Home | Community | Message Board


Shroom Supply
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop:   Original Seeds Store Buy CBD, Cannabis Seeds, Compare CBD   Amazon San Pedro

Jump to first unread post. Pages: 1
OfflineAngryW0P
Stranger
Registered: 09/22/05
Posts: 3
Last seen: 10 years, 1 month
San Pedro dosage advice
    #4696617 - 09/22/05 08:04 PM (11 years, 7 months ago)

OK, so I just ordered three foot long san pedro cuttings from an online supplier. I had planed on sharing two of the cuttings with a friend immediately and then planting the third cutting for later use. Now I'm having second thoughts though because I know that san pedro potency varies a lot from cactus to cactus. I was wondering if we should just eat all three of them instead of saving one for later. The most important thing for me is to have a good trip. I have never taken mescaline before, but I have had a lot of experience with psilocybin. I know there is no way to know whether the pedro I have is weak or strong, but I was hoping someone with a little more experience could give me some advice. Thanks.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinenunciate
Cold and Indifferent
Male User Gallery

Registered: 05/23/04
Posts: 904
Loc: Edge of the World
Last seen: 18 days, 15 hours
Re: San Pedro dosage advice [Re: AngryW0P]
    #4696623 - 09/22/05 08:06 PM (11 years, 7 months ago)

Plant one and watch it grow.  Its a great experience and you get to learn a lot.  :smile:


--------------------
I am the devil and I am just like you


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: San Pedro dosage advice [Re: nunciate]
    #4696693 - 09/22/05 08:24 PM (11 years, 7 months ago)

Like you said, theres no way to know. 12 inches has been enough to send people into orbit, but often its enough for just mild effects. There are many, many factors to potency. Many surely unknown. Genetics obviously, care, nutrients, time of the year it's harvested, and it's beginning to be speculated that even time of *day* plays an important aid. Ritualistic use harvested at night time, if I recall.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineleafing
Male User Gallery
Registered: 12/23/04
Posts: 2,769
Loc: Flag
Last seen: 2 days, 12 hours
Re: San Pedro dosage advice [Re: Koala Koolio]
    #4696715 - 09/22/05 08:29 PM (11 years, 7 months ago)

y ai just reciened mine.. i planted it couple days ago


--------------------



"The psychedelic experience is just the temporary disruption of psychophysics and the telepathic emergence of synchronic linguistics "


~Leafing~


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAngryW0P
Stranger
Registered: 09/22/05
Posts: 3
Last seen: 10 years, 1 month
Re: San Pedro dosage advice [Re: nunciate]
    #4696832 - 09/22/05 08:55 PM (11 years, 7 months ago)

Thanks for the input, I think I will just let one grow, if its a mild trip then its a mild trip, but I should at least be able to feel some effects from it. One more question, does anyone know the effects of mixing mj and pedro, I usually smoke during a mushroom trip and find it adds to the experience. Could a little kind bud be used to heighten a mild pedro trip some.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 18 days, 21 hours
Re: San Pedro dosage advice [Re: AngryW0P]
    #4696858 - 09/22/05 08:58 PM (11 years, 7 months ago)

well I dont know about the effects, but a san pedro doesn't exactly taste good... and the flavor mixed with a bit of shock from ingestion can cause nausea, something some MJ would easily help with. Especially if you're the type that can wind up focusing on a negative thing such as nausea when under the influence, it can really drag things down.


--------------------

I find your lack of faith disturbing


Edited by Konnrade (09/22/05 09:01 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinenunciate
Cold and Indifferent
Male User Gallery

Registered: 05/23/04
Posts: 904
Loc: Edge of the World
Last seen: 18 days, 15 hours
Re: San Pedro dosage advice [Re: AngryW0P]
    #4696965 - 09/22/05 09:14 PM (11 years, 7 months ago)

Quote:

AngryW0P said:
I think I will just let one grow, if its a mild trip then its a mild trip, but I should at least be able to feel some effects from it.




'atta boy! Especially since this is your first time. No need to go stampeding toward a level 5. Get used to what you are getting into. It's a psychedelic which will make it similar to mushrooms or LSD, but while they are all similar, they are still very, very different beasts.

On another note, I really do think you will find the act of caring for your cutting very satisfying. :nods:


--------------------
I am the devil and I am just like you


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 18 days, 21 hours
Re: San Pedro dosage advice [Re: nunciate]
    #4697655 - 09/22/05 11:42 PM (11 years, 7 months ago)

I second the notion of growing these cacti being fun. My healthiest cutting (came from a tip, the best ones to grow are from the tip of a column, they dont have as much healing to do, thought I'd give you a heads up) is just now starting to grow after getting some basic roots grown. I'm enjoying taking care of it a lot. I bet you'll enjoy growing a cactus too! Just be darn sure you don't overwater... and DO NOT WATER your cutting for a few weeks. It is really easy to fall to temptation and wind up having to cut off the part that you caused to rot... like I did.


--------------------

I find your lack of faith disturbing


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: San Pedro dosage advice [Re: Konnrade]
    #4698864 - 09/23/05 02:50 AM (11 years, 7 months ago)

from what I've heard the MJ certailny helps with nausia. MJ gives a nice boost to any psychedellic, but as you know it detracts from the clarity (purity even) of a trip. The clarity of a mescaline trip is one of the most amazing aspects, in my experience. Do what feels right at the time.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAngryW0P
Stranger
Registered: 09/22/05
Posts: 3
Last seen: 10 years, 1 month
Re: San Pedro dosage advice [Re: Koala Koolio]
    #4698874 - 09/23/05 02:52 AM (11 years, 7 months ago)

thanks... good advice


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineTranceharper
Psychokitty

Registered: 09/17/05
Posts: 309
Loc: Pacific Northwest USA
Last seen: 11 years, 6 months
Re: San Pedro dosage advice [Re: AngryW0P]
    #4702201 - 09/23/05 09:21 PM (11 years, 7 months ago)

They arent joking, these are fun to grow :wink: if you pot it up, put some gravel in bottem of pot , that will help incase of minor overwatering . -Tranceharper


--------------------
Meow ===^{o_o}^===


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Shop:   Original Seeds Store Buy CBD, Cannabis Seeds, Compare CBD   Amazon San Pedro

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Similar ThreadsPosterViewsRepliesLast post
* san pedro dosage question *DELETED* blacksabbathrulz 1,269 10 01/16/04 03:53 PM
by EvilGir
* san pedro growing advice? Locus 1,213 10 05/19/08 01:29 PM
by Locus
* San Pedro Dosage ?'s?? socratesmind 714 3 10/22/02 05:14 PM
by neuro
* questions on San Pedro Rahz 1,392 16 08/20/08 04:14 AM
by chris92346
* Exclusive Pictorial: How To Prepare San Pedro (Photos)
( 1 2 3 4 5 6 7 8 all )
mjshroomer 49,173 140 09/15/16 05:31 AM
by Mostly_Harmless
* Followed MJ's method of san pedro preparation with no avail
( 1 2 3 all )
HidingInPlainSight 7,320 41 04/06/08 02:28 AM
by Zinglons Acolyte
* San Pedro by the Kilo Kavatar 2,774 12 10/28/04 03:27 PM
by esin
* Please help my confusion concerning san pedro a_guy_named_ai 506 3 11/03/07 05:52 PM
by royer

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless
1,502 topic views. 1 members, 17 guests and 4 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
Radical Mycology Book by Chthaeus Press
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.034 seconds spending 0.008 seconds on 18 queries.