------------- "The soul has greater need of the ideal than of the real. It is by the real that we exist, it is by the ideal that we live." If you want to get a hold of me, my email address is in my profile. Just click on my screen name. I got banned from using private messages cause I didn't follow the rules...
|
drummerdude49
Stranger



Registered: 12/16/07
Posts: 156
Loc: stockton, CA
Last seen: 14 years, 3 months
|
Re: One Psychedelic [Re: PilzeEssen]
#9025163 - 10/03/08 06:29 PM (15 years, 3 months ago) |
|
|
lsd.
|
anarKhan
fire-dancing guerilla



Registered: 09/06/08
Posts: 142
Loc: Oregon
|
|
shrooms, mang
-------------------- NOT ALL THOSE WHO WANDER ARE LOST
|
Plasmid
Absent


Registered: 06/01/08
Posts: 1,719
Last seen: 15 years, 25 days
|
Re: One Psychedelic [Re: TheBandit]
#9025470 - 10/03/08 07:32 PM (15 years, 3 months ago) |
|
|
LSD because it lasts long, is easy to enjoy and has a high margin of safety.
|
04281969
Hobbyist



Registered: 08/09/06
Posts: 1,406
|
Re: One Psychedelic [Re: anarKhan]
#9025533 - 10/03/08 07:48 PM (15 years, 3 months ago) |
|
|
LSD is the greatest psychedelic I've ever experienced. It's as vast as the universe, and as deep as your comprehension of it. But, I agree with what TMonk said. Mescaline might be my choice for one to live with forever. It's pretty mellow.
|
g00ru
lit pants tit licker



Registered: 08/09/07
Posts: 21,088
Loc: georgia, us
Last seen: 5 years, 1 month
|
Re: One Psychedelic [Re: 04281969]
#9026137 - 10/03/08 09:50 PM (15 years, 3 months ago) |
|
|
Probably shrooms, because the shorter time span means I don't have to wait for quite such a special circumstance to dose confidently.
I assume weed isn't really part of this decision, but if it is I must regretfully choose weed.
-------------------- check out my music! drowse in prison and your waking will be but loss
|
Quoiyaien
><<<<0>>>><



Registered: 06/08/04
Posts: 1,409
Last seen: 3 years, 1 month
|
Re: One Psychedelic [Re: g00ru]
#9028340 - 10/04/08 12:36 PM (15 years, 3 months ago) |
|
|
Wow, old thread...
To answer my own question with a slightly matured perspective, LSD has been a very powerful ally in my life.
The lucid nature of the experience makes it very well suited to extensive meditation.
|
|