Home | Community | Message Board

Original Seeds Store
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Mushroom-Hut Mono Tub Substrate, Substrate Bags   North Spore Bulk Substrate   PhytoExtractum Maeng Da Thai Kratom Leaf Powder

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery

Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 25 minutes
Trusted Cultivator
Psilocybe sierrae aka P. subfimetaria * 1
    #4397850 - 07/12/05 10:06 PM (18 years, 6 months ago)

Psilocybe sierrae 7/12/05



I'm pretty sure about the identification on this one, but not 100%. Original singular specimen was collected in a field with Psilocybe semilanceata. Fruits easily and densely on manure based substrates.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Unfilter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery

Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 25 minutes
Trusted Cultivator
Re: Psilocybe sierrae aka P. subfimetaria [Re: scatmanrav]
    #4397983 - 07/12/05 10:48 PM (18 years, 6 months ago)

They are active and one (and only) test subject reported the potency roughly equal to Psilocybe cubensis.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Edited by Workman (07/12/05 10:49 PM)


Extras: Unfilter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery

Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 25 minutes
Trusted Cultivator
Re: Psilocybe sierrae aka P. subfimetaria [Re: Cyano]
    #5004782 - 12/01/05 10:48 PM (18 years, 1 month ago)

I haven't attempted it. Fruiting temperature is around 55-60F


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Unfilter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 25 minutes
Trusted Cultivator
Re: Psilocybe sierrae aka P. subfimetaria [Re: Workman] * 6
    #28610290 - 01/05/24 09:41 AM (22 days, 11 hours ago)

ITS sequence of specimen.

CAAATTGTCATTTGTATTGTCCAAACGAAGGAACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGCCCACGGCGTAGATAATTATCACACCAATAGACGGCTTTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAACTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTGCAAGGAGAGCTTGTGAAAGCAATCCTCCCGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGGGACACGGCGAGCACATGTCCTCGAGAGGACCAGCTACAACCGAGCCAAGTTTATTCCAATAATGATCCTTTCCGCAGGTTCCCCCTACGGAA


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Unfilter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 25 minutes
Trusted Cultivator
Re: Psilocybe sierrae aka P. subfimetaria [Re: BlimeyGrimey] * 3
    #28617713 - 01/11/24 02:32 PM (16 days, 6 hours ago)

Quote:

BlimeyGrimey said:
Quote:

inski said:
Yes, and it's macroscopically similar to P. stuntzii also.




I'm not very good at interpreting ITS data, but is there a chance this is Ps. stuntzii? Most of the Ps. stuntzii in the blast don't even match 100% to each other, and this ITS sequence even has some 99.5% matches with Ps. stuntzii. Once again though,  I'm not very versed in ITS data.


Quote:

the_chosen_one said:
This is awesome!

Hey Grimes! Good to see you around again! :wave:




Hey TCO! I'm back! :cool:

Over the next few months I'll be getting back into the hobby. Just got a scope after being scope-less for a decade.




ITS data is very new to me too. I don't fully understand what I am looking at (yet) but the potential is huge. Currently working towards getting my entire collection sequenced. Good to see you Grimey!


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Unfilter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 25 minutes
Trusted Cultivator
Re: Psilocybe sierrae aka P. subfimetaria [Re: Workman] * 1
    #28619585 - 01/13/24 10:33 AM (14 days, 10 hours ago)

Alan Rockefeller confirms that it is P. stuntzii. So I guess it is settled and not so novel after all.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Unfilter Print Post Top
Jump to top Pages: 1

Shop: Mushroom-Hut Mono Tub Substrate, Substrate Bags   North Spore Bulk Substrate   PhytoExtractum Maeng Da Thai Kratom Leaf Powder


Similar ThreadsPosterViewsRepliesLast post
* Genetic Relationship of Psilocybe Species... fastfred 5,153 11 10/19/14 11:52 PM
by Alan Rockefeller
* RogerRabbit gets P. cubensis "Red Boy" aka Redspore!!!
( 1 2 3 all )
fastfred 16,172 49 04/18/11 01:41 PM
by RogerRabbit
* Psilocybe zapotecorum WorkmanV 4,417 3 06/22/05 04:56 AM
by scatmanrav
* Psilocybe semilanceata help please.
( 1 2 all )
Paid 9,155 30 06/09/03 10:48 AM
by comario2
* Selection of "Psilocybe atlantis"
( 1 2 all )
WorkmanV 8,831 33 08/23/05 08:21 AM
by blackout
* Presence of Phenylethylamine in Hallucinogenic Psilocybe Mus Hermes_br 3,158 18 03/31/05 06:09 PM
by hjalmar
* Several Psilocybe cyanescens questions LordByron 7,202 16 01/04/08 09:28 PM
by LordByron
* Psilocybe hispanica
( 1 2 3 4 5 6 all )
WorkmanV 23,547 112 11/05/23 12:38 PM
by smalltalk_canceled

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, Pastywhyte, bodhisatta
21,178 topic views. 1 members, 7 guests and 1 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.024 seconds spending 0.004 seconds on 15 queries.