Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinepantsboy
I troll because I care.
Female User Gallery

Registered: 10/28/04
Posts: 13,002
Loc: 8====D ~o
Last seen: 1 year, 27 days
LSD Lookalikes
    #5256805 - 02/02/06 07:52 PM (17 years, 11 months ago)

Does anyone have a link which shows pictures of al the prints that are in circulation of RC's other chems (DOC, DOM, DOB) that are being sold as LSD but aren't LSD?

:toomuchacid:


--------------------
Acid doesn't hurt when you're on fire. :frown:




"Mushrooms are only similar to penises in their appearance." - LeBron James (2013)

ToiletDuk said:
"Bus squelching is not to be laughed at."


Extras: Filter Print Post Top
Offlinethe_psychonaut
psychonaut
 User Gallery
Registered: 01/09/05
Posts: 394
Last seen: 8 years, 5 months
Re: LSD Lookalikes [Re: pantsboy]
    #5256946 - 02/02/06 08:21 PM (17 years, 11 months ago)

i wish


--------------------
never be afraid to let your mind explore, just know what you are getting into b4 you jump in the deep end, and do your research on this site and erowid.com


Extras: Filter Print Post Top
InvisibleGratos
Just thinkin anddrinkin
 User Gallery
Registered: 08/21/05
Posts: 1,374
Re: LSD Lookalikes [Re: pantsboy]
    #5256990 - 02/02/06 08:31 PM (17 years, 11 months ago)

Check out 'recent LSD prints' in ODD.

Cant remember the exact name of the thread unfortunatly


Extras: Filter Print Post Top
Offlinepantsboy
I troll because I care.
Female User Gallery

Registered: 10/28/04
Posts: 13,002
Loc: 8====D ~o
Last seen: 1 year, 27 days
Re: LSD Lookalikes [Re: Gratos]
    #5256997 - 02/02/06 08:32 PM (17 years, 11 months ago)



--------------------
Acid doesn't hurt when you're on fire. :frown:




"Mushrooms are only similar to penises in their appearance." - LeBron James (2013)

ToiletDuk said:
"Bus squelching is not to be laughed at."


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: LSD Lookalikes [Re: pantsboy]
    #5257026 - 02/02/06 08:38 PM (17 years, 11 months ago)

Yeah, you won't find any kind of database like that...

DOM on blotter? I wish!


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Jump to top Pages: 1


Similar ThreadsPosterViewsRepliesLast post
* will LSD last?
( 1 2 all )
danlennon3 11,875 26 10/01/18 11:06 AM
by nube424
* Can one empathically affect liquid LSD?
( 1 2 3 4 5 6 all )
BlueMeanie25 14,505 109 09/11/18 12:48 PM
by heatlessbbq
* A question on LSD nickelpenny 669 1 06/07/04 10:58 PM
by splifftoter
* Thenewuser's Trip Reports (New Live Trip - Feb - 8th, Tue. - 4 Hits of LSD)
( 1 2 3 4 5 all )
thenewuser 11,108 98 02/11/05 03:50 PM
by Rose
* A contemporary scientific overview of LSD action [with .pdf version attached for convenience] Asante 10,561 14 02/14/19 10:02 PM
by PrimalSoup
* Some kid thought LSD genetically mutates the DNA of your children...
( 1 2 3 all )
Fluxburn 12,646 54 01/28/18 12:24 PM
by papel
* Captain Al Hubbard, Johnny Appleseed of LSD LearyfanS 7,898 7 11/08/17 04:34 PM
by NOUS333
* LSD/Mushroom Comparison
( 1 2 3 all )
vanner 15,329 59 04/02/09 06:04 AM
by island

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
1,866 topic views. 3 members, 49 guests and 6 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.02 seconds spending 0.004 seconds on 12 queries.