Home | Community | Message Board


Vaposhop
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop for: San Pedro

Jump to first unread post. Pages: 1
Invisiblemskip23
Can It All Be So Simple!
 User Gallery

Registered: 06/08/05
Posts: 1,519
Loc: Philly
help please(update)
    #4551317 - 08/18/05 01:22 PM (11 years, 3 months ago)

I just received 2 peyote cactus in the mail. They were in the mail for like 2 weeks. They came in pots of there own which are all cracked. Should I transplant them into different pots? How much water should I give them? And does anybody know of a good guide on how to care for peyote? Sorry if this sounds dumb but this is the first cactus I ever owned and I don't want anything to happen to them.

heres what they looked like then


pretty shabby right

now heres how they look and my cacti garden has expanded






Thanks for all the help!! :cool:


Edited by mskip23 (11/10/05 06:13 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLegoulash
Stranger
 User Gallery
Registered: 09/07/02
Posts: 4,347
Last seen: 5 years, 5 months
Re: help please [Re: mskip23]
    #4551587 - 08/18/05 02:42 PM (11 years, 3 months ago)

I was gonna give you a link to The Nook(Nans Nook)
Does anyone know what happend to tbat site?? It seems to have dissapeared.

http://www.mushmush.nl/?page=home\methods

Thats the best besides The nook.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflinemotamanM
old hand
 User Gallery
Registered: 12/18/02
Posts: 6,021
Last seen: 3 days, 5 hours
Re: help please [Re: Legoulash]
    #4551812 - 08/18/05 03:56 PM (11 years, 3 months ago)



--------------------
http://heffter.org


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLegoulash
Stranger
 User Gallery
Registered: 09/07/02
Posts: 4,347
Last seen: 5 years, 5 months
Re: help please [Re: motaman]
    #4551828 - 08/18/05 04:00 PM (11 years, 3 months ago)

Duh, my bookmark was .info for some reason.. Thanks Man.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflinemotamanM
old hand
 User Gallery
Registered: 12/18/02
Posts: 6,021
Last seen: 3 days, 5 hours
Re: help please [Re: Legoulash]
    #4552049 - 08/18/05 04:48 PM (11 years, 3 months ago)

They where a .info for a bit, but then they changed back to .org..  :smirk:


--------------------
http://heffter.org


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblemskip23
Can It All Be So Simple!
 User Gallery

Registered: 06/08/05
Posts: 1,519
Loc: Philly
Re: help please [Re: motaman]
    #4552300 - 08/18/05 06:00 PM (11 years, 3 months ago)

thanks


--------------------
url=https://files.shroomery.org/files/05-26/988356075-Picture-278.gif][/url


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblemskip23
Can It All Be So Simple!
 User Gallery

Registered: 06/08/05
Posts: 1,519
Loc: Philly
Re: help please [Re: mskip23]
    #4917306 - 11/10/05 12:12 PM (11 years, 30 days ago)

update


--------------------
url=https://files.shroomery.org/files/05-26/988356075-Picture-278.gif][/url


Post Extras: Print Post  Remind Me! Notify Moderator
InvisiblelIllIIIllIlIIlIlIIllIllIIl
Stranger
 Arcade Champion: Airfox

Registered: 12/16/04
Posts: 11,123
Loc: Texas
Re: help please(update) [Re: mskip23]
    #4918504 - 11/10/05 05:07 PM (11 years, 30 days ago)

Hey I ended up putting two pereskiopsis in one container (like you did in a few). I felt kind of guilty about this... have you noticed any bad effects? Or do you think it doesn't matter?

Your lophos look way better, too. Way to nurse em back :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblemskip23
Can It All Be So Simple!
 User Gallery

Registered: 06/08/05
Posts: 1,519
Loc: Philly
Re: help please(update) [Re: lIllIIIllIlIIlIlIIllIllIIl]
    #4918735 - 11/10/05 06:19 PM (11 years, 30 days ago)

So far so good with two in the same pot.... the cuttings have been in there for about a month and a half... Im going to take them out soon because they seem very well rooted.... How about yours? (edit I change the pics because I had doubles)


--------------------
url=https://files.shroomery.org/files/05-26/988356075-Picture-278.gif][/url


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: help please(update) [Re: mskip23]
    #4918792 - 11/10/05 06:42 PM (11 years, 30 days ago)

Thats one healthy gymnocalycium in there. Nice setup. :smile:


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblemetasin
Stranger
 User Gallery

Registered: 10/12/04
Posts: 972
Re: help please(update) [Re: mskip23]
    #4918798 - 11/10/05 06:44 PM (11 years, 30 days ago)

Nice LW's.

The pereskiopsis will take off with your new light, be ready.


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblemskip23
Can It All Be So Simple!
 User Gallery

Registered: 06/08/05
Posts: 1,519
Loc: Philly
Re: help please(update) [Re: metasin]
    #4918949 - 11/10/05 07:20 PM (11 years, 30 days ago)

yeah since my balcony and all my windows face the east at my apartment they weren't doing too good..so I hope I get some good growth now


--------------------
url=https://files.shroomery.org/files/05-26/988356075-Picture-278.gif][/url


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblemskip23
Can It All Be So Simple!
 User Gallery

Registered: 06/08/05
Posts: 1,519
Loc: Philly
Re: help please(update) [Re: Koala Koolio]
    #4918959 - 11/10/05 07:22 PM (11 years, 30 days ago)

Quote:

elgr said:
Thats one healthy gymnocalycium in there. Nice setup. :smile:




Thanks my girlfriend bought me the gym


--------------------
url=https://files.shroomery.org/files/05-26/988356075-Picture-278.gif][/url


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLegoulash
Stranger
 User Gallery
Registered: 09/07/02
Posts: 4,347
Last seen: 5 years, 5 months
Re: help please(update) [Re: mskip23]
    #4919107 - 11/10/05 07:49 PM (11 years, 30 days ago)

wow that button realy has large tuffs of hair. isnt a differnt type of Wiliamsii? Or do some just grow like taht?


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: help please(update) [Re: Legoulash]
    #4919165 - 11/10/05 08:04 PM (11 years, 30 days ago)

They normally do, but not until they're a bit bigger. Maybe the issues from before make it look a little smaller/younger?


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblemetasin
Stranger
 User Gallery

Registered: 10/12/04
Posts: 972
Re: help please(update) [Re: mskip23]
    #4919189 - 11/10/05 08:12 PM (11 years, 30 days ago)

I usually have my 400 a little bit closer than that though (with safety glass in the reflector). Are you still acclimating them?


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblemskip23
Can It All Be So Simple!
 User Gallery

Registered: 06/08/05
Posts: 1,519
Loc: Philly
Re: help please(update) [Re: Koala Koolio]
    #4919193 - 11/10/05 08:13 PM (11 years, 30 days ago)

not sure what type it is I got it from a trade my guess is it is a Wiliamsii and u can see that the guy did not know how to care for it... so I got no info on it other then its a peyote cactus


--------------------
url=https://files.shroomery.org/files/05-26/988356075-Picture-278.gif][/url


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblemskip23
Can It All Be So Simple!
 User Gallery

Registered: 06/08/05
Posts: 1,519
Loc: Philly
Re: help please(update) [Re: metasin]
    #4919200 - 11/10/05 08:16 PM (11 years, 30 days ago)

Quote:

recondite said:
I usually have my 400 a little bit closer than that though (with safety glass in the reflector). Are you still acclimating them?




yeah...Im going to move the light closer next week


--------------------
url=https://files.shroomery.org/files/05-26/988356075-Picture-278.gif][/url


Post Extras: Print Post  Remind Me! Notify Moderator
InvisiblelIllIIIllIlIIlIlIIllIllIIl
Stranger
 Arcade Champion: Airfox

Registered: 12/16/04
Posts: 11,123
Loc: Texas
Re: help please(update) [Re: mskip23]
    #4920446 - 11/11/05 01:37 AM (11 years, 30 days ago)

Mine were already well rooted, though the container is about 10 inches in diameter (a bit bigger than yours). So far they seem okay, just small amount of growth. They are in front of a south facing window underneath the heat vent.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineHerbanShaman
I am the Walrus

Registered: 07/15/04
Posts: 233
Loc: Everywhere and Nowhere
Last seen: 10 years, 7 months
Re: help please(update) [Re: lIllIIIllIlIIlIlIIllIllIIl]
    #4926840 - 11/12/05 09:58 PM (11 years, 28 days ago)

I suggest that you dont' water them at all. I'm guessing if you poked those areas that look collapsed that they would be soggy or soft. My guess would be that its rotting from being neglected by whoever sold it to you. This is VERY COMMON. People don't care about this poor endangered species. Repot it in case the soil is contaminated heavily by some sort of pollutant or plant plague lol. Do not water!! These things can go well beyond 6 mo without water. Give it 3 mo minimum and see if it pulls out of it. Chances are that overwatering is what caused the rot in the first place. I really hope this advice helps.


--------------------
"There is a world beyond ours, a world that is far away, nearby, and invisible. And there is where God lives, where the dead live, the spirits and the saints, a world where everything has already happened and everything is known. That world talks. It has a language of its own. I report what it says. The sacred mushroom takes me by the hand and brings me to the world where everything is known. It is they, the sacred mushrooms, that speak in a way I can understand. I ask them and they answer me. When I return from the trip that I have taken with them, I tell what they have told me and what they have shown me."
-- Mazatec shaman


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Amazon Shop for: San Pedro

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Similar ThreadsPosterViewsRepliesLast post
* Kratom Seedling
( 1 2 3 all )
clemens 3,751 48 09/08/07 09:34 PM
by cpw1971
* (02-17: UPDATED) Solanaceous series: a multipost dhutra primer: Part one and two
( 1 2 all )
Aneglakya 3,646 20 02/19/05 03:11 AM
by BorgFace
* San Pedro, growing vs. buying for immediate use? (Update: new ones!)
( 1 2 all )
Konnrade 2,478 21 09/26/05 12:45 AM
by Koala Koolio
* Salvia growlog (school greenhouse)
( 1 2 all )
demiu5 3,662 32 03/26/07 11:02 PM
by flushme
* My new Salvia and peyote (updated with pics 5/28/07) Simisu 1,517 11 05/29/07 06:36 AM
by Simisu
* Save My Salvia (update 03/07)
( 1 2 all )
Quake3 2,944 20 03/07/08 09:45 PM
by Zinglons Acolyte
* Cereus graft (process and outcome).
( 1 2 all )
neuro 3,626 20 08/23/04 06:21 PM
by neuro
* Acclimating A Kratom to Lower Humidity thefiendhitman 447 2 03/05/09 06:21 PM
by thefiendhitman

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless
727 topic views. 2 members, 9 guests and 4 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
World Seed Supply
Please support our sponsors.

Copyright 1997-2016 Mind Media. Some rights reserved.

Generated in 0.061 seconds spending 0.007 seconds on 14 queries.