|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Young_but_cool
Stranger
Registered: 08/16/02
Posts: 1,726
Loc: Old Europe
|
DEA discovers kratom
#4572068 - 08/23/05 06:52 PM (18 years, 7 months ago) |
|
|
This is copied and pasted from the latest microgram bulletin. I've been keeping an eye on this DEA newsletter, because clearly kratom was going to show up there sooner or later. It took a while though.
Selected Intelligence Brief
Quote:
HERBAL DRUG UPDATE: KRATOM
[From the NDIC Narcotics Digest Weekly 2005;4(16):4 Unclassified, Reprinted with Permission.]
Some epidemiologists have reported that kratom--an herbal drug derived from a tropical tree native to Southeast Asia--has significant abuse potential in the United States, where it currently is legal. Kratom leaves (fresh and dried) and plants are widely available on the Internet and probably are sold at some "head shops" in the United States. Dried kratom leaves are relatively inexpensive, often selling for $10 to $40 per ounce. Kratom users typically chew fresh leaves or make a tea from dried leaves, but some users smoke the dried leaves. Because kratom abuse has been recognized in several regions of Asia, the herb has been made illegal in Australia, Burma, Malaysia, and Thailand.
The primary active alkaloid in kratom is mitragynine; however, other alkaloids are present and account for a variety of effects, which are dose-dependent. Low doses usually produce stimulant effects; higher doses usually produce sedative and euphoric effects. Some users report ?lucid dreaming.? Effects typically begin within 5 to 10 minutes after ingestion and last approximately 6 hours. Individuals who chronically use kratom become thin, their skin darkens (particularly on the cheeks), and they experience dry mouth, constipation, and frequent urination. Withdrawal symptoms can include muscle and joint pain, hostility, aggression, eye-watering, and spastic limb movements. Users who combine kratom with nervous system depressants may experience respiratory depression, which may cause them to stop breathing.
NDIC Comment: Kratom's wide availability on the Internet suggests that demand is extensive; however, kratom abuse is not monitored by any national drug abuse survey, and NDIC has not yet received law enforcement reports regarding kratom abuse in the United States. Newspaper reports regarding kratom abuse recently were published in Malaysia, similar reports have surfaced in Great Britain, and several web sites - some based in the United States - frequented by recreational drug abusers contain extensive information about kratom. It is likely that kratom abuse is unrecognized in areas where it is occurring because the crushed, dried leaves resemble other plant-based drugs, and the effects mimic effects of other drugs.
One potential user population for kratom is opiate addicts who may attempt to self-treat if they do not have access to methadone programs or if they are reluctant to seek professional treatment. Some medical researchers have speculated that kratom may be useful as a substitute for methadone in treating opiate dependency, although more research is needed.
Edited by Young_but_cool (08/23/05 07:28 PM)
|
Anonymous
|
|
|
ManicDelirium
MysteriousMycologist TechDeviant
Registered: 08/18/05
Posts: 206
Loc: Flawda
Last seen: 12 years, 10 months
|
Re: DEA discovers kratom [Re: ]
#4573098 - 08/23/05 10:19 PM (18 years, 7 months ago) |
|
|
damnit they always catch on eventually...Kratom resin is awesome!!
grab a couple seeds before the DEA bans it's sale...
-------------------- "Buy the ticket, take the ride" --long live the great Gonzo
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
|
I assure you the DEA has known about it for a long time. Microgram is just their newsletter to the public, where they brag about busts involving drugs hidden in the most clever locations. It's too bad that the wheels are officially turning. Now it's just a matter of how fast they turn.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 10 years, 3 months
|
|
Quote:
ManicDelirium said: damnit they always catch on eventually...Kratom resin is awesome!!
grab a couple seeds before the DEA bans it's sale...
You'd have better luck with cuttings at the moment, and i encourage you to, if you are thinking about it, to get a cutting or two, from the pictures i have seen they look very nice.
|
Twirling
Barred Spiral
Registered: 02/03/03
Posts: 2,468
Last seen: 2 years, 1 month
|
Re: DEA discovers kratom [Re: rocknliam]
#4574744 - 08/24/05 12:23 PM (18 years, 7 months ago) |
|
|
You have to wonder what this means, if anything. The report here doesn't really indicate any sort of action, and I'm guessing kratom isn't on the DEA's list of chemical concerns. It's so hard because these things tend to be fairly unpredicatable.
I will say that it's tough to watch these things happen. Nothing really comes of it except frustration with the way things are.
|
Stonehenge
Alt Center
Registered: 06/20/04
Posts: 14,850
Loc: S.E.
|
Re: DEA discovers kratom [Re: Twirling]
#4574865 - 08/24/05 01:03 PM (18 years, 7 months ago) |
|
|
I have kratom cuttings for trade or whatever. USA only, it's too hard to ship across the border. Kratom is easy to care for but must be watered reguarly and does not like freezing. It has to come in during the cold months.
-------------------- “A democracy cannot exist as a permanent form of government. It can only exist until the voters discover that they can vote themselves largesse from the public treasury. From that moment on, the majority always votes for the candidates promising the most benefits from the public treasury with the result that a democracy always collapses over loose fiscal policy, always followed by a dictatorship.” (attributed to Alexis de Tocqueville political philosopher Circa 1835) Trade list http://www.shroomery.org/forums/showflat.php/Number/18047755
|
Organic
Lloyd
Registered: 04/14/02
Posts: 5,774
Loc: Overlook
Last seen: 14 years, 9 months
|
Re: DEA discovers kratom [Re: Stonehenge]
#4574879 - 08/24/05 01:06 PM (18 years, 7 months ago) |
|
|
Can it withstand window sill light in the cold months or do you just mean to bring it in on freezing days? I'm interested in a cutting for sure, I don't have anything to trade though.
--------------------
|
schmutzen
King of the side-pins
Registered: 12/03/02
Posts: 15,615
Loc: Miss Kitty's Lounge
Last seen: 8 hours, 53 minutes
|
Re: DEA discovers kratom [Re: Stonehenge]
#4576376 - 08/24/05 08:09 PM (18 years, 7 months ago) |
|
|
What's the best medium for growing Kratom?
I've had one in a humidity chamber for at least a month and he's got some good roots. Any reccomendations for potting soil vs. sterilized sifted sand? Or a mix?
Thanks
-------------------- "Blow up your TV, throw away your paper. Go to the country, build you a home."
|
Stonehenge
Alt Center
Registered: 06/20/04
Posts: 14,850
Loc: S.E.
|
Re: DEA discovers kratom [Re: schmutzen]
#4578662 - 08/25/05 11:52 AM (18 years, 7 months ago) |
|
|
I grow my kratom in regular potting soil with added perlite like I do my other plants. I fert with peter's 20 20 20. It can't take freezing at all and I bring mine in if it's going to get into the 30's. It will do fine by a window during the winter. I put my 2 kratoms in a shed out back on cold nights since they have gotten kind of large. I run a little heater out in the shed and no problems. They love frequent watering and it's hard to overwater them. As they get taller be sure to top them so they grow to the sides and not straight up.
The only bug problem I ever had was aphids and I got rid of them by spraying every day with safer's soap. I had a little BT bacteria in with the soap to get rid of any crawlers. I had to spray every day for a few weeks because I had a bad aphid problem before I spotted it. Whiteflies do not seem to bother kratom. Whiteflies will get on my voacanga africanas but not the kratom right next to it. In case anyone is wondering, no I don't have any VA cuttings available. I'm just offering my kratom cuttings because I hate to see it become illegal and I want it to be spread far and wide before that happens, if it does.
-------------------- “A democracy cannot exist as a permanent form of government. It can only exist until the voters discover that they can vote themselves largesse from the public treasury. From that moment on, the majority always votes for the candidates promising the most benefits from the public treasury with the result that a democracy always collapses over loose fiscal policy, always followed by a dictatorship.” (attributed to Alexis de Tocqueville political philosopher Circa 1835) Trade list http://www.shroomery.org/forums/showflat.php/Number/18047755
|
schmutzen
King of the side-pins
Registered: 12/03/02
Posts: 15,615
Loc: Miss Kitty's Lounge
Last seen: 8 hours, 53 minutes
|
Re: DEA discovers kratom [Re: Stonehenge]
#4578983 - 08/25/05 01:00 PM (18 years, 7 months ago) |
|
|
Thanks for the info and getting those trees out there! I'll probly have some more questions after the weekend.
Peace
-------------------- "Blow up your TV, throw away your paper. Go to the country, build you a home."
|
Lawrence
member
Registered: 08/24/03
Posts: 321
Loc: Canada, Qc
Last seen: 2 years, 2 months
|
Re: DEA discovers kratom [Re: schmutzen]
#4581655 - 08/25/05 09:11 PM (18 years, 7 months ago) |
|
|
Thanks you for the post
|
HB
Registered: 04/06/01
Posts: 42,528
Last seen: 1 year, 8 months
|
Re: DEA discovers kratom [Re: Lawrence]
#4582046 - 08/25/05 10:28 PM (18 years, 7 months ago) |
|
|
it's unbelievable how carcinogens like high fructose corn syrup are in almost every food, and yet NATURAL herbs with various healing properties are illegal ...
=( screwed up values in this society, methinks
|
stvip
Strange stranger
Registered: 03/21/05
Posts: 195
Loc: Israel
Last seen: 17 years, 2 months
|
Re: DEA discovers kratom [Re: HB]
#4583153 - 08/26/05 06:24 AM (18 years, 7 months ago) |
|
|
Quote:
it's unbelievable how carcinogens like high fructose corn syrup are in almost every food, and yet NATURAL herbs with various healing properties are illegal ...
So, what's so unNATURAL about corn syrup? Or cyanide and butolinum toxin? All full of NATURAL wholeseomeness, hmm-hmm. Why is NATURAL morphine so evil, but mitragynine and related alkaloids so healthful? (except that unlike kratom, opium doesn't cause a darkening of the skin upon the cheeckbones reminiscient of liver damage, which has never been investigated and is of unknown cause)
|
Wysefool
I AM SKELETON JELLY
Registered: 12/26/02
Posts: 6,643
Last seen: 6 days, 20 hours
|
|
I wonder why we are "recreational drug abusers" do they think there could be such a thing as a recreational drug USER?
-------------------- ]
|
Locus
Registered: 03/11/04
Posts: 6,112
Last seen: 3 years, 1 day
|
|
fuck, well it was inevitable. let me know when we cant buy the stuff anymore though. i guess we'll have a good while before that happens so thats alright. but even so, when it comes close i want to get a decent amount. peace.
-------------------- The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein "Fear is the great barrier to human growth." ~ Dr. Robert Monroe ~~~*Dosis sola facit venenum*~~~ *Check my profile to listen to my music*
|
HB
Registered: 04/06/01
Posts: 42,528
Last seen: 1 year, 8 months
|
Re: DEA discovers kratom [Re: stvip]
#4583232 - 08/26/05 08:07 AM (18 years, 7 months ago) |
|
|
there's nothing natural about high fructose corn syrup, especially the 'high fructose' ... nature doesn't supply foods with EXTRAORDINARILY high levels of fructose at will, humans do it to keep you addicted to their foods and support their companies with more money ... don't believe me? check out your local supermarket ... 9 out of 10 items are 'ARTIFICIALLY flavored ... ARTIFICIALLY preserved ... etc. .. can you name where most of the ingredients come from? no? that's because they don't exist except in laboratories
even cyanide is NECESSARY in our body in very low amounts to LIVE
however, high fructose corn syrup should never (...NEVER...) ever be in your body ...
ever.
|
Stonehenge
Alt Center
Registered: 06/20/04
Posts: 14,850
Loc: S.E.
|
Re: DEA discovers kratom [Re: HB]
#4583710 - 08/26/05 11:26 AM (18 years, 7 months ago) |
|
|
Waiting until it's about to be illegal to buy some might be waiting too late. By then, the price will skyrocket and supply will be very short. Now is the time to lay in some leaf or even get a plant. People have asked what I'd trade for one of my kratom cuttings and I'd swap for an e novo plant. I'd give more than one cutting if it was a nice one. I'd also take a nice cactus, maybe a good size bridgesii or a monstrose bridgesii. Might be one or two other things I'd take but can't discuss everything. Other deals can be arranged.
-------------------- “A democracy cannot exist as a permanent form of government. It can only exist until the voters discover that they can vote themselves largesse from the public treasury. From that moment on, the majority always votes for the candidates promising the most benefits from the public treasury with the result that a democracy always collapses over loose fiscal policy, always followed by a dictatorship.” (attributed to Alexis de Tocqueville political philosopher Circa 1835) Trade list http://www.shroomery.org/forums/showflat.php/Number/18047755
|
stvip
Strange stranger
Registered: 03/21/05
Posts: 195
Loc: Israel
Last seen: 17 years, 2 months
|
Re: DEA discovers kratom [Re: Stonehenge]
#4584171 - 08/26/05 01:57 PM (18 years, 7 months ago) |
|
|
I don't want to derail the thread in the direction of another natural versus non-natural argument (or even quibble over what 'natural' means, and I love to quibble!). As for sugar, suffice it to say that I believe drug harm-reduction programs should focus first and foremost not on amphetamine, nor on opioids, but on the euphoric, addictive, extremely health-damaging drugs known as refined sugars (and even these blights I don't believe should be outlawed).
Anyhow, perhaps this recent negative attention kratom has been receiving will prompt people to participate in my search for other plant-derived opioids project: http://www.shroomery.org/forums/showflat...rue#Post4465526
The current status is that I have finalized a list of the most promising candidates and have sent it to Shaman's Palace to see if they could source them.
|
Locus
Registered: 03/11/04
Posts: 6,112
Last seen: 3 years, 1 day
|
Re: DEA discovers kratom [Re: Stonehenge]
#4586491 - 08/27/05 02:18 AM (18 years, 7 months ago) |
|
|
you're probably right, we should get some now just in case... but i think we still have quite a while before it will get the least bit difficult to acquire it.
-------------------- The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein "Fear is the great barrier to human growth." ~ Dr. Robert Monroe ~~~*Dosis sola facit venenum*~~~ *Check my profile to listen to my music*
|
|