Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Bridgetown Botanicals Bridgetown Botanicals   Original Sensible Seeds Autoflowering Cannabis Seeds   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Left Coast Kratom Buy Kratom Capsules   PhytoExtractum Buy Bali Kratom Powder

Jump to first unread post Pages: 1
OfflineTen_Percenter
LonestarExplorer
Male

Registered: 12/14/05
Posts: 223
Last seen: 16 years, 7 months
are they legally allowed to sell dried poppy pods at floral stores?
    #5254678 - 02/02/06 10:50 AM (17 years, 11 months ago)

I want to get some but i don't want to look shady.


Extras: Filter Print Post Top
Invisibleabrad84
Stranger
Male

Registered: 10/15/05
Posts: 1,128
Re: are they legally allowed to sell dried poppy pods at floral stores? [Re: Ten_Percenter]
    #5254688 - 02/02/06 10:53 AM (17 years, 11 months ago)

I doubt many "normal" people know about all the wonderful, non craft related uses that can be put to.  :wink:


Extras: Filter Print Post Top
Offlinelemon_lw
Stranger

Registered: 10/17/04
Posts: 3,622
Loc: That Way
Last seen: 16 years, 4 months
Re: are they legally allowed to sell dried poppy pods at floral stores? [Re: Ten_Percenter]
    #5254744 - 02/02/06 11:12 AM (17 years, 11 months ago)

alright i just talked with my wife and she works at a floral store and she said that she doesnt even have access to order them. she doesnt know if its illegal but its not one of the things she can get. so i can almost guarantee its a dead end.


--------------------
In the belly of the Leviathan, one can either despair and perish, or be cheerful and persevere.-Dean Koontz


Extras: Filter Print Post Top
Invisiblekaniz
That one, overthere.
Male

Registered: 07/23/04
Posts: 4,166
Loc: Ontario
Re: are they legally allowed to sell dried poppy pods at floral stores? [Re: lemon_lw]
    #5254766 - 02/02/06 11:18 AM (17 years, 11 months ago)

Well, one would asume that if they are in stock - they are allowed to sell them. Now, if you had to ask them to place a special order for them, that may raise a few eyebrows.


Extras: Filter Print Post Top
OfflineOrizonsHorizon
Stranger
Registered: 10/10/05
Posts: 404
Last seen: 16 years, 10 months
Re: are they legally allowed to sell dried poppy pods at floral stores? [Re: kaniz]
    #5254820 - 02/02/06 11:34 AM (17 years, 11 months ago)

THey're legal...They;ve been selling online for a few years now but they cracked down on most of the largescale operations
Example: http://www.poppies.org/news/104440525433905.shtml

The laws havent changed..... The "contained schedule I" classification has been constant and applied for quite some time now, but after the DEA made a few examples of Pod sellers, the trade became pretty dormant. There are still some people who sell them---but you have to very careful in how it's advertised, marketed, sold too and described. THe people that were busted on ebay were only selling active Pod speicies...No other Floral-decor items..
THe purpose was barely ellaborated as being for arts and crafts, and alot of the people who were ordering had ebay names like "420Toker" and histories of buying stuff like boxes of ISI chargers, glass pipes, Cactii powder, GLow in the Dark tapestries and dried Hostilis root.

...Poppy pods arent a real popular item for those seeking actual Floral arangements crafts etc...They do pop up every now and then in shops but there isnt much of a demand for them---and when there is a request for this ugly potatosack Pod, they will usually only order fake plastic replicas.

---SO, this is something that can be considered Quasi-legal, much like that of P.Torch and Ayahuasca. Whether or not you are convicted is something the DEA will decide if they catch on. Most vendors dont take the risk anymore.


Extras: Filter Print Post Top
Offlineleery11
I Tell You What!

Registered: 06/24/05
Posts: 5,998
Last seen: 8 years, 9 months
Re: are they legally allowed to sell dried poppy pods at floral stores? [Re: OrizonsHorizon]
    #5254876 - 02/02/06 11:56 AM (17 years, 11 months ago)

this guy was telling me he ordered opium online and i was like, wtf...

i went to the website he told me and saw nothing of the sort, but at least now I know he was being serious.


--------------------
I am the MacDaddy of Heimlich County, I play it Straight Up Yo!

....I embrace my desire to feel the rhythm, to feel connected enough to step aside and weep like a widow, to feel inspired, to fathom the power, to witness the beauty, to bathe in the fountain, to swing on the spiral of our divinity and still be a human......
Om Namah Shivaya, I tell you What!


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: are they legally allowed to sell dried poppy pods at floral stores? [Re: leery11]
    #5254897 - 02/02/06 12:00 PM (17 years, 11 months ago)

I know someone who used to work in a floral store. The women running it ordered a few dozen poppies, fresh, and really beautiful green pods. They don't know anything about drugs, however. So, when my friend asked if it was possible to order more, they said "sure". But, found out that their supplier didn't have any more. Probably a limitation on how many they can grow.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineOrizonsHorizon
Stranger
Registered: 10/10/05
Posts: 404
Last seen: 16 years, 10 months
Re: are they legally allowed to sell dried poppy pods at floral stores? [Re: Koala Koolio]
    #5255024 - 02/02/06 12:29 PM (17 years, 11 months ago)

I just re-checked the law about Opium Poppy Pods and they are actually listed as a Schedule II. The legislation about Opium Pods that are strictly grown for ornamental purposes is very vauge. THE DEA knows they are so widely distributed everywhere that there is little they can do to enforce this law. Pods for floral arangements set-aside, the Agriculture production that supplies the Poppy seed for Burger buns at fast food joints and pastires at markets is overwhelmingly hard to regulate.

I also find it amusing how in the article, they tested the poppy Seeds for traceable levels of morphine and decided to arrest him on those grounds. Theorteically, you could be arrested for having a poppy-seed muffin using this rationale'. The funny thing is, People who make Poppy Tea dont even use the seeds...the shell of the Pod is what contains the level of opiates, conentrated eneough to induce intoxication.


Extras: Filter Print Post Top
Offlinerun_rabbit_run
people arestrange

Registered: 10/24/05
Posts: 244
Last seen: 14 years, 9 months
Re: are they legally allowed to sell dried poppy pods at floral stores? [Re: OrizonsHorizon]
    #5255044 - 02/02/06 12:33 PM (17 years, 11 months ago)

my mom has a shit load of those things


--------------------
If the doors of perception were cleansed, everything would appear as it is - infinite


Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Bridgetown Botanicals Bridgetown Botanicals   Original Sensible Seeds Autoflowering Cannabis Seeds   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Left Coast Kratom Buy Kratom Capsules   PhytoExtractum Buy Bali Kratom Powder


Similar ThreadsPosterViewsRepliesLast post
* Fungus Legality shroomsi8 2,087 13 12/02/03 09:12 AM
by psilomonkey
* Canada legality? Yarry 2,457 13 01/23/04 05:20 PM
by Yarry
* Selling Pipes Online Zwieback0 1,823 10 02/21/04 10:12 AM
by Trip
* FTP legal disclaimer Calbha 1,220 7 02/09/04 06:40 PM
by MikeOLogical
* Spores = less legal than we thought? WH15K3Y_50UR_PLZ 5,059 15 12/17/03 12:36 AM
by Granola
* Who needs a good legal service? *UPDATE 7/8/04* Mojo_Risin 2,605 13 07/12/04 12:26 AM
by Locus
* Trading or selling burned C.D.s Dreamer987 987 4 12/22/03 08:10 PM
by Granola
* VERY good legal article on grow bust laws. Lana 3,274 2 06/16/02 03:54 AM
by LCid

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Enlil, Alan Rockefeller
1,140 topic views. 0 members, 1 guests and 0 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.026 seconds spending 0.007 seconds on 15 queries.