Home | Community | Message Board


Magic-Mushrooms-Shop.com
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Jump to first unread post. Pages: 1
OfflineMrballiwhoo
Stranger
Registered: 09/13/05
Posts: 17
Last seen: 9 years, 8 months
pure psilocybin?
    #4692398 - 09/21/05 11:11 PM (12 years, 2 months ago)

I read that leary had this stuff back in during the acid tests. I think it would be crazy to get some, any one know if its even around anymore, pure psilocybin that is.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: pure psilocybin? [Re: Mrballiwhoo]
    #4692774 - 09/22/05 12:12 AM (12 years, 2 months ago)

No, it's not around to the general public. And yep, back in the 60s Sandoz manufactored it. Theres some pics on the net of the bottles and pills. I think someone on one of these boards came across an old bottle. Surely useless now.

And... if you read Brotherhood of Eternal Love, someone apparently ODed on the pure stuff. How pure it was, or it it was the whole truth will likely never be known.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Similar ThreadsPosterViewsRepliesLast post
* Pure psilocybin while asleep?
( 1 2 3 all )
Vector 6,689 43 10/22/12 05:24 AM
by Cactilove
* pure psilocybin Lelio 1,177 2 05/16/05 12:39 AM
by adoseofparn0z
* Snorting/Injecting Pure Psilocybin/Psilocin LayYouIn 4,647 2 01/29/07 07:49 PM
by ck10n3
* [PSILOCYBIN EXTRACT] Doses and Prices
( 1 2 all )
Gallium 8,578 28 09/15/04 12:39 AM
by Mixomatosis
* Psilocybin, the medicinal mushroom DreaMaTrix 4,349 4 09/03/02 07:43 PM
by Poopman
* difference between the high of the psilocybin e psilocin kottonmouthss 1,538 8 01/07/04 05:24 AM
by Annom
* Legal Psilocybin Mushrooms? I think this might be real! BioHazard 9,531 13 12/02/03 07:43 AM
by EvilGir
* Can you snort Extracted Psilocybin or Psilocin *Updated
( 1 2 all )
Flop Johnson 10,882 38 03/15/13 10:58 PM
by Intelligentxfruit

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Asante, Rose, sui, karode13
722 topic views. 3 members, 144 guests and 14 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
FreeSpores.com
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.024 seconds spending 0.007 seconds on 19 queries.