Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Kratom Powder for Sale   North Spore Bulk Substrate   MagicBag.co Certified Organic All-In-One Grow Bags   Left Coast Kratom Buy Kratom Extract   Mushroom-Hut Mono Tub Substrate   Myyco.com Isolated Cubensis Liquid Culture For Sale

Jump to first unread post Pages: < Back | 1 | 2 | 3  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineFospher
Crime FightingMaster Criminal
Male

Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 12 years, 4 months
Re: The DMT and tryptamine connection [Re: radio943dmt]
    #5291169 - 02/12/06 11:10 AM (18 years, 1 month ago)

Here's what Im thinking.

I have just inoculated a pint jar with 8 grams of mimosa hostilis. Now after I get fruits, and the genetic makeup of the mushroom is already modified to produce like 10x more psilocin like the tryptamine cubensis thread stated, I take a print off the shroom, wouldnt it reproduce to the same potency?


--------------------
010001100100001001000101!

Extras: Filter Print Post Top
OfflinePsiloman
member
Male
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 6 months
Re: The DMT and tryptamine connection [Re: Fospher]
    #5291928 - 02/12/06 04:20 PM (18 years, 1 month ago)

How will the genetic makeup of the mushroom be modified to produce 10x?

Just by adding tryptamine or DMT or whatever, is not going to make a change in the mushrooms genome,lamarcism has been disproven a long time ago.

So in short,no if one uses mimosa hostilis in a jar he wont get a strain that gives 10x in potency .

Extras: Filter Print Post Top
OfflineFospher
Crime FightingMaster Criminal
Male

Registered: 02/09/05
Posts: 2,033
Loc: The Netherlands
Last seen: 12 years, 4 months
Re: The DMT and tryptamine connection [Re: Psiloman]
    #5291967 - 02/12/06 04:35 PM (18 years, 1 month ago)

Quote:

Psiloman said:
How will the genetic makeup of the mushroom be modified to produce 10x?




Addition of Tryptamine HCl, which could be substituted for addition of Mimosa Hostilis root (about 10g/pint) as proposed in this thread, could increase the psilocin amount to 10x+%, as noted in the Tryptamine Cubensis shroomery article.

Quote:


Just by adding tryptamine or DMT or whatever, is not going to make a change in the mushrooms genome,lamarcism has been disproven a long time ago.




Now, this is not relevant to Lamarkism, in the sense that the mushrooms did not "learn" to be more potent - they were born genetically modified. They were born different, weren't they? So why cant they reproduce differently as well?


--------------------
010001100100001001000101!

Extras: Filter Print Post Top
OfflinePsiloman
member
Male
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 6 months
Re: The DMT and tryptamine connection [Re: Fospher]
    #5292032 - 02/12/06 04:59 PM (18 years, 1 month ago)

Your flushes that grow on the enriched substrate that yoy have supplemented with MHRB ,can have higher potency ,i dotn disagree with it.

The mushrooms though wont be genetically modified because of the substrate,because of MHRB.Its DMT content will only act as a precursor.In the enriched substrate they wont be "born different",they will be just born like normal cubensis that happen to have a surplus of DMT (or any other tryptamine) in their growth medium.This means that if we take a sample of tissue to clone the mushroom or spores from the enriched substrate and put it in a non-enriched substrate the mushroom that will deriver from it wont have increased potency. Well,simply genetics dont work this way. If they did,lots of stuff would be easier in genetic engineering.

Well,the above is to be taken account ,unless you have another way in mind of altering the cubensis genome so as it could produce a raised potency.That could be done with "selective breeding" but thats a painstaking and timeconsuming proccess.

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: The DMT and tryptamine connection [Re: Psiloman]
    #5292109 - 02/12/06 05:30 PM (18 years, 1 month ago)

Right.

It's like suggesting:
If I give my mushroom lots of nutrients to grow very large, will its spores produce mushrooms that grow very large with little to no nutrient?

It is an extremely simplified example of nature vs. nurture. :smile:

Perhaps through selection of the most potent ones, one could establish a strain that makes the best usage of a DMT rich substrate? I don't know, suggesting out of my ass here. But the point is that the mushrooms had more precursors available to them. It wasn't a case of them being "born differently".


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
Invisiblespecial_k
Ketamine is myLSD

Registered: 08/04/06
Posts: 242
Loc: TX
Re: The DMT and tryptamine connection [Re: radio943dmt]
    #6846825 - 04/28/07 08:46 PM (16 years, 10 months ago)

We have been talking about this for years! Were any of these experiments tried? How did they go? I'm sure nothing was done but just in case I'm bumping this thread.

Extras: Filter Print Post Top
Jump to top Pages: < Back | 1 | 2 | 3  [ show all ]

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Kratom Powder for Sale   North Spore Bulk Substrate   MagicBag.co Certified Organic All-In-One Grow Bags   Left Coast Kratom Buy Kratom Extract   Mushroom-Hut Mono Tub Substrate   Myyco.com Isolated Cubensis Liquid Culture For Sale


Similar ThreadsPosterViewsRepliesLast post
* Ban Phang Ka, Acacia Experiment(DMT, Tryptamine Substrate )
( 1 2 all )
UnderNose 9,094 20 08/11/06 09:20 AM
by UnderNose
* Psilocybe biosynthesis image / addition of DMT/mimosa radio879 2,694 14 08/08/05 05:02 PM
by mycofile
* addition of DMT experiment - couple q's
( 1 2 3 all )
radio879 6,844 52 05/18/05 01:33 AM
by radio879
* Lets start fresh...DMT substrate
( 1 2 3 4 5 all )
Bleuboxo 26,295 98 05/18/06 06:48 AM
by nimmen
* MIMOSA BARK IN MAiLBOX!!!!!
( 1 2 all )
Bleuboxo 5,877 34 06/07/01 11:59 AM
by Opi
* Super-shrooms (DMT infused from desmanthus) :):):):)
( 1 2 3 all )
YourNameHere 8,615 48 03/31/05 10:41 AM
by Civ
* tryptamine inriched substrate
( 1 2 all )
michealjackstyle 5,107 22 02/10/05 01:06 AM
by micro
* Addition of 5-MeO-DMT to mushroom substrate
( 1 2 all )
RigaCrypto 8,171 21 12/17/06 05:57 PM
by RogerRabbit

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, Pastywhyte, bodhisatta
10,186 topic views. 0 members, 1 guests and 1 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.023 seconds spending 0.006 seconds on 12 queries.