Home | Community | Message Board


Vaposhop
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Jump to first unread post. Pages: 1
OfflineMrballiwhoo
Stranger
Registered: 09/13/05
Posts: 17
Last seen: 9 years, 1 month
pure psilocybin?
    #4692398 - 09/21/05 11:11 PM (11 years, 7 months ago)

I read that leary had this stuff back in during the acid tests. I think it would be crazy to get some, any one know if its even around anymore, pure psilocybin that is.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: pure psilocybin? [Re: Mrballiwhoo]
    #4692774 - 09/22/05 12:12 AM (11 years, 7 months ago)

No, it's not around to the general public. And yep, back in the 60s Sandoz manufactored it. Theres some pics on the net of the bottles and pills. I think someone on one of these boards came across an old bottle. Surely useless now.

And... if you read Brotherhood of Eternal Love, someone apparently ODed on the pure stuff. How pure it was, or it it was the whole truth will likely never be known.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Similar ThreadsPosterViewsRepliesLast post
* Pure psilocybin while asleep?
( 1 2 3 all )
Vector 6,327 43 10/22/12 05:24 AM
by Cactilove
* pure psilocybin Lelio 1,138 2 05/16/05 12:39 AM
by adoseofparn0z
* Snorting/Injecting Pure Psilocybin/Psilocin LayYouIn 4,493 2 01/29/07 07:49 PM
by ck10n3
* [PSILOCYBIN EXTRACT] Doses and Prices
( 1 2 all )
Gallium 8,203 28 09/15/04 12:39 AM
by Mixomatosis
* Psilocybin, the medicinal mushroom DreaMaTrix 4,184 4 09/03/02 07:43 PM
by Poopman
* difference between the high of the psilocybin e psilocin kottonmouthss 1,465 8 01/07/04 05:24 AM
by Annom
* Legal Psilocybin Mushrooms? I think this might be real! BioHazard 8,646 13 12/02/03 07:43 AM
by EvilGir
* Can you snort Extracted Psilocybin or Psilocin *Updated
( 1 2 all )
Flop Johnson 10,210 38 03/15/13 10:58 PM
by Intelligentxfruit

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Asante, Rose, sui, karode13, LSDreamer
701 topic views. 4 members, 164 guests and 12 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
Avalon Magic Plants
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.016 seconds spending 0.003 seconds on 14 queries.