Home | Community | Message Board

NorthSpore.com BOOMR Bag!
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Left Coast Kratom Buy Kratom Extract   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Mushroom-Hut Mono Tub Substrate   Kraken Kratom Red Vein Kratom   Unfolding Nature Unfolding Nature: Being in the Implicate Order

Jump to first unread post Pages: 1 | 2  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinebullettoothtony
reality_skewed

Registered: 09/15/01
Posts: 69
Last seen: 7 years, 8 months
zoloft
    #448319 - 11/05/01 09:45 PM (22 years, 3 months ago)

I have a friend who takes the prescription drug Zoloft. I'm pretty sure its for depression. I was just wondering if anyone knows if there would be any drug interactions between Zoloft and shrooms. I know it might not be a good idea if she is depressed, but she really wants to try them and I'm not so sure she's depressed anyways. I'll have to talk to her first. But I just need to know if anyone has any info on Zoloft.


Extras: Filter Print Post Top
Offlineegolesss
veteran
Registered: 10/25/00
Posts: 1,005
Last seen: 21 years, 3 months
Re: zoloft [Re: bullettoothtony]
    #448326 - 11/05/01 09:52 PM (22 years, 3 months ago)

Other than mentally someone on Zoloft should not take shrooms, physically there is no harm.


--------------------
Going crazy will drive you mad, but once you get there the rest is easy....All spores are not created equal!!!!!!!!!!! Sporeworks, Hawkseye, PF, they are completely viable with very strong genetics.




Extras: Filter Print Post Top
Offlinegluke bastid
Stinky Bum
Male User Gallery

Registered: 12/20/00
Posts: 3,322
Loc: Charm City
Last seen: 5 years, 4 months
Re: zoloft [Re: egolesss]
    #448341 - 11/05/01 10:11 PM (22 years, 3 months ago)

Don't listen to Egoless. People don't take zoloft or other anti-depressants because they are mentally unstable, as he implied. People take anti-depressants because they have chemical imbalances that result in mood problems. Zoloft doesn't have the ability to make anyone "un-crazy" anyway, just increases their serotonin levels.

I have never had any problems with anti-depressants interacting with shrooms. I don't take zoloft, but I don't see why it would be any different. But don't trust me, ask a doctor. I mean it... ASK A DOCTOR.


--------------------
:hst:
Society in every form is a blessing,
but government at its best is but a necessary evil
 
- Thomas Paine


Extras: Filter Print Post Top
OfflineMarleyBob
Pooh-Bah
Registered: 05/26/99
Posts: 949
Loc: USSA
Last seen: 21 years, 9 months
Re: zoloft [Re: bullettoothtony]
    #448355 - 11/05/01 10:20 PM (22 years, 3 months ago)

my one friend who is on zoloft usually needs about twice the normal does of tryptamines than the rest of us to "get off". That might just be his personal brain chemistry though.


Extras: Filter Print Post Top
Offlineegolesss
veteran
Registered: 10/25/00
Posts: 1,005
Last seen: 21 years, 3 months
Re: zoloft [Re: gluke bastid]
    #448357 - 11/05/01 10:21 PM (22 years, 3 months ago)

First of all you don't even take the drug gluke bastid, people don't take anti-depressants because they are imbalanced, they can have something going on in their life that calls for a little help. Also Zoloft is not recomended for use over 3 months straight, chemical imbalances last more than several months last time I checked. Good advice to ask a Dr., but its not an MAO and it it is physically safe....Don't tell someone unfactual information and try to second guess someone with answers, it's dangerous and why would you want to do that?


--------------------
Going crazy will drive you mad, but once you get there the rest is easy....All spores are not created equal!!!!!!!!!!! Sporeworks, Hawkseye, PF, they are completely viable with very strong genetics.




Extras: Filter Print Post Top
Offlinebullettoothtony
reality_skewed

Registered: 09/15/01
Posts: 69
Last seen: 7 years, 8 months
Re: zoloft [Re: egolesss]
    #448370 - 11/05/01 10:29 PM (22 years, 3 months ago)

Ok, well it sounds like its physically safe so I guess thats good. I will talk to her. I have another question though. I have another friend thats taking prozac. Any thoughts on that?


Extras: Filter Print Post Top
Offlinegluke bastid
Stinky Bum
Male User Gallery

Registered: 12/20/00
Posts: 3,322
Loc: Charm City
Last seen: 5 years, 4 months
Re: zoloft [Re: egolesss]
    #449290 - 11/06/01 06:07 PM (22 years, 3 months ago)

I actually took zoloft for over a year.
I take anti-depressants precisely because of chemical imbalance and I've never talked to anyone who was ever prescribed zoloft or any other ant-depressant for a short period of time in which they needed "a little help," although I guess it is possible. The thing about anti-depressants is they don't really start having any effect on someone until about 3 weeks after they start taking them so I never figured they'd be used in such a situation. Still, you might be right about that.

I don't see how my "unfactual" information which is just my experience caused any harm, because in my experience there is no physical/chemical interaction between shrooms/lsd and anti-depressants which is what you stated.

Who was I second guessing?


--------------------
:hst:
Society in every form is a blessing,
but government at its best is but a necessary evil
 
- Thomas Paine


Extras: Filter Print Post Top
Offline420chick
Stranger
Registered: 11/11/01
Posts: 11
Loc: mid west.... Corn fields!...
Last seen: 21 years, 11 months
Re: zoloft [Re: bullettoothtony]
    #465422 - 11/21/01 08:46 AM (22 years, 3 months ago)

i have taken zoloft for a while and i have had no problems with any drugs i've done. I even tripped acid on it and i had no problems. your friend should be fine physically. just make sure she is emotionally stable enough to handle the trip. also, make sure she is in a familier enviroment and with people she knows and trusts well. other than that have fun and good luck!! ;)

peace and love


--------------------
[white]White rabbit peaks at midnight!![/white]:shocked:

[heart]love and peace all[peace]


Extras: Filter Print Post Top
OfflineGeek
Stranger

Registered: 11/15/01
Posts: 22
Loc: London, England
Last seen: 22 years, 3 months
Re: zoloft [Re: 420chick]
    #466437 - 11/22/01 06:14 AM (22 years, 3 months ago)

I'm on Sertraline, another version of Zoloft. I have a chemical imbalance, and that pill fixes it. Taking shrooms whilst on these has no problems. The shroom messes with a different part of your brain (i believe, but i could be wrong). Tell your friend not to worry.


--------------------
---

Black Metal & Shrooms!
The Ultimate Black Trip!


Extras: Filter Print Post Top
OfflineSpidey
Stranger
Registered: 11/24/01
Posts: 21
Last seen: 22 years, 2 months
Re: zoloft [Re: Geek]
    #469808 - 11/26/01 05:57 AM (22 years, 2 months ago)

Actually, Zoloft (Sertraline) does work on similar brain areas as Psilocybin and LSD.

Zoloft is in a catergory of antidepressants that are called SSRI's.

SSRI stands for Seritonin-Specific-Reuptake-Inhibitor.

What it does is potentiates serotonin neorotransmission by inhibiting its active presynaptic reuptake at the 5-HT sites, thus increasing seritonin neurotransmission throughout the brain. (A Primer of Drug Action 8th edition, Robert M. Julien, MD., 1998, page, 200-204)

Conversely, LSD, Psilocybin, and other Seritonin-like psychedelics exhibit their action by decreasing seritonin neurotransmission; resulting in an inhibition of seritonin throughout the brain. (same source, page,358-360)

So, in a sense, Zoloft acts in an opposite way than LSD and psilocybin. Therefore the two are counterproductive when taken together.



Extras: Filter Print Post Top
InvisiblePinhead
Oregano
Male

Registered: 05/13/00
Posts: 1,819
Loc: Hootersville
Re: zoloft [Re: Spidey]
    #469816 - 11/26/01 06:56 AM (22 years, 2 months ago)

I have to agree about the SSRIs and shrooms counteracting each other.
I don't trip off from 4gms of cubies unless I don't take my Effexor for a day. This is percisely why I don't do shrooms anymore,maybe medical science will come up with a more psychadelicly compatiable anti-depressant in the future.
I suppose how much of a particular SSRI you're taking would make a difference also,but I've never heard that they are a dangerous combination.


Extras: Filter Print Post Top
OfflineWarped_Ventricle
journeyman
Registered: 09/20/01
Posts: 85
Last seen: 21 years, 10 months
Re: zoloft [Re: Pinhead]
    #469823 - 11/26/01 07:09 AM (22 years, 2 months ago)

I'm on 40 mg of celexa (SSRI) a day and I trip fine.
But I agree it might not be a good idea to do them while depressed.


Extras: Filter Print Post Top
Offlinejimmyvengeance
member
Registered: 11/26/01
Posts: 130
Last seen: 19 years, 5 months
Re: zoloft [Re: Pinhead]
    #470159 - 11/26/01 02:47 PM (22 years, 2 months ago)

I think you may have oversimplified the action of the hallucinogens, but you're basically right.

In subjective studies, people taking SSRIs have had generally reduced effects from seratonergic hallucinogens. That is, if you're taking zoloft, mushrooms aren't going to hit you as hard. Of course, subjective effects are dependent on a number of variables, including SSRI dosage, mushroom dosage, general susceptibility to hallucinogens, etc. It's a big, complicated mess, but luckily, the combination is safe (hell, maybe even safer than mushrooms alone).

-Jim


Extras: Filter Print Post Top
OfflineGrimace
enthusiast
Registered: 04/04/00
Posts: 161
Loc: Oregon
Last seen: 21 years, 9 months
Re: zoloft [Re: jimmyvengeance]
    #470830 - 11/27/01 01:54 AM (22 years, 2 months ago)

Well, take it from someone that has been on Zoloft and taken shrooms at the same time. As your friend, I was taking them for a mild-severe depression. I had been taking them for about two months, so I was well adjusted to the drug. Mushrooms had no odd effects (I had taken them once before while no on Zoloft) and were very enjoyable. There is nothing in Zoloft that should differ the effects psilocybin. Your friend will be fine as long as she takes it slow, probably 1-2 grams, as this is what I did (I know individuals can differ).
Best bet is to under-dose and play it safe. Chemically, you have no worries but mentaly it's always a shoke, especially for those that have been going through any kind of depression.
On the bright side, the mushrooms will most likely act as a healing agent, however this is never a reason to go off of a perscription drug, which is exactly what I did. Tell her to stick with it, and it will eventually adapt here biology.

Grimace


--------------------
"Is there anyway of knowing........which direction we are going?!! Yes!"
Mr. Wonka


Extras: Filter Print Post Top
OfflineForTheBuddha
Dr Buddha
Registered: 10/04/05
Posts: 4
Last seen: 18 years, 4 months
Re: zoloft [Re: Spidey]
    #4753455 - 10/04/05 09:39 AM (18 years, 4 months ago)

This is exactly the type of info I'm looking for :laugh:

Thanks Spidey  :thumbup:

I've just recently started taking Zoloft.  I've been on the treatment for 6 weeks now.  I started out @ 25mg/day and gradually want up to my current 100mg/day.  Zoloft is great, however it's not what I expected.  It helps all the time.  I'm no longer anxious or nervous when I get stoned, which is good cause I'm usually stoned all the time.

I've only had shrooms once before and it was a very small amount of someone's left overs.  I'de say over a gram, but not two.  It was a fun little trip.  I've also tripped on LSD several times.

I've always had an inherently curious nature, as most of us do

Quote:

Spidey said:
Actually, Zoloft (Sertraline) does work on similar brain areas as Psilocybin and LSD.
<br>
<br>Zoloft is in a catergory of antidepressants that are called SSRI's.
<br>
<br>SSRI stands for Seritonin-Specific-Reuptake-Inhibitor.
<br>
<br>What it does is potentiates serotonin neorotransmission by inhibiting its active presynaptic reuptake at the 5-HT sites, thus increasing seritonin neurotransmission throughout the brain.  (A Primer of Drug Action 8th edition, Robert M. Julien, MD., 1998, page, 200-204)
<br>
<br>Conversely, LSD, Psilocybin, and other Seritonin-like psychedelics exhibit their action by decreasing seritonin neurotransmission; resulting in an inhibition of seritonin throughout the brain. (same source, page,358-360)
<br>
<br>So, in a sense, Zoloft acts in an opposite way than LSD and psilocybin.  Therefore the two are counterproductive when taken together.
<br>
<br>




Extras: Filter Print Post Top
OfflineShroomArtist84
Stranger
Registered: 08/09/05
Posts: 2,414
Last seen: 18 years, 25 days
Re: zoloft [Re: ForTheBuddha]
    #4754165 - 10/04/05 12:39 PM (18 years, 4 months ago)

damn spidey , good information


--------------------
No matter what I say and no matter what I write here.

I'm sick of always looking at this page with a blank stare.


Extras: Filter Print Post Top
OfflineThePredator
Your a eunich ifyou don't useunix!

Registered: 08/23/05
Posts: 542
Last seen: 17 years, 7 months
Re: zoloft [Re: ShroomArtist84]
    #4754552 - 10/04/05 01:52 PM (18 years, 4 months ago)

Because shrooms/lsd only decrease 5-HT in the 5-HT(2a) site, and it increases serotonin in the other sites (except for 4 and 5), the effects would be slightly different, how different would depend on your sensitivty. But I would imagine that it would make the trip more euphoric and put the person in a good mood.


--------------------


Extras: Filter Print Post Top
Invisiblebadchad
Mad Scientist

Registered: 03/02/05
Posts: 13,373
Re: zoloft [Re: ThePredator]
    #4754963 - 10/04/05 03:17 PM (18 years, 4 months ago)

Generally speaking, SSRI's will decrease the subjective effects of hallucinogens. There was a study done on the effects of SSRI's and LSD and it was found that the subjective effects decrease. While there are differences, the two drugs have similar effects on the serotonin systems of the brain.

http://www.ncbi.nlm.nih.gov/entrez/query...&query_hl=3


--------------------
...the whole experience is (and is as) a profound piece of knowledge.  It is an indellible experience; it is forever known.  I have known myself in a way I doubt I would have ever occurred except as it did.

Smith, P.  Bull. Menninger Clinic (1959) 23:20-27; p. 27.

...most subjects find the experience valuable, some find it frightening, and many say that is it uniquely lovely.

Osmond, H.  Annals, NY Acad Science (1957) 66:418-434; p.436


Extras: Filter Print Post Top
InvisibleRustifer
prestige worldwide
Male

Registered: 04/10/05
Posts: 7,071
Loc: Central Texas
Re: zoloft [Re: badchad]
    #4754968 - 10/04/05 03:19 PM (18 years, 4 months ago)

I've heard if you take this stuff for a long time then abrubtly stop using it it kills you.


Extras: Filter Print Post Top
OfflineThePredator
Your a eunich ifyou don't useunix!

Registered: 08/23/05
Posts: 542
Last seen: 17 years, 7 months
Re: zoloft [Re: Rustifer]
    #4754993 - 10/04/05 03:27 PM (18 years, 4 months ago)

Rustifer, you heard wrong. Theirs a chance that it could send you into shock, but it wouldn't outright kill you.


--------------------


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: zoloft [Re: ThePredator]
    #4754994 - 10/04/05 03:28 PM (18 years, 4 months ago)

My girlfriend was on zoloft for a long time. Noticable decreases in the effect of psilocybin, lsa, lsd, and mescaline were noticed. After being 'clean' for a month or two, effects were noticably stronger (normal).

Simply because someone is prescribed to zoloft doesn't mean that they're not 'suitable' for psychedelic use. I know cases that zoloft has been prescribed simply to get rid of mild depression and mild obsessive compulsive disorders.

We're not all chemically the same. Some of us are more shy, closed up. Some are quite the opposite. Such shy people often have a hard time and become somewhat depressed, but not to the point where they would be diagnosed with depression. I've known people who've gotten zoloft as it makes fitting in to dailey life a non-issue. It made them naturally friendly and talkative, and honestly (in my opinion) completely different people. The uniqueness was ripped from them and was instantly replaced by a comforting conformity. But, these are just my personal issues with this drug...

Zoloft makes psychedellic drugs less intense. It'll make MDMA do nearly nothing at all. Zoloft isn't prescribed for a mere three months. It takes over a month for it to even kick in to full effect. (In the people I've known, they start out with a low dose of 25, and after a month are at 50 or 100mg/day).

I've seen zoloft used for minor (in my opinion, important in the user's) issues of social anxiety disorder. To me, it also seems their TV ads are targeting people with such issues. While there are surely many who wouldn't be fit for psychedellic use, the mere fact that a doctor has recommended them zoloft isn't enough to determine that. However, while actually on the drug, you might not get much out of your psychedellics. It takes weeks for this effect to wear off, and it's highly recommended NOT to stop zoloft cold turkey. Might be fine for some, but I've read about severe depression and suicide from this.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineTheDoctor
Stranger

Registered: 08/17/05
Posts: 50
Last seen: 13 years, 2 months
Re: zoloft [Re: Koala Koolio]
    #4755010 - 10/04/05 03:35 PM (18 years, 4 months ago)

I have a buddy who takes Concerta (Methylphenidate), he takes it for ADD. would that in any way affect his trip differently?


Extras: Filter Print Post Top
OfflineThePredator
Your a eunich ifyou don't useunix!

Registered: 08/23/05
Posts: 542
Last seen: 17 years, 7 months
Re: zoloft [Re: TheDoctor]
    #4755028 - 10/04/05 03:40 PM (18 years, 4 months ago)

No, methylphenidate acts similar to amphetamine as a CNS stimulant.


--------------------


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2  [ show all ]

Shop: Left Coast Kratom Buy Kratom Extract   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Mushroom-Hut Mono Tub Substrate   Kraken Kratom Red Vein Kratom   Unfolding Nature Unfolding Nature: Being in the Implicate Order


Similar ThreadsPosterViewsRepliesLast post
* Zoloft and acid sanchothestoner 16,404 13 11/05/12 09:51 PM
by Psilosomniac
* Damn zoloft.. xxallonblack 12,238 17 11/30/08 01:18 PM
by xxallonblack
* Mushrooms, Acid, and Zoloft westthebest 1,552 0 11/29/11 10:52 PM
by westthebest
* Zoloft swap to microdosing mushrooms Enkidu 1,168 15 04/09/20 12:28 AM
by InfraredRick
* Lsd and zoloft, how should I do this? sk8chic100 1,992 13 03/18/16 06:53 AM
by Hanz
* Anyone Here On Zoloft? Cloud_Man 20,406 10 10/01/08 07:15 AM
by Abnormal
* Is being on zoloft gonna ruin my tripping?? MyceliumDelirium 1,646 2 08/18/10 10:41 AM
by MyceliumDelirium
* Can i take zoloft and mushrooms? funianrun 5,957 2 07/03/12 03:38 PM
by MorphinTime

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
56,909 topic views. 6 members, 45 guests and 15 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.029 seconds spending 0.008 seconds on 12 queries.