|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Fospher
Crime FightingMaster Criminal


Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 14 years, 1 month
|
Re: The DMT and tryptamine connection [Re: radio943dmt]
#5291169 - 02/12/06 11:10 AM (19 years, 9 months ago) |
|
|
Here's what Im thinking.
I have just inoculated a pint jar with 8 grams of mimosa hostilis. Now after I get fruits, and the genetic makeup of the mushroom is already modified to produce like 10x more psilocin like the tryptamine cubensis thread stated, I take a print off the shroom, wouldnt it reproduce to the same potency?
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 12 years, 3 months
|
Re: The DMT and tryptamine connection [Re: Fospher]
#5291928 - 02/12/06 04:20 PM (19 years, 9 months ago) |
|
|
How will the genetic makeup of the mushroom be modified to produce 10x?
Just by adding tryptamine or DMT or whatever, is not going to make a change in the mushrooms genome,lamarcism has been disproven a long time ago.
So in short,no if one uses mimosa hostilis in a jar he wont get a strain that gives 10x in potency .
|
Fospher
Crime FightingMaster Criminal


Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 14 years, 1 month
|
Re: The DMT and tryptamine connection [Re: Psiloman]
#5291967 - 02/12/06 04:35 PM (19 years, 9 months ago) |
|
|
Quote:
Psiloman said: How will the genetic makeup of the mushroom be modified to produce 10x?
Addition of Tryptamine HCl, which could be substituted for addition of Mimosa Hostilis root (about 10g/pint) as proposed in this thread, could increase the psilocin amount to 10x+%, as noted in the Tryptamine Cubensis shroomery article.
Quote:
Just by adding tryptamine or DMT or whatever, is not going to make a change in the mushrooms genome,lamarcism has been disproven a long time ago.
Now, this is not relevant to Lamarkism, in the sense that the mushrooms did not "learn" to be more potent - they were born genetically modified. They were born different, weren't they? So why cant they reproduce differently as well?
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 12 years, 3 months
|
Re: The DMT and tryptamine connection [Re: Fospher]
#5292032 - 02/12/06 04:59 PM (19 years, 9 months ago) |
|
|
Your flushes that grow on the enriched substrate that yoy have supplemented with MHRB ,can have higher potency ,i dotn disagree with it.
The mushrooms though wont be genetically modified because of the substrate,because of MHRB.Its DMT content will only act as a precursor.In the enriched substrate they wont be "born different",they will be just born like normal cubensis that happen to have a surplus of DMT (or any other tryptamine) in their growth medium.This means that if we take a sample of tissue to clone the mushroom or spores from the enriched substrate and put it in a non-enriched substrate the mushroom that will deriver from it wont have increased potency. Well,simply genetics dont work this way. If they did,lots of stuff would be easier in genetic engineering.
Well,the above is to be taken account ,unless you have another way in mind of altering the cubensis genome so as it could produce a raised potency.That could be done with "selective breeding" but thats a painstaking and timeconsuming proccess.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: The DMT and tryptamine connection [Re: Psiloman]
#5292109 - 02/12/06 05:30 PM (19 years, 9 months ago) |
|
|
Right.
It's like suggesting: If I give my mushroom lots of nutrients to grow very large, will its spores produce mushrooms that grow very large with little to no nutrient?
It is an extremely simplified example of nature vs. nurture. 
Perhaps through selection of the most potent ones, one could establish a strain that makes the best usage of a DMT rich substrate? I don't know, suggesting out of my ass here. But the point is that the mushrooms had more precursors available to them. It wasn't a case of them being "born differently".
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
special_k
Ketamine is myLSD

Registered: 08/04/06
Posts: 242
Loc: TX
|
Re: The DMT and tryptamine connection [Re: radio943dmt]
#6846825 - 04/28/07 08:46 PM (18 years, 7 months ago) |
|
|
We have been talking about this for years! Were any of these experiments tried? How did they go? I'm sure nothing was done but just in case I'm bumping this thread.
|
|