Home | Community | Message Board


The Spore Depot
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: PureVPN PureVPN   NordVPN NordVPN   Original Seeds Store Buy CBD, Cannabis Seeds, Compare CBD   Amazon ½ Pint Jars, Grow Light, Salvia, San Pedro, Scales

Jump to first unread post. Pages: 1 | 2 | Next >  [ show all ]
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 1 month, 20 days
San Pedro, growing vs. buying for immediate use? (Update: new ones!)
    #4657057 - 09/13/05 10:57 PM (11 years, 9 months ago)

I've found one of many suppliers on the net that sells a variety of legal plants containing entheogenic substances. Of course, as a man who has seen "Fear and Loathing in Las Vegas", and who was casually acquainted with a member of the native american church, I knew about mescaline, and ordered three 6-inch cuttings of san pedro.

I then spent about $45 on wide, shallow terra cotta pots and cactus soil. Obviously my intention is to propagate.

However, I only paid $29 for the three cuttings, including shipping. This should be 1.5 standard doses for a person of my size (170lbs, but very small build) or one good dose. I have never been able to acquire any psychoactive substance other than marijuana and I am anxious to try mescaline, since it is no doubt healthier than smoking regularly, and allows a certain level of increased lucidity compared to marijuana.

My question is if you out there feel it would be worth the price to pluck two of my cuttings from their soil and prepare them, leaving the healthiest in place (two of them are cut on both ends, one is cut from a tip). Then to order more as time elapses, planting one and using the others.

Note that I am a full-time college student, and am at the moment unemployed. My income consists off odd-jobs done when needed... though I expect to find a weekend job soon. (My fluid assets are about $20 a week)

Would I break my budget with occasional healing mescaline use?


Edited by Konnrade (09/25/05 11:58 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4657440 - 09/14/05 12:38 AM (11 years, 9 months ago)

I'd recommend planting them all, and buying another 18" if you want to use. Having 3 growing plants is a good idea.

I also don't know about your plants. Sometimes 6" cuttings from a source could just be the same as half their 12" cutting. Sometimes they're smaller, younger plants.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepuwtrip
spirit molecule

Registered: 03/16/05
Posts: 203
Last seen: 1 year, 9 months
Re: San Pedro, growing vs. buying for immediate use? [Re: Koala Koolio]
    #4657716 - 09/14/05 01:44 AM (11 years, 9 months ago)

you've invested more into the growing supplies than the plants themselves. your intention was surely to grow them :smile: so follow up on this intention and plant them all.

do you really want to try mescaline specifically, or are you just bored right now?

if you are bored, i suggest trying some salvia to see if you like that. meanwhile, read up on mushroom cultivation. i can't comment on how shrooms compare to mescaline, but my expereince on low dosage of mush was pretty much the same type of descriptions i read about on mescaline trip reports. mushroom cultivation is very easy and fast as well with big yields.

meanwhile, your little guys are growing up and you have triple the dosage of what you would have had otherwise. now you can take cuttings again or consume. you can also get seeds online and start them up like that.

if you really feel that you need to get to mescaline now, then check the price of dry cuttings online to see if they're cheaper before doing in the little ones.

thats just the way i would do it in your position.
:sun:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleCorporal Kielbasa
 User Gallery

Registered: 05/29/04
Posts: 17,029
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4658090 - 09/14/05 03:38 AM (11 years, 9 months ago)

Like Elger said those six inch cuttings are probably not of a sufficient width to form the mass needed for consuption. Meaning that as the get older and taller they really bolk up.


--------------------




Post Extras: Print Post  Remind Me! Notify Moderator
InvisiblelIllIIIllIlIIlIlIIllIllIIl
Stranger
 Arcade Champion: Airfox

Registered: 12/16/04
Posts: 11,123
Loc: Texas
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4658202 - 09/14/05 04:14 AM (11 years, 9 months ago)

Yes, I would also recomend growing. This will lead to a greater respect for the plant and probably you'll trip better when the time comes.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 1 month, 20 days
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4658248 - 09/14/05 04:24 AM (11 years, 9 months ago)

Thanks for the feedback!

In retrospect I agree, I did invest quite a bit in their proper growing (and I must admit I like to dote on the little fellas), so I should let them grow and mature (I'd like to see those huge, beautiful flowers anyways). Thankfully, I know someone who has an abundance of the cacti available, who agreed to cook some and send me a jar of it. Fate provided the best option  :grin:

To clarify, I was actually interested specifically in mescaline, but more specifically the holistic cacti, since I am well aware of the quinoid and/or antiobiotic properties of the chemicals, as well as the spiritually beneficial nature of the mescaline and alkaloids.

Again, thank you for the feedback, it was useful to gain some perspective on the matter.


--------------------

I find your lack of faith disturbing


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineTinkal
Green Thumb
 User Gallery

Folding@home Statistics
Registered: 06/01/05
Posts: 253
Loc: Europe
Last seen: 1 month, 4 days
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4658465 - 09/14/05 06:27 AM (11 years, 9 months ago)

You better forget the word "buying". Use more the word "growing".
Have a nice day.


--------------------
Of all the things I love the most, my mind is what I miss the most.

Visit my marketplace thread here! I'm giving awesome stuff :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 1 month, 20 days
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4661540 - 09/14/05 08:19 PM (11 years, 9 months ago)

For the hell of it, when I get the chance to pull out the camera I'll snap a photo of the little guys. I've put mine in pots that are much wider than the pots I see in other people's photos, they're big pots, but wider than tall, since I am under the impression that they have a large lateral root system with marginal root depth.

Once I have a photo up, if anyone sees anything wrong please do feel free to bring it to my attention  :crazy:


--------------------

I find your lack of faith disturbing


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 1 month, 20 days
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4676422 - 09/18/05 03:20 AM (11 years, 9 months ago)

Ok! I have a pretty decent set of photos (taken at night with a flash, for better contrast and depth, and because I remembered to do it when the sun had allready set).

I have 2 photos of each from different angles, and a shot from north and south. I also named them, and labeled the photos as such:

South Overview


North Overview


1st of Reggie (my healthiest one. It hasn't rooted yet, but the top looks as though it is growing. I ordered it as a 6" cutting, and yet despite being 2-3" into the ground is 6" above ground height too)


2nd of Reggie


1st of Harold (the runt of the litter, his upper part was cut rather oddly... he may not pup very well).


2nd of Harold (Notice the discoloration and drying of the top... I assume this is normal, but I may be wrong. Anything to add about this?)


1st of david, a rather clean midsection cut. (he's named for the star of david shape he has).


2nd of david


I realize naming them is a little wierd, but it helps me to keep track of which one is which, especially later on. It also motivates me to take better care of them  :grin:

Any comments? To my knowledge, they have not rooted, after being in there about 6 weeks, and only being watered twice in that time. If anyone sees anything and wants to contribute some advise, please do... I'm new to cactus growing.  :confused:


--------------------

I find your lack of faith disturbing


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineCerebralFlower
whats left?

Registered: 02/09/04
Posts: 1,326
Loc: only the truth is left
Last seen: 8 years, 23 days
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4677134 - 09/18/05 11:39 AM (11 years, 9 months ago)

can you order cuttings of cactus online legally???????????


--------------------
God says dance with your heart
And shake free of you desire

Where theres a will theres always a way
When you get confused listen to the music play



Post Extras: Print Post  Remind Me! Notify Moderator
Invisibleafoaf
CEO DBK?
 User Gallery

Registered: 11/08/02
Posts: 32,665
Loc: Ripple's Heart
Re: San Pedro, growing vs. buying for immediate use? [Re: CerebralFlower]
    #4677251 - 09/18/05 12:30 PM (11 years, 9 months ago)

these are legal cacti

please support the shroomery sponsors: http://www.shroomery.org/sponsors.php


--------------------
All I know is The Growery is a place where losers who get banned here go.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 1 month, 20 days
Re: San Pedro, growing vs. buying for immediate use? [Re: CerebralFlower]
    #4678220 - 09/18/05 06:27 PM (11 years, 9 months ago)

Yes, these are legal. they only become illegal if you prepare them in any way for human consumption. You can buy these cacti no doubt from the shroomery's sponsors, so if you're considering starting a crop, help support the shroomery in the process  :grin:

You also may be pleased to hear, if you were not allready aware of it, that Amanita Muscaria is a legal entheogenic mushroom. But as that is off-topic I won't digress into the details.

The cactii shown here are also a very tough cactus, they can take many forms of abuse and nonetheless remain a very fast growing cactus despite it. A great option for propagation, generally speaking. Also, from what I hear, they make decent grafting stock.

But, may I ask if anyone familiar with this species sees any flaw in my setup, or problem with the specimens? They may be able to withstand quite a bit, but I'd rather they be comfortable and growing ideally.


--------------------

I find your lack of faith disturbing


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineNoviseer
Percussion isFree
 User Gallery

Registered: 03/18/03
Posts: 3,994
Last seen: 2 years, 6 months
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4679276 - 09/18/05 10:41 PM (11 years, 9 months ago)

You can buy 18 inch tall pedros at home depot for 14 bucks.


--------------------
_______________________________________________________________
namaste said:
no flamz in da ODD, if you got nothing to contribute then keep yo lips zipped
_________________________________________________________________


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinedarkice
Stranger
Registered: 03/31/05
Posts: 48
Last seen: 8 years, 10 months
Re: San Pedro, growing vs. buying for immediate use? [Re: Noviseer]
    #4680642 - 09/19/05 03:26 AM (11 years, 9 months ago)

Quote:

Noviseer said:
You can buy 18 inch tall pedros at home depot for 14 bucks.



Only when you are very lucky.
Personally i think your cuttings are to small for a decent experience.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 1 month, 20 days
Re: San Pedro, growing vs. buying for immediate use? [Re: darkice]
    #4682773 - 09/19/05 06:23 PM (11 years, 9 months ago)

I myself was worried that they may have been too young, but as to their size I am more confident. they range from 2.5 to 3 inch diameter, which I thought meant that about 12" should be a decent dose. Surely not a powerful experience, but as it would be my first time on a psychedellic, I'd rather ease into it lightly anyways.

I'm keeping an eye on eBay for a cheap cutting of sufficient size to make a batch of tea, in case the tea being mailed to me by a friend fails to arrive.

I also have a question about placing these in a terrarium with flourescent "grow" lights during the winter. I dont have any place, except for the roof, where they would get more than 3 hours of direct sunlight, and the rest of the day it's all pretty shady, due to the two-story homes built very closely together. I'd like to keep a terrarium with a blend of good conditions (warm, dry air, plentiful but not excessive hours of light, and more stable soil temperatures) and aesthetic touches, so I could grow them and also use them to liven my room up. Does anyone have any advice about that sort of thing?

*edit*
eBay's low prices just made me an offer I can't resist. only $10 for a 16 inch peice, fully rooted... and the shipping is only about $7. assuming I win the auction (which is likely considering it only had 21 hours left and had no bids) then it will make a lovely addition to my collection  :laugh:


Edited by Konnrade (09/19/05 06:50 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 1 month, 20 days
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4685151 - 09/20/05 04:14 AM (11 years, 9 months ago)

Horrible news! Horrible, catastrophic news! This miserable, atrocious cactus soil has been holding in moisture and not draining well. approx. 2 weeks after last watering the soil is still very damp below the surface. I was bringing my cacti inside as a thunderstorm was starting and I wanted to shelter them from cold and wet... and one of them overturned, exposing a gap up into the body where about 1 cubic inch had rotted away!!!

I pulled up the other two, and found that reggie was fine, albeit a little gorged with water, and had sent down some small roots... david had a swollen and yellow-brown area that looked like the parts of harold which hadnt rotted away yet but were about to start. I took them into my kitchen, prepared a clean surface, sterilized the skin where I was to cut, sterilized a fillet knife, and cut off the rotten areas. They are now in a tupperware container, partially opened for ventilation, in my closet... their fresh cuts facing upward.

Hopefully they will callous over and I can try again with better soil mix... otherwise I'm afraid I will have to throw in the towel and process them for consumption. Sadly, harold and david may be doomed  :frown: . Although, perhaps it's just an indication that beginning with just reggie is sufficient, and that I should use harold and reggie to break through into the use of psychedellics at this time  :confused:


--------------------

I find your lack of faith disturbing


Post Extras: Print Post  Remind Me! Notify Moderator
InvisiblelIllIIIllIlIIlIlIIllIllIIl
Stranger
 Arcade Champion: Airfox

Registered: 12/16/04
Posts: 11,123
Loc: Texas
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4685174 - 09/20/05 04:51 AM (11 years, 9 months ago)

That sucks dude. Did you use a cactus potting mix? I have seen what can happen to a rotting cactus, it's quite depressing. But don't give up yet! Well, unless you really want to. :grin:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineEkstaza
stranger thanmost
 User Gallery

Registered: 04/11/03
Posts: 4,317
Loc: Around the corner
Last seen: 21 days, 2 hours
Re: San Pedro, growing vs. buying for immediate use? [Re: Konnrade]
    #4685355 - 09/20/05 08:18 AM (11 years, 9 months ago)

Here's what I'd do, and I already know it will work.

Take the remains of Harrold and David minus the rot and place them out to dry in a semi-sunny spot. Leave them like this until the damaged ends start to heal. They should within a few weeks, start to develop roots along the bottom side(side not facing sun) and now they are ready to go into some soil. To plant them, just lay them on their side with the roots facing down and cover up to half way with soil. Do not bury it entirely. Once the roots really start growing, you should see some pups start to form just before you need to put it away for wintering.
Good Luck

I did this with some pedros and they just took off.


--------------------
YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 1 month, 20 days
Re: San Pedro, growing vs. buying for immediate use? [Re: Ekstaza]
    #4686340 - 09/20/05 04:22 PM (11 years, 9 months ago)

hrm, that sounds like a good idea, I'll set them out in partial shade as soon as this thunderstorm ends. I recall seeing a post elsewhere where someone (I think it was you) showed photos of cuttings rooted sideways, and I was impressed with their growth, to say the least.

Thanks for the suggestion!  :grin:

My cuttings seem to still have hope  :laugh:

Yes, I did use a cactus potting mix, schultz I think. However it seems to be pretty much identical to normal potting soil, including many organic elements which are sponge-like and hold water in. I'm going to remove the soil from the two pots no longer holding cacti, add in some sand and pebbles, bake it until dry and sterile in my oven when ready to replant, and give it a try again. Reggie will just stay planted and get less water less often to prevent rot. Since it's allready rooted it seems foolish to disturb it, I'll just let it grow, it seems to have added an inch to it's height allready, albeit in the form of that little nub you see in the photo. Perhaps the pot type had something to do with it? They're regular terra-cotta pots, which I thought would allow moisture to drain and evaporate away, but they only have 1 drain hole too, and since they're absorbent perhaps they just helped hold the moisture there.

I may just buy some more to be honest... it seems wise to try the san pedro experience before I invest any more into it. What I do have would be excellent as decoration if I were to decide not to go forward with propagation with intent to consume.

*Edit* this t-storm isnt likely to pass within 24 hours, so I decided to throw reggie in the closet. I have a 13w compact flourescent pointed at it... very close up, just far enough to illuminate all of the cactus. It should keep it warm, at the least. I wonder if a regular flourescent will even have any benefit at all to a plant? In any case, I'm going to keep it illuminated 24 hours a day for a while, see if it does anything. When the sun is back to shining nicely in the sky here, outside he goes to say hi to Mr. Sunlight.

I'd rather grow these guys inside though... but man oh man how expensive grow lights are! I've seen prices of just over $200, just for a single 2' flourescent light. How in God's creation is that even remotely reasonable? Many of us using these lights are not on a big budget after all  :tongue:.

Any cheap suggestions, please?


Edited by Konnrade (09/21/05 03:25 AM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 1 month, 20 days
Re: San Pedro, growing vs. buying for immediate use? (Update: new ones!) [Re: Konnrade]
    #4711944 - 09/26/05 12:03 AM (11 years, 8 months ago)

Here's my lovely bargain trichos! They have obviously been grossly neglected by the largely unenthusiastic Target employees, but from the looks of them they came from a competent supplier. They are very dark, almost bluish. The base is also very wide and developed, meaning they're probably allready mature. The soil simply must go, as must the weeds and moss growing in the soil (garden center morons).

Here are some pictures:


an overview for a sense of scale.


a view showing more detail and the soil. (look at the tiny pot! I need to transplant them soon)


awww, a pup  :tongue:  (also note the way-too-moist soil)


--------------------

I find your lack of faith disturbing


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1 | 2 | Next >  [ show all ]

Shop: PureVPN PureVPN   NordVPN NordVPN   Original Seeds Store Buy CBD, Cannabis Seeds, Compare CBD   Amazon ½ Pint Jars, Grow Light, Salvia, San Pedro, Scales

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Similar ThreadsPosterViewsRepliesLast post
* Buying San Pedro: Cutting vs. Rooted Raven0us 776 3 02/18/08 11:32 AM
by Raven0us
* San Pedro Growing ExplosiveMango 1,010 2 11/03/06 11:19 AM
by Brewmaster
* San Pedro - Growing for maximum potency Wysefool 2,093 7 06/22/04 03:46 PM
by HarveyWalbanger
* san pedro - growing/feeding tips? RITM1999 2,926 5 10/09/08 04:48 PM
by RITM1999
* Where do San Pedro grow indiginously? bbbaaa 831 3 05/11/08 07:40 PM
by Coaster
* san pedro growing advice? Locus 1,217 10 05/19/08 01:29 PM
by Locus
* basic san pedro care Sophistic Radiance 967 4 05/15/08 11:11 PM
by implee
* san pedro -too thin mr crisper 3,108 8 12/11/01 12:21 AM
by superpimp

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless
2,599 topic views. 0 members, 26 guests and 3 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
Azarius
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.03 seconds spending 0.003 seconds on 18 queries.