Home | Community | Message Board


Out-Grow.com - Mushroom Growing Kits & Supplies
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop for: ½ Pint Jars, Coir, Vermiculite

Jump to first unread post. Pages: 1
OfflinePookztA
Medical Student

Registered: 09/09/05
Posts: 1,225
Loc: Illinois
Last seen: 5 years, 2 months
Rumor: First time grow is only good for printing not eating? Weak spores?
    #4689612 - 09/21/05 11:41 AM (11 years, 2 months ago)

some kid, that really acted like he knew what he was talking about (but clearly he may not have since hes not on the shroomery :smile:) was discussing the processes of cultivating magic mushrooms, and swears to me that everyones first grow, no matter how much quantity is produced by the flush, will have little to no potency due to some bogus reason like spores being weakened in the mail, or not being used to their environment, etc. i said BULLSHIT, because i figured the syringes im getting (from a sponsor) are probably made from someones flushes who have been repeatedly printed, grown, printed, grown, etc. so when my first grow is complete, i look forward to eating some badass mushrooms (hopefully), but i just wanted to ask the Shroomery if usually, or even if anyone, has experienced a good grow on the first time, and also experienced good trips on a normal dose of those mushrooms?


--------------------
Abrahm
Spreading Psytrance & Love in the Midwest USA

Expand Your Consciousness. :mushroomgrow:

:peace: 9/11 Challenge: Explain the Evidence http://pookzta.blogspot.com


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinerygo796
Meat Popsicle
 User Gallery

Registered: 04/17/05
Posts: 221
Last seen: 8 years, 4 months
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: PookztA]
    #4689618 - 09/21/05 11:44 AM (11 years, 2 months ago)

Maybe the guy only has grown on cakes and wasn't pleased with the potency. Shrooms from cakes are still active and still work well and shrooms on poo will knock your socks off no matter where the spores are from.


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblebackupwards
peon

Registered: 04/02/05
Posts: 3,022
Loc: somewhere else
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: PookztA]
    #4689621 - 09/21/05 11:45 AM (11 years, 2 months ago)

yes he is full of shit and yes i experienced a good grow my first time around, well as good as cakes can give anyway. first flush shrooms are as good as fourth flush shrooms imo. tell the dude he doesn't have a clue.
:peace:


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblerod
Ψ
 User Gallery

Registered: 06/29/05
Posts: 3,727
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: PookztA]
    #4689663 - 09/21/05 11:59 AM (11 years, 2 months ago)

tell that kid, he needs to go back to class, he dosent know
shit.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinecoda
Banjo Goiter
Male

Registered: 03/20/01
Posts: 8,634
Last seen: 2 years, 9 months
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: rod]
    #4689671 - 09/21/05 12:07 PM (11 years, 2 months ago)

see, if you really look at his logic, you can disprove his argument in a heartbeat.

<<will have little to no potency due to some bogus reason like spores being weakened in the mail>>

Id really like to know how the heat targets only the spores you use on your first grow and not the ones you use on each successive grow.  And also, a good tool to use to disprove arguments is to ask questions that the person cant answer.  If they cant defend their argument with reasonable, FACTUAL, information then its bullshit.  A good question to ask here would be, "how do the successive flushes gain potency".  If he can prove it, ill hang my myco hat up forever :laugh:


--------------------
To get really high is to forget yourself. And to forget yourself is to see everything else. And to see everything else is to become an understanding molecule in evolution, a conscious tool of the universe. And I think every human being should be a conscious tool of the universe. . . .

-JG



Don't fuck with the laughing jesus.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineiateshaggy
i haxor 360s
Male User Gallery

Registered: 05/20/05
Posts: 4,651
Loc: 612 Warf Avenue, next to....
Last seen: 1 hour, 37 minutes
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: coda]
    #4689985 - 09/21/05 01:50 PM (11 years, 2 months ago)

i bet he used white rice or actual puffed rice cakes on his first grow and got shrooms that sucked. ask for his tek so you can laugh in his face and ask him what kind of a retard is he.


--------------------
You are a filipina sex goddess who wants to fuck me until I fall asleep, so then you can tickle my balls and see if the legend of my diamond filled nutsuck is true.  I am a white man from costa rica, who smells like lime jello.


I can flash/jtag/repair 360's, pm for details.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleFungusMan
I81U812
Male User Gallery

Folding@home Statistics
Registered: 08/06/05
Posts: 3,109
Loc: Everywhere
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: iateshaggy]
    #4690339 - 09/21/05 03:19 PM (11 years, 2 months ago)

Hell. The first flush of B+ off my cakes knocked me on my ass! Cakes arent as bad as people like to say.I just harvested a B+ mushie thats gonna weigh around a 1/8, lol. A half pinter cake at that!


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineiateshaggy
i haxor 360s
Male User Gallery

Registered: 05/20/05
Posts: 4,651
Loc: 612 Warf Avenue, next to....
Last seen: 1 hour, 37 minutes
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: FungusMan]
    #4690379 - 09/21/05 03:31 PM (11 years, 2 months ago)

hell yeh, i just grew some b+ on pf and they came out hella sweet. i had several 30-40 gram wets. i didn't have the first complaint about potency, just things like "wow, those were the best shrooms ever." stick with these guys and they'll teach you how to make portabellos make you trip hard, well maybe not porta's but you'll definetely have a good first grow. good luck to ya.


--------------------
You are a filipina sex goddess who wants to fuck me until I fall asleep, so then you can tickle my balls and see if the legend of my diamond filled nutsuck is true.  I am a white man from costa rica, who smells like lime jello.


I can flash/jtag/repair 360's, pm for details.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: iateshaggy]
    #4690541 - 09/21/05 04:20 PM (11 years, 2 months ago)

Tell him to think about what he's saying.

Spores do not contain psilocin. Spores contain the genetic material of the mushrooms that produce psilocin. Is it really possible that the mail service altered the genetic code to create less potent mushrooms? It's like sending sperm in the mail and saying, "This batch won't have any dopamine." Sure... mutation is possible I suppose, especially if X-rays are involved. But to go as far as saying the sending causes reduced potency? bleh...

Sending in the mail will surely kill some of the spores off. Especially if it's sitting in a hot car. You could potentially have less substrains in a jar, at worst. But thats not a bad thing. If really only a couple substrains are produced, colonization could take a little longer. If potency was effected, it would be genetic. The prints (that are the only thing you'll supposedly want from the batch) will be products of that genetic line.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
OfflinePookztA
Medical Student

Registered: 09/09/05
Posts: 1,225
Loc: Illinois
Last seen: 5 years, 2 months
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: Koala Koolio]
    #4690582 - 09/21/05 04:30 PM (11 years, 2 months ago)

haha all of your posts have confirmed exactly what i told him, but i just wanted to make one thing clear about my original post, which is that he never had made the claim that spores are weakened in the mail. i just put that in there as a possiblity as to why his shrooms might have sucked, which was obviously a retarded mistake by me. he basically just said that the first batch of shrooms is never potent, theyre used to produce spores so that the batch made FROM those spores will be potent. but obviously, since the first batch i will be producing will be made from spores from someone else's flush, it was kinda a retarded statement. i am just looking to have every single insignificant question of mine answered during this first time cultivation process that i am enduring. i appreciate all your help, even with this nooby question, and i look forward to having a buncha good shrooms thanks to all your help.  one thing i am doing differently than most first timers though, is that i am casing my pftek jars into 4 or 5 different square trays with poo for substrate, and a combination verm/coir for the top layer of casing.  i know this is a daring task for a first timer, but it doesnt seem hard at all if you prepare yourself for the casing and make sure that everything is AS STERYLE AS POSSIBLE.  wish me luck! and i will make a grow log once i get it all in the FC since the incubation period is quite uneventful. :smile: thanks again! :heart:


--------------------
Abrahm
Spreading Psytrance & Love in the Midwest USA

Expand Your Consciousness. :mushroomgrow:

:peace: 9/11 Challenge: Explain the Evidence http://pookzta.blogspot.com


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineHrethic
A Human, Being

Registered: 01/06/04
Posts: 2,397
Loc: Passing through the bulk
Last seen: 5 months, 5 days
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: PookztA]
    #4692222 - 09/21/05 10:35 PM (11 years, 2 months ago)

Whenever you hear a rumor like that just come on here and get it completely debunked by all these smart folks here at the shroomery. That's completely horse shit, a recent first flush/first grow on some actual horse shit has produced some absolutely incredible shrooms.


--------------------
Will all the big boomers please unveil, please unveil, please unveil.


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblecrazytalken
SELECT
 User Gallery

Registered: 04/06/05
Posts: 122
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: Hrethic]
    #4692292 - 09/21/05 10:51 PM (11 years, 2 months ago)

Well he could have been mixin up his facts and talkin about this Variation of Psilocybin and Psilocin Levels with Repeated Flushes (Harvests) of Mature Sporocarps of Psilocybe cubensis Its a link that i believe i found on this site. If you read it has nothing to do with mailing spores so i dunno where hes gettin that shit from but still a good read. He may or may not know what hes talkin about...i dont know what was said but i do know the chemical psilocybin and psilocin levels vary among cultures and flushes.


--------------------
**"Both the psychedelic dream state and the waking psychedelic state acquire great import because they reveal to life a task: to become familiar with this dimension that is causing being, in order to be familiar with it at the moment of passing from life." -Terence McKenna



Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleJackTackle
pinningmycologist

Registered: 09/18/05
Posts: 282
Loc: behind you
Re: Rumor: First time grow is only good for printing not eating? Weak spores? [Re: PookztA]
    #4692326 - 09/21/05 10:59 PM (11 years, 2 months ago)

sounds like crap to me
i can't even think of a good argument to support that theory


--------------------
Stay Blue!


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Amazon Shop for: ½ Pint Jars, Coir, Vermiculite

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Similar ThreadsPosterViewsRepliesLast post
* outdoor grow about eating? Billy1111 601 6 07/24/06 03:47 PM
by 905
* Question about the history of growing shrooms? stealth 1,511 10 06/16/02 11:56 AM
by stealth
* best way to eat? blujack 1,055 9 07/30/04 02:27 PM
by blujack
* spores = probable cause? wrestler_az 1,108 7 08/13/02 03:01 PM
by Seuss
* FAQ 50. Has anyone ever died from eating magic mushrooms?
( 1 2 all )
RoseM 29,035 26 10/20/04 10:32 AM
by BlueOrb
* Why buy spore prints when you need syringes? LSAuser 1,663 12 11/02/02 12:05 PM
by Cow Shit Collector
* mushroom prints lga0302 545 6 11/25/05 04:19 PM
by Shnezbit
* Sick off of spores??? Dishez 501 3 10/01/07 10:20 PM
by skunkape

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Asante, Rose, sui, karode13, LSDreamer
1,245 topic views. 3 members, 223 guests and 10 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
Phytoextractum
Please support our sponsors.

Copyright 1997-2016 Mind Media. Some rights reserved.

Generated in 0.063 seconds spending 0.007 seconds on 14 queries.