Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: PhytoExtractum Kratom Powder for Sale   Original Sensible Seeds Autoflowering Cannabis Seeds   North Spore Bulk Substrate   Myyco.com APE Liquid Culture For Sale   MagicBag.co All-In-One Bags That Don't Suck   Kraken Kratom Red Vein Kratom   Bridgetown Botanicals Bridgetown Botanicals   Left Coast Kratom Buy Kratom Capsules   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Mushroom-Hut Liquid Cultures   OlympusMyco.com Olympus Myco Bulk Substrate

Jump to first unread post Pages: 1 | 2 | 3  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
InvisibleSclerite
Stranger
Registered: 07/15/01
Posts: 14
The DMT and tryptamine connection
    #4953953 - 11/18/05 10:34 PM (18 years, 5 months ago)

I repeatedly see posts speculating on using DMT contianing material in substrate, but rarely see any reports or confirmation of its effectiveness. Am I missing the right threads?? In any event, I have 10x extract of both Virola and Anadenanthera, as well as Mimosa hostilis and a huge plant of Psychotria viridis. I also have tryptamine, which in a previous thread I mentioned is highly insoluble in water, and evey attempt to add DMSO or ethanol dissolved tryptamine results in uncolonized grains or cakes, usually by contamination. Recently, a friend tried crushing the tryptamine and just sprinking in on a well colonized casing not quite fruiting. He will report the results. He thinks tryptamine hydrochloride, a water soluble salt would have been a wiser choice, but that's amino acid under the bridge. Given the fairly bulk order of mimosa, he will also try introducing it to the next casing or colonizing substrate and report back with potency variation because at this point, after many many many successsful fruitings of various species, the potency is always disappointing, and the 5g dried ego loss is little more than an interesting evening watching TV and even 10g is visual but short acting, and he is ready for the heroic dose experience so seldom encountered where chi energy is visible and the ether of the univese can be moved with the voice and telepathy is possible. This is so rare, and he wants it to be the norm and cultured mushrooms just don;t seem to make it in that regard. Only wild ones, and nly sometimes, and he is at a point where the riskiness of collecting in his area has become more than he wishes to indulge in. Recently, using Copelandia cyanescens in Amsterdam, he was floored, but in a very different way - almost brutal and not etheric and mystical.

So increasing alkaloid content is a goal, and it will be not just talked about but produced. Oh, to live in Oregon where the species are the ones of true merit. Stay tuned.

Edited by Sclerite (11/18/05 10:36 PM)

Extras: Filter Print Post Top
Offlinexaxphaanes
Mycologist
 User Gallery

Registered: 08/08/05
Posts: 2,988
Last seen: 1 year, 9 months
Re: The DMT and tryptamine connection [Re: Sclerite]
    #4953995 - 11/18/05 10:43 PM (18 years, 5 months ago)

the reason you really dont see any posts or confirmation on it is because most (if not all) people here don't have scientific equipment to test it.... they could just post experience but that experience can fluctuate because of mood settings how much they ate etc etc so it really isn't true fact.(and IMO it is fairly new thing)


--------------------
"Anything i say is fictional"
  what you should look for in manure

Extras: Filter Print Post Top
InvisibleZen Peddler
Male User Gallery

Registered: 06/18/01
Posts: 6,379
Loc: orbit
Re: The DMT and tryptamine connection [Re: Sclerite]
    #4958208 - 11/19/05 11:40 PM (18 years, 5 months ago)

I think if it were that easy most people would be doing it.


--------------------

Extras: Filter Print Post Top
Offlinemogur
regnartS

Registered: 11/15/05
Posts: 322
Loc: Puget Sound
Last seen: 11 years, 5 months
Re: The DMT and tryptamine connection [Re: Sclerite]
    #4961647 - 11/20/05 08:32 PM (18 years, 5 months ago)

What has triggered all the speculation in the posts you keep seeing is Gartz's published study. He definitely used tryptamine HCl (25mM), and the potentiation of psilocin is simply amazing. You may want to pursue that avenue, first, as the surest way to a 'potentiated' experience. The study determined also that the production of psilocybin is greatly reduced. Gartz speculates that this may result from reduced phosphate in the substrate. If so, it could be worth experimenting with phosphate dosing of the growing medium, too. Tryptamine HCl is available at most chem supply companies (Sigma Aldrich, e.g.) for about $25 for 5 grams.

As for DMT culture dosing, I couldn't predict. But I am anxiously awaiting any results that you may choose to share. Gartz said that Psilocybe cubensis was better at hydroxylating and methylating tryptamine than tryptothan, which is an earlier precursor in the bio-synthesis of psilocin. I'm no chemist, so don't have a clue whether DMT is already locked up, but I know that it isn't known to be a direct precursor. On the other hand, what could it hurt to try. If I had some Mimosa hostilis bark, I think that might be worth trying as a substrate material, without having to extract the DMT.

Extras: Filter Print Post Top
OfflineInterested
Stranger
Registered: 11/30/04
Posts: 45
Last seen: 9 years, 10 months
Re: The DMT and tryptamine connection [Re: mogur]
    #4961763 - 11/20/05 09:08 PM (18 years, 5 months ago)

Mainstream chemical supply companies won't sell to individuals. That said, there are small chem companies on the internet that sell tryptamine, and they'll likely sell to individuals.

It will be completely obvious to anyone with even a passing knowledge of chemistry that you're doing something illegal if you, as an individual, order quantities of tryptamine. Bizarrely, if internet rumors are to be believed, tryptamine is not listed as a "watched chemical", meaning that chemical supply companies are not obligated to report sales of it. This doesn't make much sense, since it's known that many more innocuous chemicals ARE watched. None the less, if this is correct (and I have no idea if it is) it means it's relatively safe to order.

Extras: Filter Print Post Top
Offlineradio943dmt
Stranger
Registered: 11/18/05
Posts: 16
Last seen: 17 years, 9 months
Re: The DMT and tryptamine connection [Re: Interested]
    #4962827 - 11/21/05 02:24 AM (18 years, 5 months ago)

I have tried adding DMT by simply grounding up some Mimosa Hostilis root bark in a blender (cheaply available), you don't need all that much around 10g bark per 1/2 pint jar, mixing it in with the substrate, and to make it more water soluble I added some phosphoric acid (could have used hcl acid or something but I thought using phosphoric would possibly help more psilocybin production?) - the phosphoric acid i've had around for a while, its really cheap (10%) from some online beer store.

I added enough phosphoric acid to lower the ph some but not too much (mixed it in after adding water of course). I did this *before* I sterilized the jars, so the DMT being in salt form (most likely, if enough acid is added) it isn't going to boil/burn up or anything.

We've been doing it this way ever since we decided to try it - its worth it! I noticed leaving the jars for longer, after they look fully colonised, couple weeks longer, seems to make them more potent. Also the potency increase does vary between flushes, some seemingly 4x as potent, anyway they always seemed (subjectively) to be at least 1.5-5x as potent as regular cubensis without the mimosa added.

Now, 10g of mimosa for a jar, cost nearly nothing. I've never tried it without adding some phosphoric acid but i'd only guess it would still work.. maybe not as good, but can't be NO potency increase..

I've thought of also adding ground up mimosa mixed in with the fruiting stage, never tried it, there seems to be a limit as to how much mimosa you can add before the limit is reached and the enzymes are all tied up with enough DMT as-is anyway - but all I know is i'm happy with these fuckers the way I do it, I mean, why bother with trying to obtain costly tryptamine etc when you can just add some dirt cheap mimosa bark?

Not sure where but there's a limiting stage somewhere, not sure if adding tryptamine is the best way anyway, it might be before the limiting stage i forget, but I do remember looking at a chart seeing that the 4-hydroxylating stage was past this and so DMT skipped this limiting stage.

...why grow them normally ever again after discovering this..

Extras: Filter Print Post Top
Offlinezenman223
The last Mohican
Male

Registered: 10/23/05
Posts: 384
Loc: NC
Last seen: 7 years, 5 months
Re: The DMT and tryptamine connection [Re: radio943dmt]
    #4976070 - 11/24/05 11:53 AM (18 years, 5 months ago)

where might someone come across some of this bark? this is very interesting i would love to be able to drastically increase potentcy w/o alot of hassle, sclerite, keep us posted on your experinces pls btw i would say the hydrocloride salt would deff. be the way to go.


--------------------
"I think I am, therefore I become."
"In the beginning of a change the patriot is a scarce man, and brave, and hated and scorned. When his cause succeeds, the timid join him, for then it costs nothing to be a patriot." - Mark Twain 

Extras: Filter Print Post Top
InvisibleSclerite
Stranger
Registered: 07/15/01
Posts: 14
Re: The DMT and tryptamine connection [Re: zenman223]
    #4987241 - 11/27/05 06:26 PM (18 years, 5 months ago)

Well, I am able to order it as a research chemical, and in fact had ordered it to make an agar to culture marine actinomycetes which I had reason to believe were causing a disease in a marine invertebrate - tryptamine is watched to some degree, but it is an AA so has many uses outside anything illegal, of course. Having left over product, I was curious about these studies. In any event, the deed is done, and a friend will post soon on the results as he said fruiting was inititated quite prolifically in the first flush.

on M hostilis, it is available many places - you may want to check out ayahusca.org for sources and I think Danny at psychoactiveherbs.com has great prices and materials for ethnobotanical source material as well as Maya Ethobotanicals in the Netherlands.

Extras: Filter Print Post Top
Offlineamyloid
Stranger
Registered: 03/08/03
Posts: 980
Last seen: 10 years, 3 months
Re: The DMT and tryptamine connection [Re: zenman223]
    #4990246 - 11/28/05 03:41 PM (18 years, 5 months ago)

you can get mimosa hostilis root bark from www.iamshaman.com. which is one of shroomery's sponsers!


--------------------
"A human being is part of a whole, called by us the Universe, a part limited in time and space. He experiences himself, his thoughts and feelings, as something separated from the rest--a kind of optical delusion of his consciousness. This delusion is a kind of prison for us, restricting us to our personal desires and to affection for a few persons nearest us. Our task must be to free ourselves from this prison by widening our circles of compassion to embrace all living creatures and the whole of nature in its beauty."
-Al Einstein

Extras: Filter Print Post Top
OfflineMobius_Strip
Distant Relative
 User Gallery

Registered: 03/11/05
Posts: 322
Loc: Spangladesh
Last seen: 17 years, 10 months
Re: The DMT and tryptamine connection [Re: amyloid]
    #4991239 - 11/28/05 06:46 PM (18 years, 5 months ago)

I just checked, IamShaman no longer sells mimosa hostilis root bark. See their site for more info.


--------------------
The smart way to keep people passive and obedient is to strictly limit the spectrum of acceptable opinion, but allow very lively debate within that spectrum - even encourage the more critical and dissident views. That gives people the sense that there's free thinking going on, while all the time the presuppositions of the system are being reinforced by the limits put on the range of the debate
-Noam Chomsky

Extras: Filter Print Post Top
Offlinezenman223
The last Mohican
Male

Registered: 10/23/05
Posts: 384
Loc: NC
Last seen: 7 years, 5 months
Re: The DMT and tryptamine connection [Re: Mobius_Strip]
    #4999439 - 11/30/05 04:51 PM (18 years, 5 months ago)

thanks


--------------------
"I think I am, therefore I become."
"In the beginning of a change the patriot is a scarce man, and brave, and hated and scorned. When his cause succeeds, the timid join him, for then it costs nothing to be a patriot." - Mark Twain 

Extras: Filter Print Post Top
Offlineradio943dmt
Stranger
Registered: 11/18/05
Posts: 16
Last seen: 17 years, 9 months
Re: The DMT and tryptamine connection [Re: zenman223]
    #5000647 - 11/30/05 10:05 PM (18 years, 5 months ago)

Quote:

OK, SWIM is here to share a method for you busy bees to analyze, SWIM is prepared to be flamed to ashes but here to share regardless - It is SWIMs' personal belief and that of others in his circle that this is a method for producing tryptamine enhanced mushrooms easily.

Bees may recall the post about Meth from mother nature, or something like that, from the past year, SWIM copied it but lost the file somewhere.it included a list of the known chemicals found in analyses of psilocybe baeocystes, SWIM thinks was the species....must find it again, it might make a useful reference.

Anyway, a couple of years back, SWIM produced a few silly mushies using the basic PF method, bet they were not very strong, tho very friendly and manageable for all.

Upon discussions with other local followers of the hermetic arts, was concluded to change fruiting mix, to a 20% ground rye component. This increased potency considerably.

Having tasted something of success in this effort, SWIM unbeknownst to his associates,(double blind control - heh,heh) propogated a dozen cakes with the addition of roughly two cups (loose NOT packed) of sterilized (boiled in small amt DH2O in microwave, oven dried, casserole dish scraped and resins included with leaves) dried Mimosa Leaves. Said Mimosa is... (I have been unable to find the type of tree in web images from google, It is definitely a cousin to Mimosa Hostilis, but has puffy pink flowers, reminiscent of giant dandelion seeds with pink instead of white fibers, will post exact species when I get it figured out. It is a common yard ornamental here.)

Several weeks later SWIM later had to leave the local honky tonk experiencing extreme time distortions and increasing difficulty walking and forming coherent sentences after taking one small (3-4 grams wet fresh weight) cap w/stem of these, a dose he would normally consider merely medicinal.

Bioassay was confirmed experientially by several other individuals - these were definitely not your ordinary mushies, one friend witnessed dancing sombreros in his house after ignoring my advise and consuming perhaps half an oz fresh weight. Another friend, paranoid of being pulled over by the Publik OfficialZ, consumed roughly an oz and found himself able to drive for a few minutes(?) but very lost, he eventually discovered he was some miles too far North to find his home. In all cases the trip was barely manageable (get yer seat belt tight and hang on) during the peak, which occurred much faster than normal mushies and dissipated faster, reminiscent of DMT family substances. Also, as well as time distortion all subjects experienced powerful psychedelic patterns which are not normally typical of the psilocybins I have known.

Later experimentation with the new Albino spore race was curtailed hurriedly due to outside circumstances, but results were again consistent. Some 40# wet were accumulated and dispersed to the village before halt of experiment, all results reported were invariably favorable.

The food recipe for these cakes is as follows.....


2 cups sterile vermiculite

1 and 1/4 cup brown rice and rye mix (organic grains, purchased whole and ground to chunky flour in coffee grinder, 80 percent organic brown rice, 20 percent organic rye berries)

1 cup Mimosa leaf (boiled in micro and dried in oven)(loose pack dammit!)

pea sized chunk of sterilized limestone, crushed to powder

1 1/3 cup of high grade artesian water, no cheap brands

mix but not so thoroughly that all air is out of media, you want it spongy when the jars are filled

will fill exactly 6 half pint jars

fill jars to thread with food mix, DO NOT PACK THE FOOD MIX YOU WANT AIR SPACES IN IT.

fill jar ALMOST to top with sterile vermiculite (this is a baffle/filter to catch possible contaminants) seal jar with previously prepared lid

pressure cook at 15 PSI for 25 minutes from the time the release valve begins to dance and hiss

Hint - use small pressure cookers that will only hold 3 half-pint jars, they heat fast and make for efficient and uniform heat transfer, SWIM uses 2 cookers at a time, sometimes inoculating 60 jars for a days work, roughly 8-10 hours

when jars are room temp may be inoculated using typical syringe technique

Keep jars warm and dark, 76 degrees I have found is ideal

After about 10 days you can take the jars which are about half colonized and slap them hard upside down on a phone book or something, you will feel the cake rock in the jar now and the airspace you have gained between glass and culture allows for faster completion of colonization.

everything else is generic PF TEK version of MMGG method, with 2 modifications*

the Perlite humidity tech is used, roughly...

2-3 inches perlite in cleaned and sterile sterilite container from any Wallys place

SOAK perlite in good quality artesian or spring water, sterile, stay away from cheap brands, it will take about 2/3 of a gallon, you don't want the cakes to sink in the "swamp"

*1/2 OZ h2o2 is added to each 16 quart sterilite terrarium, then water is added across pouring point of peroxide to fully disperse oxidizing antiseptic

the temp is tweaked up and down, to imitate natural conditions and improve humidity in the terrariums, condensation should almost always be visible

*One or two hours or so of direct morning sunlight is the most effective way to enhance growth that SWIM has found, this remarkably accelerates fruiting - It is also very neat to sit with the terrariums in the early morning and have a cup of Java and a fat joint, you can almost see the little guys grow as they bask in sunlight. Can almost see em sitting on the cowpie out in the pasture.

typical filtered daylight is fine for rest of cycle, 24 hr light and dark cycle is somewhat important to follow.

Each terrarium will hold three cakes with no need to shuffle them around, each terrarium will produce close to a Lb/6 weeks in optimum conditions

AFTER 6 weeks of fruiting...dispose or grind and extract cakes, no doubt some good bees can tell us how to remove any possible ergot taint from the other alkaloids present?.

SWIM STRONGLY recommends that fruits from these cakes after 6 weeks be carefully dried, stashed, and treated as a milligram strength substance, hopefully someBees may find this method worthy of some real scientific effort and analysis and might share their results with us?

SWIM would be very interested to hear from someone with access to TLC EQ, to see what the alkaloid content of some of these little amigos might be, when this method is applied. Rest assured, this method grows more than simple shroomies.




Found that just browsing around the net.. from a long time ago.

Yeah, you can easily find plenty of mimosa bark from many places in the world for really damn cheap, when you think about how little you'd actually need to include in your substrate or whatever.

Extras: Filter Print Post Top
OfflineXxDaTxX
Stranger
Registered: 12/02/05
Posts: 13
Last seen: 10 years, 2 months
Re: The DMT and tryptamine connection *DELETED* [Re: radio943dmt]
    #5005530 - 12/02/05 02:45 AM (18 years, 5 months ago)

Post deleted by XxDaTxX

Reason for deletion: N/A


Extras: Filter Print Post Top
OfflineSilly_Cyben
not-quite-newbie

Registered: 04/11/05
Posts: 183
Loc: USA
Last seen: 1 year, 26 days
Re: The DMT and tryptamine connection [Re: XxDaTxX]
    #5009009 - 12/03/05 01:03 AM (18 years, 5 months ago)

There is a vendor that sells mimosa bark: The Shaman's Den.

Extras: Filter Print Post Top
Offlineradio943dmt
Stranger
Registered: 11/18/05
Posts: 16
Last seen: 17 years, 9 months
Re: The DMT and tryptamine connection [Re: Silly_Cyben]
    #5025179 - 12/06/05 07:10 PM (18 years, 5 months ago)

It looks to me from this study:

Addition of DET Gartz study (Oct. 1988)
http://www.geocities.com/radio879z/psilocybebio.pdf

And this study already on the shroomery,

Addition of Tryptamine Gartz study (March 1988):
http://www.shroomery.org/index.php/par/7953

That addition of DMT to the substrate may provide just as much potentiation / increase in psilocin as adding Tryptamine HCl.

Both studies show 5 flushes and up to 3.3% 4-hydroxy-DET/DMT out at the end.

Here's another image,

http://www.geocities.com/radio879z/psilocybes_enzymesteps.gif

A friend of mine in another country recently got ahold of a couple grams of Tryptamine freebase, and he does have mimosa bark and DMT, also his friend has access to analysis equipment..

So hopefully sometime soon he'll be able to inoculate several jars, some with tryptamine added, some with ground up mimosa bark added, a jar or two with nothing added..

Now, its easy to make the HCl salt of tryptamine, but just as easy to make the phosphate salt (he has some phosphoric acid), and the point of making a salt of Tryptamine (or DMT) is to make it water soluble right? so..

Quote:

The results in Table 1 show that the enzyme systems in Psilocybe cubensis have a high hydroxylation and methalation capacity to convert added Tryptamine to psilocin. It is possible that a reduced amount of phosphate in the culture media decreased the bio-synthesis of psilocybin from psilocin in the media.




For psilocybin, for the phosphoryloxy group, where does it get that from? I would think possibly using phosphoric acid instead might result in more psilocybin production, he has IMed DMT phosphate solution before, adding 1/3 molar phosphoric acid (1 molecule of phosphoric acid can attach to 3 DMT molecules, enough to make it water soluble), but each psilocybin molecule has its own so I could add an equal molar amount of phosphoric acid per tryptamine or DMT molecule, i'm wondering what is the best ph, or a range for the ph that the substrate should or could be for proper growth?

I haven't read up on it but some of you might know, what effect does ph have on mushroom growth in general? How much phosphoric acid could he add to the substrate mix, to add more phosphoric acid but not let the ph drop too low?

It'll be a while til he could get some results, but from everything i've read it seems like adding either tryptamine or DMT to the substrate would probably produce super incredibly potent mushrooms, probably equally, but since Tryptamine is hard to obtain - mimosa root bark IS NOT hard to get and INCREDIBLY cheap!

In that study i linked to above (Oct. Gartz study) they added DET (also talks about adding NMT resulting in more baeocystin), got mushrooms with as much as around 3.3% of the dry weight of 4-HO-DET out (same percent as adding Tryptamine HCl), both studies show a chart with 5 flushes and similar % numbers.

Now i'm not sure why this hasn't 'caught on' yet, because people HAVE added DMT to the substrate and gotten super potent mushrooms out, and if its as easy as simply adding a little ground up mimosa hostilis root bark to your substrate i'd think once enough people started doing it, ...well who wouldn't want to do it?

Typically mimosa bark has 0.57% DMT by weight (average maybe.. often more), thats around 50mg per 10g bark, I got some info from someone who's added different amounts of DMT per jar and found that for a "pf style" jar, 30mg - 40mg produced more potent mushrooms and 50mg seemed to be the max  in his experiments they would take, and adding 60mg+ didn't hurt anything but didn't add any more potency than 50mg - but the 50mg or more jars produced some mega godly potent shrooms!

So looking at those numbers lets say typical dried mushrooms contain 0.6% combined psilocin & psilocybin, so a 5 gram cubensis trip would be around 30mg psilocin/psilocybin (correct me if my numbers are off).

Now if you have dried cubensis with average 3.0% psilocin then 5 grams would be more like 150mg's.. 5x as potent, or lets say even 2.0% would be over 3x potency, which seems to be what people have been reporting from just adding DMT (at least 2x, up to around 5x potency, depending on flush and other things).

The price of 1kg mimosa root bark can be had for as low as $100, enough for 100 "pf style" jars, costing $1 per jar to add 10g bark for such a huge potency increase..

Ok even if you didn't get 5x potency by just tossing in 10g bark, a dollar for 2x potency at the lowest, ain't too bad..

---
I don't know if its ok (against the rules or what) but I have bags of mimosa bark just 'laying around' with nothing to do which i'd happily give away to anyone (the bark is legal to have) wanting to hang up for ordamental purposes or anything not illegal of course.

I'd love someday to see a Mega thread on the shroomery sorta like that coffee thread, just about people's experiences with adding Mimosa root bark to their substrate, I think its one of those things that just hasn't 'caught on' yet but would if people actually started trying it (did i mention how CHEAP the bark is?? :smile: )

Extras: Filter Print Post Top
OfflineMisterMyco
Myco-fanatic
Male

Registered: 12/08/05
Posts: 636
Last seen: 18 years, 2 months
Re: The DMT and tryptamine connection [Re: Interested]
    #5034617 - 12/08/05 03:48 PM (18 years, 5 months ago)

The DEA Diversion website (google that and you'll find it) has a link to the US Code (Regulations & Codified CSA > CFR > Section 1310 > Section 1310.02) that gives a complete list of the 34 watched chemicals. Tryptamine HCL is not one of those chemicals. However, I can't think of many uses for Tryptamine.HCL other than drug production, so it would be a big red flag. Order small, if you are going to do it, I suppose.


--------------------
"I have never, in all my life, not for one moment, been tempted toward religion of any kind. The fact is that I feel no spiritual void. I have my philosophy of life, which does not include any aspect of the supernatural."
Isaac Asimov

Extras: Filter Print Post Top
OfflineXxDaTxX
Stranger
Registered: 12/02/05
Posts: 13
Last seen: 10 years, 2 months
Re: The DMT and tryptamine connection *DELETED* [Re: MisterMyco]
    #5035783 - 12/08/05 07:32 PM (18 years, 5 months ago)

Post deleted by XxDaTxX

Reason for deletion: N/A


Extras: Filter Print Post Top
Invisiblemicro
bunbun has a gungun
Male User Gallery

Registered: 05/09/03
Posts: 7,532
Loc: Brick City Flag
Re: The DMT and tryptamine connection [Re: XxDaTxX]
    #5037816 - 12/09/05 04:23 AM (18 years, 5 months ago)

OK.... Adding tryptamine to the substrate could possibly increase potency, but its presence also causes a downregulation of tryptohan's decarboxylase activity so it's going to limit the amount of Shikimate psilocybin produced bt the hyphae.

The results Gartz got were neat, though.... If only this could be duplicated. It would be interesting to find out how much is downregulated, too, which would be incredibly simple -- have 2 runs of mushrooms with the added Tryptamine and add glyphosate to one of them. The difference in alkaloid production is the weight that is NOT downregulated and still made by the fruitbody.

However, there are 2 compounds that are not inhibitors, so they may actually produce MORE alkaloids than tryptamine if they are properly digested by the mycelium:

5-Methoxy-N,N-dimethyltryptamine
-and-
5-Methoxytryptamine

I haven't seen anyone try these, but if they are not digested properly you won't really come out with anything. Just an idea.

(see http://www.shroomery.org/index.php/par/24373)

Tryptamine is decarboxylated tryptophan and a Google search for the two will yeild several preparations, some of which are all OTC and fairly easy. If you are doing the ones with metals, though, you may want to wash the product with a solution of EDTA to chelate the metals, as I believe Zn and Cu are toxic to the mushrooms.

Tryptophan is no longer sold because of a B.S. FDA regulation. I don't think it's a dietary suplement you can buy alone, but it's obviously available from biological sources. Someone here actually pointed me to a page that described how to isolate it from milk (however I don't have the link).

Just my 2c

--
Micro


--------------------
Any research paper or book for free
(Avatar is Maxxy, a character by Mizzyam, RIP)

Extras: Filter Print Post Top
Offlineradio943dmt
Stranger
Registered: 11/18/05
Posts: 16
Last seen: 17 years, 9 months
Re: The DMT and tryptamine connection [Re: micro]
    #5046421 - 12/10/05 11:39 PM (18 years, 5 months ago)

Ahh! Check this out.... from Ask Dr. Shulgin,

http://www.cognitiveliberty.org/shulgin/blg/

Quote:


4-Hydroxy-5-methoxy-N,N-dimethyltryptamine would be a fascinating compound to explore. The reason it's not in TIKHAL is that it is virtually unknown. The only report of it in the chemical literature was a paper published by Marc Julia's group at the Pasteur Institute in 1965. They reported the synthesis and physical properties of the compound but to my knowledge it has never been explored in any way. The synthesis is quite a frightening thing. It starts with ortho-vanillin and takes approximately 10 steps to get to the 4,5-HO-MeO-DMT. I'm not surprised that no one has pursued the compound.

However there is a very interesting study that took place in Leipzig about 15 years ago. Jochen Gartz, a mushroom explorer whom I know quite well, has done some fascinating studies with Psilocybe species by raising them on solid media containing strange tryptamines that are alien to the mushroom. Apparently the enzymes that are responsible for the 4-hydroxy group of psilocin are indifferent to what it is they choose to 4-hydroxylate. He has taken things like DPT or DIPT and put them in the growth media and the fruiting bodies that came out contain 4-hydroxy-DPT or 4-hydroxy-DIPT instead of psilocin. In fact, he has a patent on the process. These active compounds are made by the mushroom so they really are natural and yet they never have been observed in nature. I'll give you even odds that if you put spores of a psilocybe species on cow droppings loaded with 5-MeO-DMT you would come out with mushrooms containing 4,5-HO-MeO-DMT. This way you avoid a 10 step synthesis by growing a psychoactive mushroom that contains no illegal drug.





INTERESTING! . So being that the spores are legal almost everywhere, if this is true.. that adding enough of some other tryptamine stops psilocin/cybin production, technically you could legally grow mushrooms containing these things using cubensis spores possibly?

Well... i'm going to go through my box of tryptamines and see what I have, I only have a little bit of 5-MeO-DMT left its the HCl salt and i'd give it all up in the name of science (and possibly testing out a hopefully active new compound..). I am out of 5-MeO-MiPT.. I do have a little bit of AMT, but also 5-MeO-AMT.. and some others..

Maybe I will do some testing first, with as many jars as possible (I REALLY hope some others out there will help me along with this research! its fun shit..), maybe one jar with just tiny amounts of many tryptamines tossed in hoping to get a bunch of detectable amounts of 4-ho-whatever's out, so I can hopefully see what works and what doesn't.

VERY facinating! If the mycellium will take something like 5-MeO-whatever and add a 4-HO group to it, and they turn out active.. or take AMT and produce 4-HO-AMT.. well there's a lot of easily made compounds anyone could "synth up" at home out of their RC collection..

I would love it if some other people who had more mushroom growing experience would get on this, I only grew some once, if anyone has any tips on how to speed up the process, make it simpler (and/or fastest / easiest way to fruit them, maybe smaller jars, and what substrate to use, a good cubensis strain. etc etc) let me know - I will practice on just the ones with added tryptamine and mimosa bark first, then adding (mostly pure) DMT, get a good method down before trying other tryptamines so hopefully I don't fuck up any (or many!) with things like bacteria etc.

Extras: Filter Print Post Top
OfflineFospher
Crime FightingMaster Criminal
Male

Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 12 years, 6 months
Re: The DMT and tryptamine connection [Re: radio943dmt]
    #5050361 - 12/11/05 10:44 PM (18 years, 5 months ago)

Are you trying to say that the DMT compound of the 4-HO-DMT psilocybin make-up will be overrun by another tryptamine such as DiPT or AMT to make 4-HO-DiPT or 4-HO-AMT? If so, what good would adding DMT or 5-methoxy-DMT do besides possibly increasing the potency of the species?


--------------------
010001100100001001000101!

Extras: Filter Print Post Top
OfflineXxDaTxX
Stranger
Registered: 12/02/05
Posts: 13
Last seen: 10 years, 2 months
Re: The DMT and tryptamine connection *DELETED* *DELETED* [Re: micro]
    #5050642 - 12/11/05 11:53 PM (18 years, 5 months ago)

Post deleted by XxDaTxX

Reason for deletion: N/A


Extras: Filter Print Post Top
Offlineradio943dmt
Stranger
Registered: 11/18/05
Posts: 16
Last seen: 17 years, 9 months
Re: The DMT and tryptamine connection [Re: Fospher]
    #5052063 - 12/12/05 12:05 PM (18 years, 5 months ago)

Quote:

Are you trying to say that the DMT compound of the 4-HO-DMT psilocybin make-up will be overrun by another tryptamine such as DiPT or AMT to make 4-HO-DiPT or 4-HO-AMT? If so, what good would adding DMT or 5-methoxy-DMT do besides possibly increasing the potency of the species?




Possibly overrun yes, the point? Well, I could take something easily made from tryptamine like DALT (diallyltryptamine), and add it to substrate to use the fungi friends to biosynth me some 4-HO-DALT! (much more difficult to make!).

What good would it be to add DMT? Well, yes, to increase potency! If its as easy as adding one dollar's worth amount of mimosa root bark to a jar, for 2x-5x+ potency increase, who wouldn't want to?

As for adding 5-MeO-DMT well did you read any of my last post? Did you click on that Ask Dr. Shulgin link? He talks about the mushroom enzymes and possibly getting 4-HO-5-MeO-DMT out (which he's curious about the activity!) when you add 5-meo-dmt.

Those Gartz studies, show mostly psilocin coming out when adding DMT/DET/whatever (i mean the 4-hydroxy version and not the psilocybin equivalent, 4-phosphoryloxy-whatever).  So I mixed some KOH in some water and some phosphoric acid, adjusted to a ph of 4-5, so should be potassium phosphate, which I am going to experiment with, with some of these jars i'm going to inoculate with added ground mimosa hostilis bark to see if it helps the psilocin/psilocybin ratio - hopefully making not only super shrooms, but super shrooms that are extra stable :wink:.

I have access to the needed analysis equipment, plan to do experiments with varying amounts of added mimosa bark, tryptamine added, and various synthetic tryptamines added to see what comes out!

So what I figure is, i'll come back with some kick ass results to post everywhere, with ways to help calculate how much bark to add or this and that this and.. what?

Some people will go ahead and try it, get their asses reamed hard with a half gram of cubensis and start preaching the 'new way to grow' on the internet and it'll just take off.  Thats my guess anyway..

If azurescens are the most potent, and even those are like what, 2%? Looks like these easily grown super cubensis shrooms will easily blow those away.

Check out this link, for more detail and probably where i'd be updating the most at,

http://www.bluelight.ru/vb/showthread.php?t=232955

Extras: Filter Print Post Top
OfflineFospher
Crime FightingMaster Criminal
Male

Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 12 years, 6 months
Re: The DMT and tryptamine connection [Re: radio943dmt]
    #5057983 - 12/13/05 03:03 PM (18 years, 5 months ago)

Quote:

radio943dmt said:
Possibly overrun yes, the point?




Will it still be psychoactive with the replacement of DMT with another tryptamine? And if yes, will it be as potent?


--------------------
010001100100001001000101!

Edited by Fospher (12/13/05 03:09 PM)

Extras: Filter Print Post Top
OfflineFospher
Crime FightingMaster Criminal
Male

Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 12 years, 6 months
Re: The DMT and tryptamine connection [Re: radio943dmt]
    #5084591 - 12/20/05 01:39 AM (18 years, 4 months ago)

...any updates?


--------------------
010001100100001001000101!

Extras: Filter Print Post Top
Offlineradio943dmt
Stranger
Registered: 11/18/05
Posts: 16
Last seen: 17 years, 9 months
Re: The DMT and tryptamine connection [Re: Fospher]
    #5090227 - 12/21/05 02:29 PM (18 years, 4 months ago)

Quote:

Will it still be psychoactive with the replacement of DMT with another tryptamine? And if yes, will it be as potent?





Depends on which tryptamine you add. If you added lets say.. DiPT which you can order and get mushrooms with 4-HO-DiPT out, then yes that would definitely be active because 4-HO-DiPT has been sold online for years also (and a damn good psychedelic it is).

That link i posted up there to what Shulgin says about 4-HO-5-MeO-DMT, http://www.cognitiveliberty.org/shulgin/blg/ , he seems to guess that it will be active and should be explored but its such a pain in the ass to synthesize that.. well thats when he goes on about using mushrooms to do some cool synthesis for you.

There are a lot of tryptamines you could add that are available and probably active like DPT, MiPT, AMT and even 5-MeO-AMT which the 4-HO versions of those (just the AMT ones) haven't been tasted yet i don't think but would probably definitely be active.

Now i'd *really* like to get my hands on some DALT, in the 5-MeO-DALT entry from Shulgin's future book he mentions that 4-HO-DALT will probably be one of the fastest orally acting psychedelics, guessing like 10 minutes to come up after ingestion. I have a tiny bit if 5-MeO-DALT left which i could try tossing in there to see if i got any 4-HO-5-MeO-DALT out..

First couple i'd like to try adding are AMT and 5-MeO-DMT to see what comes out and hopefully get to taste them.

Extras: Filter Print Post Top
OfflineFospher
Crime FightingMaster Criminal
Male

Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 12 years, 6 months
Re: The DMT and tryptamine connection [Re: radio943dmt]
    #5093747 - 12/22/05 12:37 PM (18 years, 4 months ago)

A 'tiny bit', you're talking milligrams here?

If you're tossing such a small amount in with the substrate, wont most of it go to waste?


--------------------
010001100100001001000101!

Edited by Fospher (12/22/05 01:09 PM)

Extras: Filter Print Post Top
OfflineFospher
Crime FightingMaster Criminal
Male

Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 12 years, 6 months
Re: The DMT and tryptamine connection [Re: radio943dmt]
    #5093817 - 12/22/05 01:04 PM (18 years, 4 months ago)

Also, what would your predictions be on addition of Tryptamine or 5-Methoxy-Tryptamine (5-MeO-T) (and the difference thereof)?

According to the Tryptamine Cubensis study, a 3.3% percentage of psilocin increase from the regular <1% was documented in Cubensis, when a .25mm concentration of Tryptamine HcL was added to the substrate on a dried cow dung/rice-grain mixture. It also says that twice the amount of water needs to be used, which I dont quite understand. Does it need to be more than damp, and 90mm be used?

Edited by Fospher (12/22/05 04:34 PM)

Extras: Filter Print Post Top
OfflineFospher
Crime FightingMaster Criminal
Male

Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 12 years, 6 months
Re: The DMT and tryptamine connection [Re: Fospher]
    #5094680 - 12/22/05 04:50 PM (18 years, 4 months ago)

Shroomery really needs more people on this.

C'mon people, look alive! This is the a loophole that could last another 5 years before anyone catches on and the drug becomes another scheduled analogue.

Im just a pawn trying to extract all information possible, and with so many growers at this forum who's opinion and experience would be extremely valuable contributing, this project could speed up exponentially!

Contribute!


--------------------
010001100100001001000101!

Extras: Filter Print Post Top
OfflineBkultra
Male

Registered: 12/13/05
Posts: 177
Last seen: 6 years, 2 months
Re: The DMT and tryptamine connection [Re: XxDaTxX]
    #5095915 - 12/22/05 09:36 PM (18 years, 4 months ago)

I am currently extracting (N,N-DMT) and would be happy to test this but to be honest i do not have a complete lab to do so. They most i would be able to do is run a test by spliting my cake into two groups. One control group that i prep as normal and a 2nd that i can place some DMT extrat into each jar. I aslo have 10lbs of MHRB so i could try to add some into a caseing but I only do PF Cakes atm. As for 5-MeO-DMT I am still looking for the best way to extract it ( I dont think useing frogs is a very good method ) though I may be wrong.


--------------------
We had two bags of grass... pellets of mescaline... five sheets of high-powered blotter acid... a salt shaker half-full of cocaine... a whole galaxy of multicolored uppers, downers, screamers, laughers.     
Also a quart of tequila, a quart of rum, a case of beer...     
- a pint of raw ether...
- Shit !     
two dozen amyls.     
Not that we needed all that for the trip... but once you get locked into a serious drug collection... the tendency is to push it as far as you can.

Edited by Bkultra (12/22/05 09:37 PM)

Extras: Filter Print Post Top
OfflineXxDaTxX
Stranger
Registered: 12/02/05
Posts: 13
Last seen: 10 years, 2 months
Re: The DMT and tryptamine connection [Re: Bkultra]
    #5190652 - 01/17/06 10:59 AM (18 years, 4 months ago)

Tryptamine HCl works by getting around the normal regulatory mechanisms to yield 3.5% of your favorite alkaloid from a species that typically limited to ~0.5%.  DMT may work, but there are questions about yield that have not been addressed. Tryptamin HCl uptake seems to be less regulated, ergo 7x output, however DMT uptake seems to be less documented as far as yields of the final product.  If you can find Tryptamin HCl, why not let the fungus methylate and hydroxylate ... it is more than capable of doing so.  That is if you can find it!

If you're set on using DMT for whatever reason .... assuming you are using natural sources, in order to evaluate DMT as an option, one would first need to find out the form of DMT in its natural state (freebase or HCl salt).  If its the freebase then uptake may be severely limited.  If you are fairly adept in chemistry, and can isolate the freebase from these plant sources, then dissolve it in a min amount of dil. HCl and adjust to a pH of 6 from NaOH.  I wouldn't suggest nuking these in a PC either, with a MP of ~50-60 C it is very possible that sterilization would degrade a large amount of it.

In other words ... if you are going to try and do this easily ... try to use Tryptamine HCl ... not freebase Tryptamine ... not Tryptophan ... not DMT (unless the last paragraph made sense to you) ... but Tryptamin HCl.  AFOAFOAFOAFOAFOAF ... let call him SWIM says to do it like this: spawn bulk substrate in bags ... then when casing make a 25 mM solution of Tryptamine HCl and spray it into the substrate after removing it from the bag (ie. thin layer, spray, another thin layer, spray, etc) ... case .... fruit ... then take ONE SINGLE CAP ... and write to me later to thank me.    :grin:

Edited by XxDaTxX (01/17/06 11:29 AM)

Extras: Filter Print Post Top
OfflineFGL
Stranger

Registered: 06/25/05
Posts: 572
Last seen: 10 years, 26 days
Re: The DMT and tryptamine connection [Re: XxDaTxX]
    #5204186 - 01/20/06 08:09 PM (18 years, 3 months ago)

Quote:

XxDaTxX said:
let call him SWIM says to do it like this: spawn bulk substrate in bags ... then when casing make a 25 mM solution of Tryptamine HCl and spray it into the substrate after removing it from the bag (ie. thin layer, spray, another thin layer, spray, etc) ... case .... fruit ...




Doesnt it added comtams to the substrate?

Extras: Filter Print Post Top
OfflineXxDaTxX
Stranger
Registered: 12/02/05
Posts: 13
Last seen: 10 years, 2 months
Re: The DMT and tryptamine connection *DELETED* [Re: FGL]
    #5206322 - 01/21/06 12:35 PM (18 years, 3 months ago)

Post deleted by XxDaTxX

Reason for deletion: N/A


Extras: Filter Print Post Top
OfflineFGL
Stranger

Registered: 06/25/05
Posts: 572
Last seen: 10 years, 26 days
Re: The DMT and tryptamine connection [Re: XxDaTxX]
    #5206535 - 01/21/06 02:02 PM (18 years, 3 months ago)

so you mix the Tryptamine HCL with no sterile mineral water?

Extras: Filter Print Post Top
OfflineXxDaTxX
Stranger
Registered: 12/02/05
Posts: 13
Last seen: 10 years, 2 months
Re: The DMT and tryptamine connection *DELETED* [Re: FGL]
    #5208972 - 01/22/06 02:48 AM (18 years, 3 months ago)

Post deleted by XxDaTxX

Reason for deletion: N/A


Extras: Filter Print Post Top
OfflineFGL
Stranger

Registered: 06/25/05
Posts: 572
Last seen: 10 years, 26 days
Re: The DMT and tryptamine connection [Re: XxDaTxX]
    #5209416 - 01/22/06 08:30 AM (18 years, 3 months ago)

Thanks for your valuable info XxDaTxX !

Could you link for a good Tryptamine HCL extraction way?

Extras: Filter Print Post Top
OfflineFGL
Stranger

Registered: 06/25/05
Posts: 572
Last seen: 10 years, 26 days
Re: The DMT and tryptamine connection [Re: FGL]
    #5209425 - 01/22/06 08:32 AM (18 years, 3 months ago)

do you fix the Ph of the tryptamine HCL solution before spraying the substrate?

Extras: Filter Print Post Top
OfflineXxDaTxX
Stranger
Registered: 12/02/05
Posts: 13
Last seen: 10 years, 2 months
Re: The DMT and tryptamine connection *DELETED* [Re: FGL]
    #5210350 - 01/22/06 01:34 PM (18 years, 3 months ago)

Post deleted by XxDaTxX

Reason for deletion: N/A


Extras: Filter Print Post Top
OfflineFGL
Stranger

Registered: 06/25/05
Posts: 572
Last seen: 10 years, 26 days
Re: The DMT and tryptamine connection [Re: XxDaTxX]
    #5213465 - 01/23/06 08:09 AM (18 years, 3 months ago)

Thanks again XxDaTxX!
you have been of great help! :thumbup:

do you fix the Ph of the tryptamine HCL solution before spraying the substrate?

Extras: Filter Print Post Top
OfflineXxDaTxX
Stranger
Registered: 12/02/05
Posts: 13
Last seen: 10 years, 2 months
Re: The DMT and tryptamine connection *DELETED* [Re: FGL]
    #5216354 - 01/24/06 12:21 AM (18 years, 3 months ago)

Post deleted by XxDaTxX

Reason for deletion: N/A


Extras: Filter Print Post Top
OfflineFGL
Stranger

Registered: 06/25/05
Posts: 572
Last seen: 10 years, 26 days
Re: The DMT and tryptamine connection [Re: XxDaTxX]
    #5222829 - 01/25/06 06:27 PM (18 years, 3 months ago)

Sounds good!

Extras: Filter Print Post Top
OfflineFospher
Crime FightingMaster Criminal
Male

Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 12 years, 6 months
Re: The DMT and tryptamine connection [Re: radio943dmt]
    #5291169 - 02/12/06 11:10 AM (18 years, 3 months ago)

Here's what Im thinking.

I have just inoculated a pint jar with 8 grams of mimosa hostilis. Now after I get fruits, and the genetic makeup of the mushroom is already modified to produce like 10x more psilocin like the tryptamine cubensis thread stated, I take a print off the shroom, wouldnt it reproduce to the same potency?


--------------------
010001100100001001000101!

Extras: Filter Print Post Top
OfflinePsiloman
member
Male
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 8 months
Re: The DMT and tryptamine connection [Re: Fospher]
    #5291928 - 02/12/06 04:20 PM (18 years, 3 months ago)

How will the genetic makeup of the mushroom be modified to produce 10x?

Just by adding tryptamine or DMT or whatever, is not going to make a change in the mushrooms genome,lamarcism has been disproven a long time ago.

So in short,no if one uses mimosa hostilis in a jar he wont get a strain that gives 10x in potency .

Extras: Filter Print Post Top
OfflineFospher
Crime FightingMaster Criminal
Male

Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 12 years, 6 months
Re: The DMT and tryptamine connection [Re: Psiloman]
    #5291967 - 02/12/06 04:35 PM (18 years, 3 months ago)

Quote:

Psiloman said:
How will the genetic makeup of the mushroom be modified to produce 10x?




Addition of Tryptamine HCl, which could be substituted for addition of Mimosa Hostilis root (about 10g/pint) as proposed in this thread, could increase the psilocin amount to 10x+%, as noted in the Tryptamine Cubensis shroomery article.

Quote:


Just by adding tryptamine or DMT or whatever, is not going to make a change in the mushrooms genome,lamarcism has been disproven a long time ago.




Now, this is not relevant to Lamarkism, in the sense that the mushrooms did not "learn" to be more potent - they were born genetically modified. They were born different, weren't they? So why cant they reproduce differently as well?


--------------------
010001100100001001000101!

Extras: Filter Print Post Top
OfflinePsiloman
member
Male
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 8 months
Re: The DMT and tryptamine connection [Re: Fospher]
    #5292032 - 02/12/06 04:59 PM (18 years, 3 months ago)

Your flushes that grow on the enriched substrate that yoy have supplemented with MHRB ,can have higher potency ,i dotn disagree with it.

The mushrooms though wont be genetically modified because of the substrate,because of MHRB.Its DMT content will only act as a precursor.In the enriched substrate they wont be "born different",they will be just born like normal cubensis that happen to have a surplus of DMT (or any other tryptamine) in their growth medium.This means that if we take a sample of tissue to clone the mushroom or spores from the enriched substrate and put it in a non-enriched substrate the mushroom that will deriver from it wont have increased potency. Well,simply genetics dont work this way. If they did,lots of stuff would be easier in genetic engineering.

Well,the above is to be taken account ,unless you have another way in mind of altering the cubensis genome so as it could produce a raised potency.That could be done with "selective breeding" but thats a painstaking and timeconsuming proccess.

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: The DMT and tryptamine connection [Re: Psiloman]
    #5292109 - 02/12/06 05:30 PM (18 years, 3 months ago)

Right.

It's like suggesting:
If I give my mushroom lots of nutrients to grow very large, will its spores produce mushrooms that grow very large with little to no nutrient?

It is an extremely simplified example of nature vs. nurture. :smile:

Perhaps through selection of the most potent ones, one could establish a strain that makes the best usage of a DMT rich substrate? I don't know, suggesting out of my ass here. But the point is that the mushrooms had more precursors available to them. It wasn't a case of them being "born differently".


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
Invisiblespecial_k
Ketamine is myLSD

Registered: 08/04/06
Posts: 242
Loc: TX
Re: The DMT and tryptamine connection [Re: radio943dmt]
    #6846825 - 04/28/07 08:46 PM (17 years, 25 days ago)

We have been talking about this for years! Were any of these experiments tried? How did they go? I'm sure nothing was done but just in case I'm bumping this thread.

Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3  [ show all ]

Shop: PhytoExtractum Kratom Powder for Sale   Original Sensible Seeds Autoflowering Cannabis Seeds   North Spore Bulk Substrate   Myyco.com APE Liquid Culture For Sale   MagicBag.co All-In-One Bags That Don't Suck   Kraken Kratom Red Vein Kratom   Bridgetown Botanicals Bridgetown Botanicals   Left Coast Kratom Buy Kratom Capsules   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Mushroom-Hut Liquid Cultures   OlympusMyco.com Olympus Myco Bulk Substrate


Similar ThreadsPosterViewsRepliesLast post
* Ban Phang Ka, Acacia Experiment(DMT, Tryptamine Substrate )
( 1 2 all )
UnderNose 9,095 20 08/11/06 09:20 AM
by UnderNose
* Psilocybe biosynthesis image / addition of DMT/mimosa radio879 2,698 14 08/08/05 05:02 PM
by mycofile
* addition of DMT experiment - couple q's
( 1 2 3 all )
radio879 6,846 52 05/18/05 01:33 AM
by radio879
* Lets start fresh...DMT substrate
( 1 2 3 4 5 all )
Bleuboxo 26,328 98 05/18/06 06:48 AM
by nimmen
* MIMOSA BARK IN MAiLBOX!!!!!
( 1 2 all )
Bleuboxo 5,880 34 06/07/01 11:59 AM
by Opi
* Super-shrooms (DMT infused from desmanthus) :):):):)
( 1 2 3 all )
YourNameHere 8,623 48 03/31/05 10:41 AM
by Civ
* tryptamine inriched substrate
( 1 2 all )
michealjackstyle 5,119 22 02/10/05 01:06 AM
by micro
* Addition of 5-MeO-DMT to mushroom substrate
( 1 2 all )
RigaCrypto 8,185 21 12/17/06 05:57 PM
by RogerRabbit

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, Pastywhyte, bodhisatta
10,197 topic views. 1 members, 2 guests and 2 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.036 seconds spending 0.005 seconds on 12 queries.