|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Workman
1999 Spore War Veteran


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 24 minutes
|
Psilocybe sierrae aka P. subfimetaria 1
#4397850 - 07/12/05 10:06 PM (18 years, 6 months ago) |
|
|
Psilocybe sierrae 7/12/05

I'm pretty sure about the identification on this one, but not 100%. Original singular specimen was collected in a field with Psilocybe semilanceata. Fruits easily and densely on manure based substrates.
-------------------- Research funded by the patrons of The Spore Works Exotic Spore Supply My Instagram Reinvesting 25% of Sales Towards Basic Research and Species Identification 
|
Workman
1999 Spore War Veteran


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 24 minutes
|
Re: Psilocybe sierrae aka P. subfimetaria [Re: scatmanrav]
#4397983 - 07/12/05 10:48 PM (18 years, 6 months ago) |
|
|
They are active and one (and only) test subject reported the potency roughly equal to Psilocybe cubensis.
-------------------- Research funded by the patrons of The Spore Works Exotic Spore Supply My Instagram Reinvesting 25% of Sales Towards Basic Research and Species Identification 
Edited by Workman (07/12/05 10:49 PM)
|
Workman
1999 Spore War Veteran


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 24 minutes
|
Re: Psilocybe sierrae aka P. subfimetaria [Re: Cyano]
#5004782 - 12/01/05 10:48 PM (18 years, 1 month ago) |
|
|
I haven't attempted it. Fruiting temperature is around 55-60F
-------------------- Research funded by the patrons of The Spore Works Exotic Spore Supply My Instagram Reinvesting 25% of Sales Towards Basic Research and Species Identification 
|
Workman
1999 Spore War Veteran



Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 24 minutes
|
Re: Psilocybe sierrae aka P. subfimetaria [Re: Workman] 6
#28610290 - 01/05/24 09:41 AM (22 days, 11 hours ago) |
|
|
ITS sequence of specimen.
CAAATTGTCATTTGTATTGTCCAAACGAAGGAACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGCCCACGGCGTAGATAATTATCACACCAATAGACGGCTTTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAACTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTGCAAGGAGAGCTTGTGAAAGCAATCCTCCCGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGGGACACGGCGAGCACATGTCCTCGAGAGGACCAGCTACAACCGAGCCAAGTTTATTCCAATAATGATCCTTTCCGCAGGTTCCCCCTACGGAA
-------------------- Research funded by the patrons of The Spore Works Exotic Spore Supply My Instagram Reinvesting 25% of Sales Towards Basic Research and Species Identification 
|
Workman
1999 Spore War Veteran



Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 24 minutes
|
Re: Psilocybe sierrae aka P. subfimetaria [Re: BlimeyGrimey] 3
#28617713 - 01/11/24 02:32 PM (16 days, 6 hours ago) |
|
|
Quote:
BlimeyGrimey said:
Quote:
inski said: Yes, and it's macroscopically similar to P. stuntzii also.
I'm not very good at interpreting ITS data, but is there a chance this is Ps. stuntzii? Most of the Ps. stuntzii in the blast don't even match 100% to each other, and this ITS sequence even has some 99.5% matches with Ps. stuntzii. Once again though, I'm not very versed in ITS data.
Quote:
the_chosen_one said: This is awesome!
Hey Grimes! Good to see you around again! 
Hey TCO! I'm back! 
Over the next few months I'll be getting back into the hobby. Just got a scope after being scope-less for a decade.
ITS data is very new to me too. I don't fully understand what I am looking at (yet) but the potential is huge. Currently working towards getting my entire collection sequenced. Good to see you Grimey!
-------------------- Research funded by the patrons of The Spore Works Exotic Spore Supply My Instagram Reinvesting 25% of Sales Towards Basic Research and Species Identification 
|
Workman
1999 Spore War Veteran



Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 24 minutes
|
Re: Psilocybe sierrae aka P. subfimetaria [Re: Workman] 1
#28619585 - 01/13/24 10:33 AM (14 days, 10 hours ago) |
|
|
Alan Rockefeller confirms that it is P. stuntzii. So I guess it is settled and not so novel after all.
-------------------- Research funded by the patrons of The Spore Works Exotic Spore Supply My Instagram Reinvesting 25% of Sales Towards Basic Research and Species Identification 
|
|