Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Bridgetown Botanicals Bridgetown Botanicals   PhytoExtractum Maeng Da Thai Kratom Leaf Powder   Kraken Kratom Red Vein Kratom   Original Sensible Seeds Autoflowering Cannabis Seeds

Jump to first unread post Pages: 1 | 2  [ show all ]
InvisibleveggieM

Registered: 07/25/04
Posts: 17,504
Woman shows up at police station to buy pot [ND]
    #5290989 - 02/12/06 09:03 AM (17 years, 11 months ago)

Woman shows up at police station with $3 to buy pot :doh:
February 12, 2006 - in-forum.com


Grace Sium, 20

West Fargo Police Officer Ken Zeeb figured it was just a silly college prank when a student phoned the police station looking to score some marijuana.

But the joke was on the student when she actually showed up to buy the pot.

Zeeb arrested 20-year-old Grace Sium of Fargo for criminal attempt and possession of drug paraphernalia at 3:58 a.m. Saturday.

According to Zeeb:

Sium, a junior at North Dakota State University, called the cop shop about 3:15 a.m., wanting to know where she could buy some marijuana.

The dispatcher told her several times that selling and possessing marijuana was illegal.

But Sium insisted, so the dispatcher told her there was marijuana in the evidence locker, and that if she came to the police station he would ?hook her up.?

Zeeb had arrived for his 4 a.m. shift about 15 minutes early and was in the station?s locker room when Sium arrived.

?The dispatcher got on the intercom and said, ?You know what? She?s here. She just handed me $3 for marijuana,? ? Zeeb said.

Zeeb said Sium didn?t appear to be surprised when he arrested her.

?She didn?t seem like she was really under the influence of drugs or alcohol,? he said. ?She understood what was going on and articulated herself well.?

Sium, who is originally from Oakdale, Minn., did not return a phone message left for her Saturday at the Cass County Jail.

Zeeb, a police officer for the past 15 years, said he worked narcotics for 7? years and has arrested people for trying to buy drugs at a house as it was being searched by police.

But Saturday?s incident was ?about the craziest thing I?ve ever come across,? he said.

?This is something that you couldn?t even make up,? he said.


Extras: Filter Print Post Top
Invisibleabrad84
Stranger
Male

Registered: 10/15/05
Posts: 1,128
Re: Woman shows up at police station to buy pot [ND] [Re: veggie]
    #5291007 - 02/12/06 09:19 AM (17 years, 11 months ago)

Sounds like someone dared her to do it.


Extras: Filter Print Post Top
Offlineblaze2
The Witness
Male

Registered: 12/20/02
Posts: 1,883
Loc: San Antonio, TX
Last seen: 11 years, 6 months
Re: Woman shows up at police station to buy pot [ND] [Re: abrad84]
    #5291122 - 02/12/06 10:32 AM (17 years, 11 months ago)

yup dare.


--------------------
"Religion without science is blind, Science without religion is lame." Albert Einstein

"peace is not maintained through force it is acheived through intelligence." Albert Einstein

"Those who desire to give up Freedom in order to gain Security, will not have, nor do they deserve, either one."
Thomas Jefferson

"To compel a man to furnish contributions of money for the propagation of opinions which he disbelieves and abhors, is sinful and tyrannical." --Thomas Jefferson


Extras: Filter Print Post Top
OfflineLegoulash
Stranger
 User Gallery
Registered: 09/07/02
Posts: 4,347
Last seen: 12 years, 7 months
Re: Woman shows up at police station to buy pot [ND] [Re: blaze2]
    #5291146 - 02/12/06 10:51 AM (17 years, 11 months ago)

Or she just smuggled a quatch of crack to her boyfriend.


Extras: Filter Print Post Top
OfflineMicrocosmatrix
Spiral staircasetechnician
Male

Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 1 month
Re: Woman shows up at police station to buy pot [ND] [Re: veggie]
    #5291277 - 02/12/06 12:13 PM (17 years, 11 months ago)

What the fuck did she think she was going to get for 3 dollars anyway?


--------------------
:orly:



Extras: Filter Print Post Top
Offline_SE
Pseudo Reality
Male

Registered: 01/30/06
Posts: 33
Loc: Twighlight Zone
Last seen: 1 year, 10 months
Re: Woman shows up at police station to buy pot [ND] [Re: Microcosmatrix]
    #5291302 - 02/12/06 12:24 PM (17 years, 11 months ago)

People these days, i hope it was a dare, or a way to smuggle drugs into the jail, because if not. Then she should have never enrolled in college because i don't think i see her graduating anything with brains her size


--------------------
~SE


Extras: Filter Print Post Top
OfflineWysefool
I AM SKELETON JELLY
Male User Gallery
Registered: 12/26/02
Posts: 6,643
Last seen: 5 months, 26 days
Re: Woman shows up at police station to buy pot [ND] [Re: veggie]
    #5291815 - 02/12/06 03:31 PM (17 years, 11 months ago)

Definitely a dare or something she wanted to try just to be eccentric. Maybe she thought the officer would let her off, probably why she only offered $3, to make it clear she wasn't serious.


--------------------
]


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Woman shows up at police station to buy pot [ND] [Re: Wysefool]
    #5292073 - 02/12/06 05:15 PM (17 years, 11 months ago)

Some sort of dare/bullshit initiation thing?


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineRemainRandom50
Do You Need ToKnow Me?
Registered: 01/15/06
Posts: 1,695
Last seen: 14 years, 9 months
Re: Woman shows up at police station to buy pot [ND] [Re: Koala Koolio]
    #5294041 - 02/13/06 08:46 AM (17 years, 11 months ago)

sounds like shes a fucking moron. and looks like a piece of shit hahahaha


--------------------
At times I get consumed by my everyday life and will leave the Shroomery. Yet, every time drugs come falling into my life for fun.....I always think about the Shroomery and then I'm back!


Extras: Filter Print Post Top
OfflineShroomer215
Consumer ofshrooms

Registered: 02/06/06
Posts: 64
Loc: In your Mind.
Last seen: 16 years, 1 month
Re: Woman shows up at police station to buy pot [ND] [Re: RemainRandom50]
    #5294230 - 02/13/06 10:15 AM (17 years, 11 months ago)

wow she is as dumb as they get... shes proble pleaging for a Soratiy(if thats how you spell is)


Extras: Filter Print Post Top
Offline_SE
Pseudo Reality
Male

Registered: 01/30/06
Posts: 33
Loc: Twighlight Zone
Last seen: 1 year, 10 months
Re: Woman shows up at police station to buy pot [ND] [Re: Shroomer215]
    #5304453 - 02/15/06 07:44 PM (17 years, 11 months ago)

stupid is as stupid does


--------------------
~SE


Extras: Filter Print Post Top
OfflineMadtowntripper
Sun-Beams out of Cucumbers
 User Gallery

Registered: 03/06/03
Posts: 21,287
Loc: The Ocean of Notions
Last seen: 5 months, 23 days
Re: Woman shows up at police station to buy pot [ND] [Re: Shroomer215]
    #5306012 - 02/16/06 09:09 AM (17 years, 11 months ago)

Quote:

Shroomer215 said:
wow she is as dumb as they get... shes proble pleaging for a Soratiy(if thats how you spell is)




I think that deserves a "Most Creative Spelling of the Year" award.


--------------------
After one comes, through contact with it's administrators, no longer to cherish greatly the law as a remedy in abuses, then the bottle becomes a sovereign means of direct action.  If you cannot throw it at least you can always drink out of it.  - Ernest Hemingway

If it is life that you feel you are missing I can tell you where to find it.  In the law courts, in business, in government.  There is nothing occurring in the streets. Nothing but a dumbshow composed of the helpless and the impotent.    -Cormac MacCarthy

He who learns must suffer. And even in our sleep pain that cannot forget falls drop by drop upon the heart, and in our own despair, against our will, comes wisdom to us by the awful grace of God.  - Aeschylus


Extras: Filter Print Post Top
InvisibleStonerguy
I smoke penis
Male

Registered: 05/29/04
Posts: 5,538
Loc: Lost
Re: Woman shows up at police station to buy pot [ND] [Re: Madtowntripper]
    #5307432 - 02/16/06 03:14 PM (17 years, 11 months ago)

I think that is pronounced sor-ro-tie


--------------------
yawn...
SG


Extras: Filter Print Post Top
OfflineWhiteBunny
How deep doesthe rabbit hole go?
 User Gallery

Registered: 07/29/05
Posts: 1,351
Loc: Earth
Last seen: 15 years, 4 months
Re: Woman shows up at police station to buy pot [ND] [Re: Shroomer215]
    #5307930 - 02/16/06 05:29 PM (17 years, 11 months ago)

Quote:

Shroomer215 said:
wow she is as dumb as they get... shes proble pleaging for a Soratiy(if thats how you spell is)




wow I am a really bad spellinhg but that takes the cake. The I followed by the y hmmm. Don't feel bad bud I think we all have those days.


WB


--------------------


Extras: Filter Print Post Top
Offlinedollface123
Doll Face
Female
Registered: 06/09/23
Posts: 3
Loc: USA
Last seen: 7 months, 16 days
Re: Woman shows up at police station to buy pot [ND] [Re: veggie]
    #28352956 - 06/09/23 07:21 AM (7 months, 16 days ago)

First of all she's not stupid she's as smart as me. And I'm fucking genius. Second of all she's bipolar and she wasn't taking her meds. This is true to the factor.. The most detailed factor because I know the girl in person. Third of all bipolar people can get out of their minds without their medication. 4th of all not taking your medication when you're bipolar makes you seem stupid or look stupid but you're not really stupid you're actually smart and she did go in buying trying to buy $3 worth of weed cuz she's always been a pothead but who cares if you're a pot head or not. Plus why would she not go to the police station they're the ones that take all the weed away from people or they used to at least until it became legalized. And 5th of all to the person who is asking if this is from a sorority or not Buddy learn how to fucking spell before you call somebody stupid and then you can't even spell yourself dude You're fucking retarded shut the fuck up and shut your front door and stay out of people's business if you're going to not know how to spell maybe you shouldn't be on this platform and if you all are going to judge somebody judge yourselves and look in the fucking mirror you fucking retards. And I can say that cuz I'm bipolar myself. Also I'm a fucking genius. I sense things that nobody else senses. And I've been able to prove it with scientific research so you can fuck off all of you. Stop judging my friend and leave her the fuck alone. The cops obviously wanted some attention so they posted this.  thinking it's hilarious. What if it was about you would you like that on here??... Think about others before you think about yourselves. And when you do think about yourselves look in the fucking mirror before you think about judging somebody else.. and their reactions to something. When you don't know the full fucking factors or truths. Piss off. Have a nice day God bless . Not. Who here has not done something stupid in their lifetimes This is the poll that I'm asking you to answer If you have not done something stupid in your lifetime you're a liar. Or you're pretty and perfect like you think you are but you might not be might be lying. Let's see who thinks they're perfect who thinks they're perfect and who thinks that they haven't done something stupid in their younger years or in their lifetimes That's the poll I'm asking you guys to take.. let's see who answers correctly.


Extras: Filter Print Post Top
Offlinedollface123
Doll Face
Female
Registered: 06/09/23
Posts: 3
Loc: USA
Last seen: 7 months, 16 days
Re: Woman shows up at police station to buy pot [ND] [Re: Shroomer215]
    #28352965 - 06/09/23 07:28 AM (7 months, 16 days ago)

First of all it says wow this is dumb as it gets. I hope she was pledging for a sorority or something... Buddy that's how you spell all that Just letting you know. Or chick or whoever you the fuck you are. Second of all shut the fuck up. When have you not done something dumb in your lifetime??... When have any of you not done something stupid when you were younger or something??... Can any one of you say that you haven't done something stupid in your lifetime???... Can anyone of you say that you're perfect??.... I thought so. Now shut the fuck up and sit the fuck down. Before you get me even more mad and I'm scary when I'm mad. And this is my friend and this has no right to be up. It's the stupidest fucking thing I've ever read. And who cares if it's about weed It's fucking weed dude it's legalized in Minnesota now. This may say Fargo but she's not in Fargo she's in Minnesota.. Minneapolis Minnesota to be exact. So shut the fuck up all of you. All of you are the retarded ones compared to her and me. You guys need to get some schooling or something. She and I already have schooling. And it's not just regular schooling is called college schooling We both been through it even though we've flunked out before we still got the training so you should shut the fuck up before you talk shit because she's smart as shit when she's on her meds she's more normal Yes I understand that part.. when she's not on her meds she's not thinking clearly. But she also went to the cops because who wouldn't go to the cops these days They fucking seize weed all the time. That's probably what she was thinking without being in the right state of mind. So think before you speak about my friend..


Extras: Filter Print Post Top
Offlinedollface123
Doll Face
Female
Registered: 06/09/23
Posts: 3
Loc: USA
Last seen: 7 months, 16 days
Re: Woman shows up at police station to buy pot [ND] [Re: _SE]
    #28352968 - 06/09/23 07:31 AM (7 months, 16 days ago)

And I wonder what your brain size is??... You obviously have no idea who you're judging right now. So maybe you should shut the fuck up. You fucking moron. Learn to read a book instead of judging people online that you don't even know that are probably smarter than you are. Learn to be more aware. And no it wasn't a dare. Everybody. For fuck's sake. Leave this woman alone.


Extras: Filter Print Post Top
OfflinePBJ710
Strangler

Folding@home Statistics
Registered: 07/05/19
Posts: 2,623
Last seen: 18 days, 19 hours
Re: Woman shows up at police station to buy pot [ND] [Re: dollface123] * 1
    #28352971 - 06/09/23 07:36 AM (7 months, 16 days ago)

It sounds like you both have mental issues.


Extras: Filter Print Post Top
OfflinetheRealrollforever
I DID-DENT
 User Gallery


Registered: 08/31/13
Posts: 12,736
Loc: Bada-Bing!
Last seen: 2 days, 11 hours
Re: Woman shows up at police station to buy pot [ND] [Re: dollface123]
    #28353069 - 06/09/23 09:57 AM (7 months, 16 days ago)

Quote:

dollface123 said:
And I wonder what your brain size is??... You obviously have no idea who you're judging right now. So maybe you should shut the fuck up. You fucking moron. Learn to read a book instead of judging people online that you don't even know that are probably smarter than you are. Learn to be more aware. And no it wasn't a dare. Everybody. For fuck's sake. Leave this woman alone.



You must have been at the top of your fuckin' class.


--------------------


sunshine said:
The order has to be secret and no one is sure.


Extras: Filter Print Post Top
Invisibledurian_2008
Cornucopian Eating an Elephant
 User Gallery


Registered: 04/02/08
Posts: 16,685
Loc: Raccoon City
Re: Woman shows up at police station to buy pot [ND] [Re: theRealrollforever]
    #28353150 - 06/09/23 11:08 AM (7 months, 16 days ago)

There were undercover dealers at the university. She just called the wrong extension. :nono:


Extras: Filter Print Post Top
InvisibleTheStallionMang
Do U know who yur fuckin with?
Male

Registered: 10/18/17
Posts: 4,531
Loc: Flag
Re: Woman shows up at police station to buy pot [ND] [Re: dollface123]
    #28353188 - 06/09/23 11:43 AM (7 months, 16 days ago)

Quote:

dollface123 said:
First of all it says wow this is dumb as it gets. I hope she was pledging for a sorority or something... Buddy that's how you spell all that Just letting you know. Or chick or whoever you the fuck you are. Second of all shut the fuck up. When have you not done something dumb in your lifetime??... When have any of you not done something stupid when you were younger or something??... Can any one of you say that you haven't done something stupid in your lifetime???... Can anyone of you say that you're perfect??.... I thought so. Now shut the fuck up and sit the fuck down. Before you get me even more mad and I'm scary when I'm mad. And this is my friend and this has no right to be up. It's the stupidest fucking thing I've ever read. And who cares if it's about weed It's fucking weed dude it's legalized in Minnesota now. This may say Fargo but she's not in Fargo she's in Minnesota.. Minneapolis Minnesota to be exact. So shut the fuck up all of you. All of you are the retarded ones compared to her and me. You guys need to get some schooling or something. She and I already have schooling. And it's not just regular schooling is called college schooling We both been through it even though we've flunked out before we still got the training so you should shut the fuck up before you talk shit because she's smart as shit when she's on her meds she's more normal Yes I understand that part.. when she's not on her meds she's not thinking clearly. But she also went to the cops because who wouldn't go to the cops these days They fucking seize weed all the time. That's probably what she was thinking without being in the right state of mind. So think before you speak about my friend..




:puppet:


Extras: Filter Print Post Top
Invisibledurian_2008
Cornucopian Eating an Elephant
 User Gallery


Registered: 04/02/08
Posts: 16,685
Loc: Raccoon City
Re: Woman shows up at police station to buy pot [ND] [Re: TheStallionMang]
    #28353200 - 06/09/23 11:56 AM (7 months, 16 days ago)

It begs to be asked why Grace is in college, when there were not enough resources to accommodate a mentally stable person, not especially prone to taking dares. 

Is she going to be put in the front of the hiring line, fast tracked, and given lending preferences, for reasons which no one can put his finger on?


Extras: Filter Print Post Top
OfflineShiVersblood
VAmPiRES HELLA ❤
I'm a teapot User Gallery

Registered: 08/18/07
Posts: 115,620
Loc: United States of America Flag
Last seen: 2 hours, 10 minutes
Re: Woman shows up at police station to buy pot [ND] [Re: durian_2008] * 1
    #28357031 - 06/12/23 12:21 PM (7 months, 13 days ago)

Maybe this was some kind of federal sting operation set up by the FBI to try and see if the cop was corrupt or not.


Extras: Filter Print Post Top
InvisibleTheStallionMang
Do U know who yur fuckin with?
Male

Registered: 10/18/17
Posts: 4,531
Loc: Flag
Re: Woman shows up at police station to buy pot [ND] [Re: ShiVersblood]
    #28357376 - 06/12/23 04:39 PM (7 months, 13 days ago)

Nah, it's much more likely that the arrested woman is just that stupid, same goes for her "friend" that posted here

We couldn't start doing test to see if cops are corrupt or not cause we'd have hardly any cops left


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2  [ show all ]

Shop: Bridgetown Botanicals Bridgetown Botanicals   PhytoExtractum Maeng Da Thai Kratom Leaf Powder   Kraken Kratom Red Vein Kratom   Original Sensible Seeds Autoflowering Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* Woman shows up at court with rock cocaine stuffed in shoe motamanM 2,556 3 07/21/03 09:44 PM
by Dreamer987
* Woman arrested for smoking pot with children motamanM 5,908 8 05/22/03 12:39 AM
by thestringphish
* Woman Dies After Police Mistakenly Raid Her Apartment motamanM 2,640 3 05/18/03 05:27 AM
by Revelation
* Wrong number leads to pot arrests Bavet 3,848 8 03/09/03 08:08 PM
by Dobie
* DNA DATABASE TRACKS POT TRAFFICKING motamanM 2,340 4 07/28/03 10:58 PM
by biglo
* The day the law changed... and it all went to pot AnnoA 1,211 1 02/03/04 02:53 PM
by MrMaddHatter
* Judge rules police used excessive force in 1999 case motamanM 1,909 5 05/11/04 09:30 PM
by motaman
* Feds considers axing potent pot TinMan 2,424 3 06/02/03 01:01 PM
by Hans_Moleman

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: motaman, veggie, Alan Rockefeller, Mostly_Harmless
2,602 topic views. 0 members, 3 guests and 1 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.026 seconds spending 0.007 seconds on 14 queries.