|
RatherBeAlone13
Stranger
Registered: 11/07/05
Posts: 184
Last seen: 17 years, 5 months
|
Police searched my car today... *DELETED*
#4923240 - 11/11/05 05:50 PM (18 years, 4 months ago) |
|
|
Post deleted by RatherBeAlone13Reason for deletion: paranoid
|
RESTLESS
C.M.L.W.
Registered: 06/21/05
Posts: 21,817
|
|
--------------------
|
dnL
stranger thanstrange
Registered: 09/02/03
Posts: 668
|
Re: Police searched my car today... [Re: RESTLESS]
#4923262 - 11/11/05 05:54 PM (18 years, 4 months ago) |
|
|
half a quarter pound, wouldn't it be easier to say 2 0z's
either way, you better be smoking a shitload of it tonight
peace!
--------------------
|
FL_accciD
Jack's Paranoia
Registered: 11/04/04
Posts: 1,665
Loc: midwest
Last seen: 15 years, 8 months
|
Re: Police searched my car today... [Re: RESTLESS]
#4923263 - 11/11/05 05:54 PM (18 years, 4 months ago) |
|
|
pop quiz dude: half a quarter pound? is that like about three quarters?
-------------------- - - - T H E E N D - - -
|
McKennaFan200
AmateurGairologist
Registered: 04/30/04
Posts: 5,395
Last seen: 10 years, 5 months
|
|
Quote:
RatherBeAlone13 said: I heard that hiding stuff in with your engine is a good idea, as long as its not too hot.
Sounds like a winner.
-------------------- "It seemed to me culture is a shabby lie. Or at least this culture is a shabby lie. If you work like a dog, you get 260 channels of bad television and a German automobile. What kind of perfection is that?"-McKenna
|
Fade_To_Black
Fire It Up
Registered: 12/26/03
Posts: 1,406
Last seen: 3 years, 6 months
|
Re: Police searched my car today... [Re: FL_accciD]
#4923273 - 11/11/05 05:56 PM (18 years, 4 months ago) |
|
|
::head explodes::
--------------------
|
RatherBeAlone13
Stranger
Registered: 11/07/05
Posts: 184
Last seen: 17 years, 5 months
|
Re: Police searched my car today... [Re: McKennaFan200]
#4923281 - 11/11/05 05:58 PM (18 years, 4 months ago) |
|
|
Quote:
McKennaFan200 said:
Sounds like a winner.
Would u rather have it in tha car with you? Or safely tucked away in tha engine ?
--------------------
|
trendal
J♠
Registered: 04/17/01
Posts: 20,815
Loc: Ontario, Canada
|
|
If you stick it in the engine, the engine will heat up the pot and make it smell a LOT more. I suspect so, anyway. Heat makes things smell more.
--------------------
Once, men turned their thinking over to machines in the hope that this would set them free. But that only permitted other men with machines to enslave them.
|
McKennaFan200
AmateurGairologist
Registered: 04/30/04
Posts: 5,395
Last seen: 10 years, 5 months
|
|
I mean....hot engine...plastic bags...just setting yourself up for something going wrong.
-------------------- "It seemed to me culture is a shabby lie. Or at least this culture is a shabby lie. If you work like a dog, you get 260 channels of bad television and a German automobile. What kind of perfection is that?"-McKenna
|
dnL
stranger thanstrange
Registered: 09/02/03
Posts: 668
|
|
Quote:
RatherBeAlone13 said:
Quote:
McKennaFan200 said:
Sounds like a winner.
Would u rather have it in tha car with you? Or safely tucked away in tha engine ?
safely in the engine? isn't that some kind of oxymoron
the best place is in a locked briefcase, inside your locked trunk. they need a search warrant to open the briefcase
but i mean, is 2 oz's really that hard to hide anyways?
--------------------
|
debianlinux
Myconerd - DBK
Registered: 12/09/02
Posts: 8,334
Loc: Over There
Last seen: 8 months, 20 days
|
|
what did you get ticketed for?
|
Fade_To_Black
Fire It Up
Registered: 12/26/03
Posts: 1,406
Last seen: 3 years, 6 months
|
|
in the car.. that way it will crank..
--------------------
|
RatherBeAlone13
Stranger
Registered: 11/07/05
Posts: 184
Last seen: 17 years, 5 months
|
Re: Police searched my car today... [Re: McKennaFan200]
#4923341 - 11/11/05 06:12 PM (18 years, 4 months ago) |
|
|
Quote:
McKennaFan200 said: I mean....hot engine...plastic bags...just setting yourself up for something going wrong.
Did I say anything about plastic bags?
No.
--------------------
|
dnL
stranger thanstrange
Registered: 09/02/03
Posts: 668
|
|
Quote:
RatherBeAlone13 said:
Quote:
McKennaFan200 said: I mean....hot engine...plastic bags...just setting yourself up for something going wrong.
Did I say anything about plastic bags?
No.
did you have the weed in metal containers then or what?
--------------------
|
Fade_To_Black
Fire It Up
Registered: 12/26/03
Posts: 1,406
Last seen: 3 years, 6 months
|
Re: Police searched my car today... [Re: dnL]
#4923360 - 11/11/05 06:16 PM (18 years, 4 months ago) |
|
|
it was in the cylinders..
--------------------
Edited by Fade_To_Black (11/11/05 06:16 PM)
|
StrandedVoyager
The People's Champ
Registered: 12/09/04
Posts: 3,236
Loc: (202)-456-1414 Call Me
Last seen: 7 years, 7 months
|
|
Do you think cops ever read these message boards and kick themselves in the ass?
Just the mental image of a cop on his computer in between the kiddy porn and stormfront.org banging his head on the keyboard because he missed a spot in his search is very appealing to me.
-------------------- Hi My god... it's full of stars...
|
RatherBeAlone13
Stranger
Registered: 11/07/05
Posts: 184
Last seen: 17 years, 5 months
|
Re: Police searched my car today... [Re: dnL]
#4923374 - 11/11/05 06:20 PM (18 years, 4 months ago) |
|
|
Quote:
dnL said:
Quote:
RatherBeAlone13 said:
Quote:
McKennaFan200 said: I mean....hot engine...plastic bags...just setting yourself up for something going wrong.
Did I say anything about plastic bags?
No.
did you have the weed in metal containers then or what?
No its not in a metal container. But you gotta understand, not everywhere under tha hood is hot, for example, inside your air box, as long as you are not obstucting tha air flow.
--------------------
|
RatherBeAlone13
Stranger
Registered: 11/07/05
Posts: 184
Last seen: 17 years, 5 months
|
|
All is Im trying to say is, wouldnt you feel safer if your stuff was hidden under tha hood, where you know it wont be found; then somewhere else?
--------------------
|
ZippoZ
Knomadic
Registered: 06/17/03
Posts: 13,227
Loc: Pongyang, North Korea
|
|
if you have a beater like everyone else here... do this,
get a stash can of fix a flat or somthign else automotive, rough it up so it looks old. then throw it in a box with a bunch of tools and car shit.
works great, or the airbox
-------------------- PEACE zippoz "in times of widespread chaos and confusion, it has been the duty of more advanced human beings - artists, scientists, clowns, and philosophers - to create order. In such times as ours however, when there is too much order, too much m management, too much programming and control, it becomes the duty of superior men and women and women to fling their favorite monkey wrenches into the machinery. To relieve the repression of the human spirit, they must sow doubt and disruption" "People do it every day, they talk to themselves ... they see themselves as they'd like to be, they don't have the courage you have, to just run with it."
|
Fade_To_Black
Fire It Up
Registered: 12/26/03
Posts: 1,406
Last seen: 3 years, 6 months
|
|
would it really matter if they sent the dogs out?
--------------------
|
trendal
J♠
Registered: 04/17/01
Posts: 20,815
Loc: Ontario, Canada
|
|
What do you mean "know it won't be found"???
All they'd need is a K9 unit, if they suspected drugs. I'm sure the dogs can smell it no matter where you put it.
--------------------
Once, men turned their thinking over to machines in the hope that this would set them free. But that only permitted other men with machines to enslave them.
|
RatherBeAlone13
Stranger
Registered: 11/07/05
Posts: 184
Last seen: 17 years, 5 months
|
Re: Police searched my car today... [Re: trendal]
#4923396 - 11/11/05 06:27 PM (18 years, 4 months ago) |
|
|
k, well I guess thats true. But I would/will feel a lot safer tho with it packed away.
--------------------
|
psilog
{o:o}
Registered: 08/10/05
Posts: 581
Loc: home on the range
Last seen: 2 months, 22 days
|
Re: Police searched my car today... [Re: trendal]
#4923405 - 11/11/05 06:30 PM (18 years, 4 months ago) |
|
|
Quote:
trendal said:
All they'd need is a K9 unit, if they suspected drugs. I'm sure the dogs can spell it no matter where you put it.
Those dogs become extremely smart when provoked with drugs...
--------------------
|
LethalX5
Registered: 01/07/05
Posts: 2,176
Last seen: 7 years, 7 months
|
|
Quote:
RatherBeAlone13 said: k, well I guess thats true. But I would/will feel a lot safer tho with it packed away.
then when they find it hidden in your car they get to keep it....
-------------------- "To get what you've never had, You must do what you've never done."
|
Fade_To_Black
Fire It Up
Registered: 12/26/03
Posts: 1,406
Last seen: 3 years, 6 months
|
Re: Police searched my car today... [Re: psilog]
#4923424 - 11/11/05 06:37 PM (18 years, 4 months ago) |
|
|
ive always wondered if asshole cops can give a hand/voice signal to a K9 unit to bark, sit, or whatever and lie to the person in question saying that the dog smelled narcotics, just to search without probable cause.
--------------------
|
trendal
J♠
Registered: 04/17/01
Posts: 20,815
Loc: Ontario, Canada
|
Re: Police searched my car today... [Re: psilog]
#4923479 - 11/11/05 06:56 PM (18 years, 4 months ago) |
|
|
Quote:
psilog said: Those dogs become extremely smart when provoked with drugs...
whoops!
--------------------
Once, men turned their thinking over to machines in the hope that this would set them free. But that only permitted other men with machines to enslave them.
|
buckwheat
Cynically Insane
Registered: 12/09/02
Posts: 11,179
Loc: Not Enough Characters to ...
|
|
I was thinking of hiding places the other day and a motorcyle is perfect.
1.Cops dont expect drugs to be on bikes
2.You need tools to get to some of the places you can put drugs in,and it can be a pain in the ass if you dont know that bike. that kind of effort would require a drug dog so that brings us back to number 1
|
leery11
I Tell You What!
Registered: 06/24/05
Posts: 5,998
Last seen: 8 years, 11 months
|
Re: Police searched my car today... [Re: buckwheat]
#4923515 - 11/11/05 07:07 PM (18 years, 4 months ago) |
|
|
why did you consent to search in the first place?
-------------------- I am the MacDaddy of Heimlich County, I play it Straight Up Yo! ....I embrace my desire to feel the rhythm, to feel connected enough to step aside and weep like a widow, to feel inspired, to fathom the power, to witness the beauty, to bathe in the fountain, to swing on the spiral of our divinity and still be a human...... Om Namah Shivaya, I tell you What!
|
RatherBeAlone13
Stranger
Registered: 11/07/05
Posts: 184
Last seen: 17 years, 5 months
|
Re: Police searched my car today... [Re: leery11]
#4923526 - 11/11/05 07:09 PM (18 years, 4 months ago) |
|
|
Quote:
leery11 said: why did you consent to search in the first place?
He said my car smells like weed.
Which is definately true, even smells like it to me. Since I smoke in there all tha time.
I was just asking for troble.
--------------------
|
leery11
I Tell You What!
Registered: 06/24/05
Posts: 5,998
Last seen: 8 years, 11 months
|
|
ahhh.... that was lucky then!
-------------------- I am the MacDaddy of Heimlich County, I play it Straight Up Yo! ....I embrace my desire to feel the rhythm, to feel connected enough to step aside and weep like a widow, to feel inspired, to fathom the power, to witness the beauty, to bathe in the fountain, to swing on the spiral of our divinity and still be a human...... Om Namah Shivaya, I tell you What!
|
RatherBeAlone13
Stranger
Registered: 11/07/05
Posts: 184
Last seen: 17 years, 5 months
|
Re: Police searched my car today... [Re: leery11]
#4923540 - 11/11/05 07:13 PM (18 years, 4 months ago) |
|
|
It was lucky.
I wonder how much time id be doing?
--------------------
|
thegatewaydrug
my burning sunwill some dayrise
Registered: 11/15/04
Posts: 6,987
Loc: wherever i may roam
|
|
possession and intent to sell are the only charges i can think of right now
-------------------- May God have mercy upon my enemies, because i won't. General George S. Patton
|
ipickPA
newbie
Registered: 11/16/03
Posts: 332
Last seen: 11 years, 11 months
|
Re: Police searched my car today... [Re: thegatewaydrug]
#4923561 - 11/11/05 07:23 PM (18 years, 4 months ago) |
|
|
mindcandy, those slick biker's have already thought of using motorcycle's to transport meth. They hide it in their crankcases, hence meth=crank.
|
thegatewaydrug
my burning sunwill some dayrise
Registered: 11/15/04
Posts: 6,987
Loc: wherever i may roam
|
Re: Police searched my car today... [Re: buckwheat]
#4923566 - 11/11/05 07:27 PM (18 years, 4 months ago) |
|
|
i hope not, iv been pulled over one time when i was out riding and he coulda sworn he smelled weed on me (which was impossible cause i didnt smoke the whole day and i had nothing on me), so he asked to search me and my backpack, i agreed and like i expected he turned up with nothing and let me go. most of the time pigs will just say they smell somethin just to bug u. btw i have a few friends that ride all day with an O or more in their back pack, they just go around selling it all day cause 1. gas is better and 2. u get around faster
-------------------- May God have mercy upon my enemies, because i won't. General George S. Patton
|
buckwheat
Cynically Insane
Registered: 12/09/02
Posts: 11,179
Loc: Not Enough Characters to ...
|
Re: Police searched my car today... [Re: ipickPA]
#4923571 - 11/11/05 07:30 PM (18 years, 4 months ago) |
|
|
Quote:
ipickPA said: mindcandy, those slick biker's have already thought of using motorcycle's to transport meth. They hide it in their crankcases, hence meth=crank.
woah thats funny as hell who would have thought.
|
buckwheat
Cynically Insane
Registered: 12/09/02
Posts: 11,179
Loc: Not Enough Characters to ...
|
Re: Police searched my car today... [Re: thegatewaydrug]
#4923575 - 11/11/05 07:31 PM (18 years, 4 months ago) |
|
|
Quote:
thegatewaydrug said: btw i have a few friends that ride all day with an O or more in their back pack, they just go around selling it all day cause 1. gas is better and 2. u get around faster
iv'e had similar thought as your friends
i would put it in the tool box under the faring though back packs are always gonna get searched
Edited by mindcandy (11/11/05 07:32 PM)
|
Vvellum
Stranger
Registered: 05/24/04
Posts: 10,920
|
|
Quote:
RatherBeAlone13 said:
Quote:
leery11 said: why did you consent to search in the first place?
He said my car smells like weed.
Which is definately true, even smells like it to me. Since I smoke in there all tha time.
I was just asking for troble.
that's why you never smoke in the car or drive like a dumbass while holding. seriously, cars are how most people get busted. hope you're more careful next time - you dont want that trouble.
|
recalcitrant
My Own God
Registered: 04/20/02
Posts: 2,927
Loc: Canada West
Last seen: 7 years, 10 months
|
Re: Police searched my car today... [Re: Vvellum]
#4924619 - 11/12/05 12:01 AM (18 years, 4 months ago) |
|
|
Quote:
bi0 said: cars are how most people get busted.
I got busted last month driving a U-Haul for my neighbour. It was a seriously fucked up situation.
I have court on the 15th. Wish me luck.
-------------------- We have to answer our own prayers
|
AliceDee
-L S D-
Registered: 08/10/03
Posts: 3,957
|
Re: Police searched my car today... [Re: recalcitrant]
#4924800 - 11/12/05 12:50 AM (18 years, 4 months ago) |
|
|
ive hid a QP in the engine area before... i put a couple bags around it and put it near the intake (its one of those intakes enclosed in a box) and nothing bad happend.. ( i didnt really drive that far but still... plus the weed was vacuum sealed so no smell...
best place to hide shit is your spare tire... let the gas out and fill er up with whatever guns, drugs, anything... then gas the tire back up... this way is also smell profe so no dogs can smell it....
btw for future reference... a cop cant search you unless he has reasonable suspicion.. so he actually has to see you smoking it or see evidence in your car... even if your acting nervous he cant do shit... even if he smells it he cant search you... they cant even detain you either unless they have reasonable suspicion, so just dont say anything, dont answer ANY of his questions, and just ask politely for your ticket so you can get outta there... the cops make you think smell is reasonable suspicion becuase the cop will tell you he smells marijauana... if you say its probably this incence i just burned, then your off, but if you admit to anything then thats automatically giving him the right to search even if his "assumption" was wrong and he didnt find anything...
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 10 months, 13 days
|
Re: Police searched my car today... [Re: AliceDee]
#4924828 - 11/12/05 01:01 AM (18 years, 4 months ago) |
|
|
two glaring errors, sadly.
1- Dogs can detect the presence of the substances they are trained to search for through most barriers you can think of. Glass jars, foodsaver bags, metal tins/crates, and certainly something porous such as a tire. I have seen this demonstrated, in person. The nose of most dogs is many, MANY times more sensitive than humans, or indeed a number of other creatures. If it weren't for this incredible sense of smell, the use of search and rescue dogs would be far less worth the effort, as would contraban sniffing dogs. Admittedly it's harder for a dog to smell sealed bags of marijuana stuffed into a spare tire... but it is not beyond their ability. They may overlook it for lack of attention paid within sufficient proximity, but they CAN smell it.
2- As part of a legal agreement to be granted a license to drive you consent to the authority of law enforcement officials to search your vehicle whenever they deem it necessary. The decision to search is entirely in their hands and they need no warrant nor permission from you or a judge. If the police desire to search your vehicle they will search your vehicle and if you resist you will go to jail or be detained. And that's just making things worse, because if you're jailed your vehicle ends up in the impound lot, where is is MUCH easier to perform a more thorough search. And if he has to detain you his suspicion is aroused and he will be looking for the reason you made a fuss.
Please... do not post that kind of misinformation. That dual-edged error could potentially overinflate someone's confidence with fallacies percieved as truth, which may lead to them making a decision that leads to many years in jail.
-------------------- I find your lack of faith disturbing
|
THE KRAT BARON
one-eyed willie
Registered: 07/08/03
Posts: 42,409
|
|
You could always rig up your wheel wells. A friend of mine jury rigged his wells up for weight.
-------------------- m00nshine is currently vacationing in Maui. Rumor has it he got rolled by drunken natives and is currently prostituting himself in order to pay for airfare back to the mainland but he's having trouble juggling a hairon addiction. He won't be back for a long while.
Edited by Learyfan (11/12/05 06:19 AM)
|
RESTLESS
C.M.L.W.
Registered: 06/21/05
Posts: 21,817
|
Re: Police searched my car today... [Re: THE KRAT BARON]
#4924901 - 11/12/05 01:27 AM (18 years, 4 months ago) |
|
|
Are you allowed to say jury in the pub?
--------------------
Edited by Learyfan (11/12/05 06:19 AM)
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 10 months, 13 days
|
Re: Police searched my car today... [Re: RESTLESS]
#4924973 - 11/12/05 02:13 AM (18 years, 4 months ago) |
|
|
well if not, the two of you are both screwed
-------------------- I find your lack of faith disturbing
|
RESTLESS
C.M.L.W.
Registered: 06/21/05
Posts: 21,817
|
Re: Police searched my car today... [Re: Konnrade]
#4924981 - 11/12/05 02:23 AM (18 years, 4 months ago) |
|
|
--------------------
|
Microcosmatrix
Spiral staircasetechnician
Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 3 months
|
Re: Police searched my car today... [Re: Konnrade]
#4924990 - 11/12/05 02:34 AM (18 years, 4 months ago) |
|
|
Quote:
2- As part of a legal agreement to be granted a license to drive you consent to the authority of law enforcement officials to search your vehicle whenever they deem it necessary. The decision to search is entirely in their hands and they need no warrant nor permission from you or a judge.
That's bullshit, sorry. They DO need probable cause, a warrant, or permission.
Even if some states are making it a condition of getting a driver's licence to consent to search, (which is new to me if they are), you can still refuse to allow a search and the most that could happen is you lose the driver's licence, (but they get no legal search and no big felony arrest.)
Like the deal with the breathalizer, you do still have a choice.
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 10 months, 13 days
|
Re: Police searched my car today... [Re: Microcosmatrix]
#4925010 - 11/12/05 03:03 AM (18 years, 4 months ago) |
|
|
Well that's the way things work here in this city anyhow.
I guess my area is a bad place to have drugs in your car when visiting.
-------------------- I find your lack of faith disturbing
|
lid
Insert TitleHere
Registered: 10/12/05
Posts: 563
Loc: People's Republic of New ...
Last seen: 10 years, 7 months
|
Re: Police searched my car today... [Re: Konnrade]
#4925027 - 11/12/05 03:16 AM (18 years, 4 months ago) |
|
|
that sucks man! When i was 21 I got pulled over so much in a 3 month period (never got ticketed, just harassed) that it got to the point that I could tell the police were behind me just from the shape of their headlights in the mirrors. Funny thing is, I would pull over before their lights came on and before i did anything ticket worthy, and they would swerve onto the shoulder behind me. I always loved taking them by suprise with that.
-------------------- molon labe.
Edited by lid (11/12/05 03:17 AM)
|
hawksapprentice
Yearns to Snowboard
Registered: 06/06/03
Posts: 3,195
Loc: Oregon
Last seen: 9 months, 24 days
|
Re: Police searched my car today... [Re: lid]
#4925136 - 11/12/05 05:29 AM (18 years, 4 months ago) |
|
|
I have always known what the police cars healights look like in my rear view. But now they're driving Yukons and shit, getting too hard to keep track of them all.
-------------------- "I celebrate the Earth, my home, my mother, my grave, and as long as men are Man they must, if they would preserve the integrated being, do the same---[and preserve]--this rank casual hungry smelly sweaty lusting transitory body, my oozy pulpy liquid-bag-swollen body, bones, blood, hair glands, my bejeweled sex; I love and celebrate it all. never to let men forget that they are animals as much as gods---that is one thing I shall say." Edward Abbey
|
Learyfan
It's the psychedelic movement!
Registered: 04/20/01
Posts: 34,168
Loc: High pride!
Last seen: 4 hours, 54 minutes
|
Re: Police searched my car today... [Re: Microcosmatrix]
#4925192 - 11/12/05 06:50 AM (18 years, 4 months ago) |
|
|
Quote:
Microcosmatrix said: They DO need probable cause, a warrant, or permission.
That's what I was thinking. They do need probable cause. A cop can define "probable cause" however he/she pleases, but they do need it. If they ask you if they can search your car, you can refuse as long as you have a good excuse as to why they can't. In 2002 I was pulled over for speeding. I had read a post about your rights regarding a search on this very site just one day prior and had my story ready to go. I had weed and Adderall in the trunk when I was pulled over. While the cop was writing my ticket, I thought my story through. The cop asked to search my vehicle and I said "No, I really need to be going right now." He asked why and I told him that I was meeting my parents for dinner and that I was late. I then changed the subject because I knew he had no probable cause.
Hey ratherbealone, why were you pulled over? How long before being pulled over had you smoked in your car?
-------------------- -------------------------------- Mp3 of the month: Sons Of Adam - Feathered Fish
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: Learyfan]
#4925193 - 11/12/05 06:52 AM (18 years, 4 months ago) |
|
|
Quote:
Learyfan said: you can refuse as long as you have a good excuse as to why they can't.
cops need a reason to search, you dont need a reason why they cant, being able to articulate why they cant is better than a simple 'no' but that no will suffice since it is your property/privacy that they intend to invade.
|
Learyfan
It's the psychedelic movement!
Registered: 04/20/01
Posts: 34,168
Loc: High pride!
Last seen: 4 hours, 54 minutes
|
Re: Police searched my car today... [Re: Prisoner#1]
#4925198 - 11/12/05 06:59 AM (18 years, 4 months ago) |
|
|
Quote:
Prisoner#1 said:
Quote:
Learyfan said: you can refuse as long as you have a good excuse as to why they can't.
cops need a reason to search, you dont need a reason why they cant, being able to articulate why they cant is better than a simple 'no' but that no will suffice since it is your property/privacy that they intend to invade.
Technically you're very right. I could be wrong, but it just seems to me that if you were to respond with that simple "no", he could possibly use your lack of an excuse as "probable cause"?
-------------------- -------------------------------- Mp3 of the month: Sons Of Adam - Feathered Fish
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: Learyfan]
#4925236 - 11/12/05 07:47 AM (18 years, 4 months ago) |
|
|
any refusal to allow a search cannot be used as probable cause, the supreme court backs yo on that one, a cop can make a claim that by refusing a search you've got something to hide but if he is unable to articulate what presents probable cause in your given search you're case would quickly be dismissed.
|
ShroomArtist84
Stranger
Registered: 08/09/05
Posts: 2,414
Last seen: 18 years, 1 month
|
Re: Police searched my car today... [Re: Prisoner#1]
#4925248 - 11/12/05 07:57 AM (18 years, 4 months ago) |
|
|
nice.
-------------------- No matter what I say and no matter what I write here. I'm sick of always looking at this page with a blank stare.
|
Ramlaen
Pysconaut
Registered: 11/06/04
Posts: 638
Last seen: 13 years, 2 months
|
Re: Police searched my car today... [Re: ShroomArtist84]
#4925263 - 11/12/05 08:05 AM (18 years, 4 months ago) |
|
|
We should start a Just Say no to searches campaign
|
Learyfan
It's the psychedelic movement!
Registered: 04/20/01
Posts: 34,168
Loc: High pride!
Last seen: 4 hours, 54 minutes
|
Re: Police searched my car today... [Re: Prisoner#1]
#4925452 - 11/12/05 10:55 AM (18 years, 4 months ago) |
|
|
Quote:
Prisoner#1 said: any refusal to allow a search cannot be used as probable cause, the supreme court backs yo on that one, a cop can make a claim that by refusing a search you've got something to hide but if he is unable to articulate what presents probable cause in your given search you're case would quickly be dismissed.
That sounds right, P1. I just don't trust the police. Perhaps I should have stated that having an excuse isn't necessary, but it would certainly help. It seems to me that a cop who wants to search you can always say he "smelled marijuana" on you. That excuse would always work.
-------------------- -------------------------------- Mp3 of the month: Sons Of Adam - Feathered Fish
|
Noviseer
Percussion isFree
Registered: 03/18/03
Posts: 3,994
Last seen: 9 years, 3 months
|
Re: Police searched my car today... [Re: Konnrade]
#4925478 - 11/12/05 11:13 AM (18 years, 4 months ago) |
|
|
Quote:
Konnrade said:
2- As part of a legal agreement to be granted a license to drive you consent to the authority of law enforcement officials to search your vehicle whenever they deem it necessary. The decision to search is entirely in their hands and they need no warrant nor permission from you or a judge. If the police desire to search your vehicle they will search your vehicle and if you resist you will go to jail or be detained. And that's just making things worse, because if you're jailed your vehicle ends up in the impound lot, where is is MUCH easier to perform a more thorough search. And if he has to detain you his suspicion is aroused and he will be looking for the reason you made a fuss.
Are you sure about that? I know they're allowed to search for weaponry, but to legally seize drugs they've got to respect due process somehow--reasonable suspicion or something.
-------------------- _______________________________________________________________ namaste said: no flamz in da ODD, if you got nothing to contribute then keep yo lips zipped _________________________________________________________________
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: Learyfan]
#4925613 - 11/12/05 12:14 PM (18 years, 4 months ago) |
|
|
Quote:
Learyfan said: It seems to me that a cop who wants to search you can always say he "smelled marijuana" on you. That excuse would always work.
most cops record via video or wireless mirophon, most of the time it's both,
often cops will walk up and ask for papers and immediately mention the smell of marijuana to set up his up his case for a legal search, rule #1, necver transport more than you can eat before the cop reaches your window, rule #2 never smoke in your car, failing these 2 simple rules is almost guaranteed to land you in jail, unless you're lucky.
when a cop mentiones the smell of marijuana, if you're clean, respond with a comment like "I understand what you're saying officer, you are trying to establish false probable cause to sway a court case for an illegal search" of course the cop will be a bit agitated but you are still within your rights when the cop tries to pressure you to allow a search request a K-9 unit, refuse to allow the dog into the car, a police dog is viewed as a cop by the court systems, his job can be performed from the exterior of the vehicle
if you arent clean, you fucked up, the cops case will hold up in court
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: Noviseer]
#4925624 - 11/12/05 12:18 PM (18 years, 4 months ago) |
|
|
Quote:
Noviseer said: I know they're allowed to search for weaponry, but to legally seize drugs they've got to respect due process somehow--reasonable suspicion or something.
they are allowed to look into your car from the outide, take you out of the car and pat you down for a weapon, if they find drugs/paraphenalia in the process, it's legal and they then have PC to search the car, there are no laws about 'arms reach searches' or crap like that
|
shirley knott
not my real name
Registered: 11/11/02
Posts: 9,105
Loc: London
Last seen: 7 years, 2 months
|
Re: Police searched my car today... [Re: Prisoner#1]
#4925637 - 11/12/05 12:22 PM (18 years, 4 months ago) |
|
|
Quote:
Prisoner#1 said: any refusal to allow a search cannot be used as probable cause, the supreme court backs yo on that one, a cop can make a claim that by refusing a search you've got something to hide but if he is unable to articulate what presents probable cause in your given search you're case would quickly be dismissed.
but the cop's response to this (from his manual) is "i could see on the floor of the front seat cardboard torn in a manner that indicated creation of a 'roach' filter, commonly used to manufacture marijuana cigarettes. this, combined with the strong marijuana smell, and the defendant's behaviour, gave me 'probable cause'. and look, here is what i found: ....." etc....
if it's true that the law prohibits a proper search of a vehicle without a warrant, then great. personally i doubt you'd have a prayer up against a system that classes posession of marijuana as a jailable offense.
-------------------- buh
|
Ramlaen
Pysconaut
Registered: 11/06/04
Posts: 638
Last seen: 13 years, 2 months
|
Re: Police searched my car today... [Re: shirley knott]
#4925645 - 11/12/05 12:24 PM (18 years, 4 months ago) |
|
|
Fact is you got a better shot if you say no then if you consent, at least then you can argue in court, where as if you consent you have much less grounds to argue on
|
dnL
stranger thanstrange
Registered: 09/02/03
Posts: 668
|
Re: Police searched my car today... [Re: Ramlaen]
#4925675 - 11/12/05 12:36 PM (18 years, 4 months ago) |
|
|
"officer i have to take the biggest shit of my life. if i'm not being detained am i free to go"
--------------------
|
l33tmouse
Stranger
Registered: 06/29/05
Posts: 103
Last seen: 18 years, 1 month
|
Re: Police searched my car today... [Re: dnL]
#4925769 - 11/12/05 01:17 PM (18 years, 4 months ago) |
|
|
When your breakin the law, don't break the law is what i always say!
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: shirley knott]
#4925793 - 11/12/05 01:24 PM (18 years, 4 months ago) |
|
|
Quote:
shirley knott said: but the cop's response to this (from his manual) is "i could see on the floor of the front seat cardboard torn in a manner that indicated creation of a 'roach' filter, commonly used to manufacture marijuana cigarettes. this, combined with the strong marijuana smell and the defendant's behaviour, gave me 'probable cause'. and look, here is what i found: ....." etc....
again, clean car, if there's nohting within his view there is no claim. violate the 2 rules and you run the risk of arrest, if you havent eaten all the weed you were a fool, sure theres a chance you can get away with it but thers as great a chance that you wont
Quote:
if it's true that the law prohibits a proper search of a vehicle without a warrant, then great. personally i doubt you'd have a prayer up against a system that classes posession of marijuana as a jailable offense.
under the law, a car is an extension of your home, probable cause or a warrant is in fact needed to search, too many people relinquish that right, if a cop claims he smells marijuana he'd have no problem bringing in a K-9 at the drivers request, cops like to fish so they'll stall you and ask all sorts of questions they're hoping you screw up, they're watching your behavior at that point, look them in the eyes and answer their questions and you're more likely to drive away
In the US our due process relies heavily on the cops to perform certain actions in a reasonable time period, if they fail to have paper work filed by a specific time, the defendant can be aquitted, if they change a few letter in a name it can be dropped, the inability to articulate what led to the stop and eventualy the search will have it thrown out, smart thing to do is not draw attention to yourself so all of it can be avoided
|
lid
Insert TitleHere
Registered: 10/12/05
Posts: 563
Loc: People's Republic of New ...
Last seen: 10 years, 7 months
|
Re: Police searched my car today... [Re: Prisoner#1]
#4925973 - 11/12/05 02:20 PM (18 years, 4 months ago) |
|
|
Just out of curiosity, what would the case be if he said he smelled pot (granted you have never ever smoked in your car)and you had pot scented incense/candles in your car that had recently been lit. Having provided him information about the incense/candle and shown it to him, could this dismiss 'smell' as probable cause?
-------------------- molon labe.
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: lid]
#4926251 - 11/12/05 03:52 PM (18 years, 4 months ago) |
|
|
the smell alone is probable cause, if the smell is legitimate, incense or airfresheners with the same smell would be thrown out since theres no physical evidence, a benefit to that would be, if more people had them and no drugs, soon smell would no longer be a factor in searches
|
lid
Insert TitleHere
Registered: 10/12/05
Posts: 563
Loc: People's Republic of New ...
Last seen: 10 years, 7 months
|
Re: Police searched my car today... [Re: Prisoner#1]
#4926306 - 11/12/05 04:18 PM (18 years, 4 months ago) |
|
|
I'm a little confused about your wording P#1.
So what you are saying is, even if you didnt have anything illegal, the incense/candles could constitute probable cause to a search (having them wouldnt do anything?).
-------------------- molon labe.
|
RESTLESS
C.M.L.W.
Registered: 06/21/05
Posts: 21,817
|
Re: Police searched my car today... [Re: lid]
#4926309 - 11/12/05 04:20 PM (18 years, 4 months ago) |
|
|
Who burns incense or candles in their car?
--------------------
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: lid]
#4926329 - 11/12/05 04:27 PM (18 years, 4 months ago) |
|
|
Quote:
lid said: I'm a little confused about your wording P#1.
So what you are saying is, even if you didnt have anything illegal, the incense/candles could constitute probable cause to a search (having them wouldnt do anything?).
correct, simply because a very similar smell to marijuana is present a cop would search your car, although if there is no found, I'm sure a k-9 would be brought out and you'd suffer a shitload of inconvienience including being subject to DWI/DUI charges until a blood test came back... if enough people did it and everything came back clean, cops would stop taking that approach to gain search permission
|
lid
Insert TitleHere
Registered: 10/12/05
Posts: 563
Loc: People's Republic of New ...
Last seen: 10 years, 7 months
|
Re: Police searched my car today... [Re: Prisoner#1]
#4926356 - 11/12/05 04:38 PM (18 years, 4 months ago) |
|
|
not many. I know one person who does, but he was nuts about 'Nag Champa'. Not to mention his cat hid a dead bird under the dash and car fresheners werent strong enough to mask the remaining smell. But if everyone started doing this, it would be pretty sweet if smell could no longer be used as probable cause.
I know they can do a breath test whenever they want to. But I didn't think they were able to take a blood test unless they could observe symtoms of illegal drug use.
Thanks for the clarification though!
-------------------- molon labe.
|
leery11
I Tell You What!
Registered: 06/24/05
Posts: 5,998
Last seen: 8 years, 11 months
|
Re: Police searched my car today... [Re: Prisoner#1]
#4926361 - 11/12/05 04:40 PM (18 years, 4 months ago) |
|
|
Quote:
Prisoner#1 said:
Quote:
lid said: I'm a little confused about your wording P#1.
So what you are saying is, even if you didnt have anything illegal, the incense/candles could constitute probable cause to a search (having them wouldnt do anything?).
correct, simply because a very similar smell to marijuana is present a cop would search your car, although if there is no found, I'm sure a k-9 would be brought out and you'd suffer a shitload of inconvienience including being subject to DWI/DUI charges until a blood test came back... if enough people did it and everything came back clean, cops would stop taking that approach to gain search permission
the problem with blood tests for "drugged driving" offenses is that there is no way to really tell whether THC in the blood means that you were actually high when driving.....
basically anyone who tests positive for THC, even if they smoked weeks ago.... can get a DWI charge for it, according to norml.
-------------------- I am the MacDaddy of Heimlich County, I play it Straight Up Yo! ....I embrace my desire to feel the rhythm, to feel connected enough to step aside and weep like a widow, to feel inspired, to fathom the power, to witness the beauty, to bathe in the fountain, to swing on the spiral of our divinity and still be a human...... Om Namah Shivaya, I tell you What!
|
lid
Insert TitleHere
Registered: 10/12/05
Posts: 563
Loc: People's Republic of New ...
Last seen: 10 years, 7 months
|
Re: Police searched my car today... [Re: leery11]
#4926395 - 11/12/05 04:52 PM (18 years, 4 months ago) |
|
|
Well i think there is though. They could do tests right after smoking and for 3-5 hours afterwards, find out what the bloodlevel concentrations are during that period of time, and develop an average based on a large sample. Then they could compare your concentrations to the average to determine if you were under the infulence at that time.
I'm under the impression that blood doesn't show THC or its metabolites nearly as long as piss does. I'll try to find out where I found this information, and see if the source is credible.
-------------------- molon labe.
Edited by lid (11/12/05 04:53 PM)
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: leery11]
#4926423 - 11/12/05 05:03 PM (18 years, 4 months ago) |
|
|
Quote:
leery11 said: basically anyone who tests positive for THC, even if they smoked weeks ago.... can get a DWI charge for it, according to norml.
precicely why weed airfresheners and stuff can work against you, THC in your blood can get you a posession charge as well, the court/cop doesnt care when you smoked, they just want your money
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: lid]
#4926432 - 11/12/05 05:05 PM (18 years, 4 months ago) |
|
|
Quote:
lid said: Well i think there is though. They could do tests right after smoking and for 3-5 hours afterwards, find out what the bloodlevel concentrations are during that period of time
too costly and invasive fo the PD, they'll do one blood test and leave it at that, plus they can pull it the same way they did for alcohol, tht would mean heavy/regular smokers will always be screwed even if they have gone several days without
|
lid
Insert TitleHere
Registered: 10/12/05
Posts: 563
Loc: People's Republic of New ...
Last seen: 10 years, 7 months
|
Re: Police searched my car today... [Re: Prisoner#1]
#4926469 - 11/12/05 05:22 PM (18 years, 4 months ago) |
|
|
Well I know that I'm just splitting hairs here. But what about the statute of limitations. I don't know what they are, but lets say they are hypothetically 24 hours for possession or use. If someone (or enough people) run with this, and win would there be the possibility of a test such as this being developed to keep law enforcement from looking sloppy and inefficient?
-------------------- molon labe.
|
Diploid
Cuban
Registered: 01/09/03
Posts: 19,274
Loc: Rabbit Hole
|
|
http://norml.org/index.cfm?Group_ID=3405
2. Never Consent Many individuals arrested on marijuana charges could have avoided that arrest by exercising their Fourth Amendment rights. If a law enforcement officer asks for your permission to search, it is usually because: (1) there is not enough evidence to obtain a search warrant; or (2) the officer does not feel like going through the hassle of obtaining a warrant. Law enforcement officers are trained to intimidate people into consenting to searches. If you do consent, you waive your constitutional protection and the officers may search and seize items without further authorization. If officers find contraband, they will arrest you.
If you do not consent to a search, the officer must either release you or detain you and attempt to get a warrant. The fact that you refuse to consent does not give the officer grounds to obtain a warrant or further detain you.
An officer can obtain a search warrant only from a judge or magistrate and only upon a showing of "probable cause." Probable cause requires an officer to articulate information that would cause a reasonable person to believe that a crime has been or is being committed and that evidence of that involvement can be found within the object of the search.
There are exceptions to the search warrant requirement which permit an officer to search an area without a warrant or consent under certain circumstances. The important thing for you to remember is never to consent to a search or talk with an officer if you want to preserve your rights.
If an officer asks to search you or an area belonging to you or over which you are authorized to control, you should respond:
"I do not consent to a search of my [person, baggage, purse, luggage, vehicle, house, blood, etc.] I do not consent to this contact and do not want to answer any questions. If I am not under arrest, I would like to go now (or be left alone)."
3. Don't Answer Questions Without Your Attorney Present Whether arrested or not, you should always exercise the right to remain silent. Anything you say to law enforcement officers, reporters, cell mates, or even your friends can be used as evidence against you. You have the right to have an attorney present during questioning. Your right to remain silent should always be exercised.
4. Determining if You Can Leave You may terminate an encounter with officers unless you are being detained under police custody or have been arrested. If you cannot tell whether you may leave, you can ask officers, "Am I under arrest or otherwise detained?" If the answer is, "No," you may leave.
An officer can temporarily detain you without arresting you if he has "reasonable suspicion" that you are involved in criminal activity. An officer must be able at a later time to articulate to a judge objective facts that would have caused a reasonable person to suspect that you were involved in criminal activity at the point that you were detained. Also, the officer may perform a "pat down" or "frisk" on you during the detention if he has reasonable suspicion that you are armed. However, an officer may only reach into your pockets if he pats something that feels like a weapon.
When an officer attempts to contact or question you, you should politely say:
"I do not consent to this contact and I do not want to answer any questions. If I am not under arrest I would like to go now (or be left alone)."
If arrested, you should again refuse a search of any kind and refuse to answer any questions. At this point you should insist on speaking to an attorney as soon as possible.
5. Do Not Be Hostile; Do Not Physically Resist There are times when individuals politely assert their rights and refuse to consent to a search but the officers nonetheless proceed to detain, search, or arrest them. In such cases, it is important not to physically resist. Rather, you should reassert your rights as outlined above in section 2.
6. Informing on Others The police and prosecutors often try to pressure individuals into providing information that would lead to the arrest and conviction of others. Threats and promises by police and prosecutors should be viewed with caution and skepticism. Decisions should only be made after consulting with an experienced criminal defense attorney and examining one's own conscience.
-------------------- Republican Values: 1) You can't get married to your spouse who is the same sex as you. 2) You can't have an abortion no matter how much you don't want a child. 3) You can't have a certain plant in your possession or you'll get locked up with a rapist and a murderer. 4) We need a smaller, less-intrusive government.
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: lid]
#4927014 - 11/12/05 08:54 PM (18 years, 4 months ago) |
|
|
Quote:
lid said: what about the statute of limitations.
there's no such thing in criminal law
|
RatherBeAlone13
Stranger
Registered: 11/07/05
Posts: 184
Last seen: 17 years, 5 months
|
Re: Police searched my car today... [Re: Learyfan]
#4927122 - 11/12/05 09:20 PM (18 years, 4 months ago) |
|
|
Quote:
Learyfan said:
Quote:
Microcosmatrix said: They DO need probable cause, a warrant, or permission.
Hey ratherbealone, why were you pulled over? How long before being pulled over had you smoked in your car?
I got pulled over for failure to get my car inspected. I smoked tha night before.
--------------------
|
lid
Insert TitleHere
Registered: 10/12/05
Posts: 563
Loc: People's Republic of New ...
Last seen: 10 years, 7 months
|
Re: Police searched my car today... [Re: Prisoner#1]
#4927144 - 11/12/05 09:24 PM (18 years, 4 months ago) |
|
|
Well I just found out that the statute of limitations is about 3 years for all other crimes, so it really has no basis on this argument. Some places do not even have a statute of limitations regarding drug use (pretty retarded, considering you have 9 years for a sexual offense, if there is no physical evidence IE: DNA).
I think people should stand up against things such as driving under the influence for a drug you did weeks ago, which is ludicrous seeing as you cant be convicted for a DWI if they found traces of alcohol in your systems from several days ago.
-------------------- molon labe.
Edited by lid (11/12/05 09:31 PM)
|
Shroomism
Space Travellin
Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension
|
Re: Police searched my car today... [Re: lid]
#4927155 - 11/12/05 09:27 PM (18 years, 4 months ago) |
|
|
Yeah.. whoever made these stupid ass laws. I don't care. Someone needs to change them.
--------------------
|
Skunk420
Registered: 06/13/04
Posts: 18,524
Loc: inside
|
|
Dont drive with weed on you, use some other mode of transportation, I have been pulled over back in 2000, I had a weed pipe hidden in my underwear, in a special inside pocket, I got pulled over for speeding. They gave me the whole sobriey test, they must have seen me stash something under the seat, of course I let them search the car, i knew they weren't gonna find anything. I had the one pipe on me, i was on my way to go pick up a bag in fact.. I just got through smoking some resin in my pipe barely earlier. I think they suspected I was suspecting i was high, but i passed all the field sobreity tests, including standing on one foot and walking a straight line. I think they thought I hid something down my pants, little did they know i had it inside a hidden pocket in my underwear. I was at a park years earlier and I got searched for weed, it was right after I got off of probation for weed, so they automaticially was thinking i was smoking, i had a small bag of weed and a small pipe down my underwear. I just got though smoking only a cigarette, I had my weed stashed from earlier. But I have been lucky I never have been busted for DUI for weed before a few times. I will never smoke in a car anymore, I will find a place to smoke first, hide the weed or only bring enough to smoke on a mountain trail. smoke a joint and after that have none on me.. then be careful driving. But I am more paranoid to do that now, If I get pulled over driving anytime if i had a car, I bet they would ask me if i was smoking or using everytime i drove. I have been busted for weed twice, had a dui, almost 2 duis form one other time driving from a canyon, good thing a park ranger lady pulled me over, she let me call for someone to pick me up, i was twice the legal limit..drunk as fuck, and high on meth,, That would have been my second dui, lucky it was a park ranger lady..and not a regular cop.. that was back in late 2000.. I think I will not even have drugs in a car or using drugs right before i drive anymore. I will pick up drugs in some other vehicle, or get it delivered to my house or a safe place to meet to pick it up. Wow, I have to be careful as fuck myself, I am still on probation for second time weed possession, attemped sale of alcohol to a minor..
|
lid
Insert TitleHere
Registered: 10/12/05
Posts: 563
Loc: People's Republic of New ...
Last seen: 10 years, 7 months
|
Re: Police searched my car today... [Re: Shroomism]
#4927184 - 11/12/05 09:36 PM (18 years, 4 months ago) |
|
|
Maybe a dumb idea here, but I think its worth mentioning.
We should should do what some of the catholic, and jewish communities do.... A Shroomery voters block. Get more people involved in our community, and all vote for someone who supports our views, ideas, and messages.
-------------------- molon labe.
|
WormholeSurfer
Stranger
Registered: 10/10/05
Posts: 180
|
Re: Police searched my car today... [Re: lid]
#4927315 - 11/12/05 10:17 PM (18 years, 4 months ago) |
|
|
no offense, but a lot of you guys seem to think they dont train cops to search hidden places in vehicles for drugs and shit.
|
Skunk420
Registered: 06/13/04
Posts: 18,524
Loc: inside
|
Re: Police searched my car today... [Re: WormholeSurfer]
#4927331 - 11/12/05 10:23 PM (18 years, 4 months ago) |
|
|
like i said, dont drive with drugs on you..then you wont get pulled over for them. Use other forms of transportation. That is wrong with people nowdays, I used to drive all the damn time, now I can go without a car and I am more happy, less hassles..no DUIS no getting pulled over by the cops. If you drive do it without drugs in the car and do it sober. It is not worth the risk, I have been potenially busted too many times for DUI, I am surprized I dont have 5 duis and more possession charges. I am not preaching i am just typing shit, but I am changing my ways now before I go to prison for stupid shit in the near future.
Edited by skunk78395 (11/12/05 10:24 PM)
|
RatherBeAlone13
Stranger
Registered: 11/07/05
Posts: 184
Last seen: 17 years, 5 months
|
Re: Police searched my car today... [Re: Skunk420]
#4927532 - 11/12/05 11:06 PM (18 years, 4 months ago) |
|
|
Quote:
skunk78395 said: but I am changing my ways now before I go to prison for stupid shit in the near future.
Thats EXACTLY what I need to do...
Change my ways.
--------------------
|
AliceDee
-L S D-
Registered: 08/10/03
Posts: 3,957
|
Re: Police searched my car today... [Re: Konnrade]
#4927678 - 11/12/05 11:48 PM (18 years, 4 months ago) |
|
|
misinformation??? dude i know this from first hand experience....
but ya i guess if you put the tire in a room with nothing in it but a dog and the tire, then ya itll smell it... but its so subtle... and they need probably cause aswell to even get a dog in the first place...
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: WormholeSurfer]
#4928157 - 11/13/05 05:07 AM (18 years, 4 months ago) |
|
|
Quote:
WormholeSurfer said: no offense, but a lot of you guys seem to think they dont train cops to search hidden places in vehicles for drugs and shit.
to the contrary, I've had speaker boxes taken apart, amps opened and seen them pull a dash from someone elses car because they suspected he was transporting
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 10 months, 13 days
|
Re: Police searched my car today... [Re: Prisoner#1]
#4928164 - 11/13/05 05:09 AM (18 years, 4 months ago) |
|
|
Quote:
Prisoner#1 said:
Quote:
WormholeSurfer said: no offense, but a lot of you guys seem to think they dont train cops to search hidden places in vehicles for drugs and shit.
to the contrary, I've had speaker boxes taken apart, amps opened and seen them pull a dash from someone elses car because they suspected he was transporting
I bet they just left them to put everything back together on their own too.
-------------------- I find your lack of faith disturbing
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: Konnrade]
#4928177 - 11/13/05 05:32 AM (18 years, 4 months ago) |
|
|
I gave the guy my card and reinstalled it for him but yeah, the way they like to work is rip shit apart and and be held harmless for damages, he submitted the bill to the county ($500) and they actualy paid it.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: Police searched my car today... [Re: Prisoner#1]
#4928665 - 11/13/05 11:57 AM (18 years, 4 months ago) |
|
|
Paying a bill like that now and then insures that they can keep doing this shit without a good reason not to. We're wrong? eh, no harm done.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Prisoner#1
Even Dumber ThanAdvertized!
Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Police searched my car today... [Re: Koala Koolio]
#4928673 - 11/13/05 11:59 AM (18 years, 4 months ago) |
|
|
it's definately cheaper than a lawsuit
|
|