|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
RobMarley420
LSD Enthusiast
Registered: 05/01/05
Posts: 12,554
Loc: Mushroom Mountain
|
LSA = Wonderful Time!!!
#4391336 - 07/11/05 01:05 AM (18 years, 8 months ago) |
|
|
I had a wonderful time last Friday. I crushed up 10 HBWR seeds, picked out as much shell as possible trying not to waste any, and parachuted them at 6:30 right after I ate dinner. After I took the seeds me and my friend took a ride on our mountain bikes on some dirt trials down the street from my house. We went out to some train tracks that cross over a stream and make a bridge, it's probably 100 feet high, we go out there all the time to smoke, it's a phat chillin spot. So by the time we get out there I start to feel the first effects of the seeds, I felt realy good almost like I'm rollin. We smoked 2 bowl and chilled for a little bit throwing water proof firecrackers down into the stream. It was a little more than an hour after I took the seeds at this point and I was feeling good! It was like I was SUPER FRIED! We started to head back and all the yellow flowers off of the dirt path were standing out from the green grass like sore thumbs. The colors were intensified quite a bit, alot like shrooms. We went back to my place and just chilled for a bit. My friend left and I was alone about 2 hours into it. I went outside and sat on my front porch and looked at the sky it looked beautifl, it was just getting dark and the stars were starting to show. I started to get really tired and got a little headache at this point. I thought I was just burning out from the weed but it could've been the seeds, I dont know. I felt no nausea at all up until 3 hours after I ate them. This was probably because I ate like 6 brownies and 2 Hersheys candybars when we got back to my house, I had a killer case of the munchies. I went back into my house to pack up a bowl when I started to feel the nausea and then I started to feel like I was gonna barf and my headache got worse. I laid on my bed and just chilled. At this point everything annoyed me and seemed to make me feel like throwing up, the lights, the colors, the sound of the fan, the heat. I laid on the floor of my bathroom next to the toilet cause I felt like I was gonna heave. My bathroom floor was cold and that helped, I just closed my eyes and relaxed. I had some closed eye visuals, flowers blooming, mushrooms growing, and then I saw my sink with like 5 seperate faucets filling 5 cups with water. I thought this was telling my to drink water so I did. I slowly but surely drank 5 little dixie cups of water and laid back down. I felt perfect in 5 minutes, it's like my CEV's almost guided me to drink water. The whole nausea part was realy unpleasant but nothing I couldn't handle and it deffinetly wont keep me from doing them again, I had a great time. I was peaking now after I got over the nausea, everything in my house just looked different. Nothing huge or crazy but just different, in a way I can't explain. kinda like shrooms. I felt super good at this point. almost like rollin, almost like shrooms. It was about 4 hours into the trip and I went into my backyard and put a log into the fire pit. I smoked a bowl to my slef and watched the fire devour the log. When sitting around the fire I would put my head back and stare up into the stars and just think, sometimes closing my eyes. I would get totaly lost in my thoughts and closed eye visuals, it was very dreamy, almost like I was having dreams. I would look back down at the fire and I would just be like "whoa, I'm back to reality", I got so lost in my thoughts i kinda forgot where I was and what I was doing, it was really cool. I had mild hallucinations when I stared at the clouds, the would swirl around a little and move back and forth. Time got very distorted too, 15 minutes felt like 30 or 45. I sat outside arournd the fire for what felt like 4 hours but it was only 2. After this I went inside smoked a couple bowls and went to sleep. I felt absolutely wonderful the whole time, except for the sick part where I felt like shit but it was well worth it. When I was sitting around the fire after I had smoked a bowl it reminded me of my first lsd trip. I looked up at the trees against the dark blue/purple sky and it was like the sky was a canvas and the black tree silohetts were painted on the sky, I felt that same way while on acid! I'm deffinetly gonna have this experience again. I would deffinetly recomend LSA to anyone interested. It can be a great experience!!
--------------------
|
VirgilKane
Miner for truth and delusion
Registered: 05/17/05
Posts: 1,131
Loc: lowdown
|
Re: LSA = Wonderful Time!!! [Re: RobMarley420]
#4391453 - 07/11/05 03:14 AM (18 years, 8 months ago) |
|
|
Great report!
and that's a wicked collection in your sig!!
-------------------- Absense of evidence is not evidence of absense... "Religion is a defense against a religious experience" Carl G. Jung "So really, ordinary reality is a kind of chemical habit, sanctioned by culture, which says it's okay to use certain drugs, eat certain foods, and have certain sexual behaviors. However, when you transcend all this pre-conditioning by returning to the original wisdom of the animal body, then you discover this immense dimension of opportunity. For some people, it is a frightening risk. To me, that's the psychedelic experience." Terence McKenna
|
ajna
Hunter
Registered: 01/02/05
Posts: 410
Loc: Qld, AUS
Last seen: 14 years, 10 months
|
Re: LSA = Wonderful Time!!! [Re: VirgilKane]
#4391485 - 07/11/05 03:59 AM (18 years, 8 months ago) |
|
|
nice. i'll be planting some seeds in the spring, look forward to my first try.
|
stefan
work in progress
Registered: 04/11/01
Posts: 8,932
Loc: The Netherlands
Last seen: 3 years, 5 months
|
Re: LSA = Wonderful Time!!! [Re: RobMarley420]
#4391697 - 07/11/05 07:41 AM (18 years, 8 months ago) |
|
|
please make paragraphs next time you post. reading a solid block of text sucks. didn't read it because of it. glad you had a good trip though
|
hempknight
Stranger
Registered: 05/18/05
Posts: 267
Last seen: 17 years, 6 months
|
Re: LSA = Wonderful Time!!! [Re: stefan]
#4391848 - 07/11/05 09:20 AM (18 years, 8 months ago) |
|
|
Well your stubbornness hindered you from reading an excellent trip report. The part about the cups of water was awesome. Glad to see some people have a good time with LSA.
|
RobMarley420
LSD Enthusiast
Registered: 05/01/05
Posts: 12,554
Loc: Mushroom Mountain
|
Re: LSA = Wonderful Time!!! [Re: VirgilKane]
#4392609 - 07/11/05 01:44 PM (18 years, 8 months ago) |
|
|
Quote:
schapper said: Great report!
and that's a wicked collection in your sig!!
Thanks bro.
Quote:
stefan said:please make paragraphs next time you post. reading a solid block of text sucks. didn't read it because of it. glad you had a good trip though
What's the big deal??? Is there really any difference in reading one block of text compared to 2-3 blocks of text??? Still same amount of words, still same things being said, just some space added inbetween thoughts.
I put this post up because I've read alot of people saying that HBWR seeds are no good and they had really unpleasant experiences and didn't like it. THis is to show that if you go into your trip with the mindset that your going to like it and have a good time, you will have a good time. You will have a GREAT time! Anyone interested at all in LSA should go for it, you can have a wonderful experience!!!
--------------------
|
pH_
Voyager
Registered: 03/31/05
Posts: 466
Loc: New England
Last seen: 12 years, 2 months
|
Re: LSA = Wonderful Time!!! [Re: RobMarley420]
#4393165 - 07/11/05 04:30 PM (18 years, 8 months ago) |
|
|
very nice report. my trips are like that too, hopefully tonight will be no exception i never got nausea that came on that late, usually right when i start feeling the lsa i get the nausea, sometimes i never get it. i also get that feeling things are "different" havent had a change to experience shrooms, LSD, or E yet so i cant compare. its different from dxm, thats for sure. more pleasant, much more. i get that time dilation on the come up. the come up for me is usually the most intense, crazy part, but once the peak hits its usually bliss, clear headed, musically euphoric, and a bit visual
im glad you enjoyed it. LSA gets dogged too much. some like it, some hate it. if you hate it, just move along
|
PsYcHoDeLiCjOsH
Hippie
Registered: 06/29/05
Posts: 39
Loc: Atlanta, Georgia
Last seen: 17 years, 11 months
|
Re: LSA = Wonderful Time!!! [Re: pH_]
#4393338 - 07/11/05 05:54 PM (18 years, 8 months ago) |
|
|
hhhhmmmm... never had LSA before.... sounds like it would be something cool to trip to at the Phil Lesh show in colorado...
-------------------- HiPpIe
|
TerrapinSunrise
Stranger
Registered: 01/27/03
Posts: 350
Loc: KY
|
|
lsa makes me tired, nauseous, and intoxicated--not something i could be at a show on. in fact, the times i've eaten LSA the only thing i could do was sit or lie down and hope for death. (first bad trip ever was on LSA--stuff is NASTY).
stick to the mushroom and maybe the LSD.... INFINITELY better, in my experience.
|
LazyCrash
I like gas.
Registered: 07/02/05
Posts: 896
Loc: T-Town
Last seen: 9 years, 7 months
|
|
Break it up so people can keep their place while reading! It makes a huge difference.
If someone says my name and I look away, I gotta figure out where I was.
Plus all the white text cramped up like that just hurts eyeballs when reading something so long like that.
The space between gives people time to reflect on what you just said so they can understand better. It also makes referencing, quoting, and re-reading parts much easier.
--------------------
Edited by LazyCrash (07/12/05 04:30 PM)
|
Noviseer
Percussion isFree
Registered: 03/18/03
Posts: 3,994
Last seen: 9 years, 3 months
|
Re: LSA = Wonderful Time!!! [Re: RobMarley420]
#4396953 - 07/12/05 05:50 PM (18 years, 8 months ago) |
|
|
Quote:
dingleberrysalad said:
What's the big deal??? Is there really any difference in reading one block of text compared to 2-3 blocks of text???
Definitely. Paragraphs are so important. Sorry man I can't read that thing either, but I'm also glad you had a good time.
-------------------- _______________________________________________________________ namaste said: no flamz in da ODD, if you got nothing to contribute then keep yo lips zipped _________________________________________________________________
|
Locus
Registered: 03/11/04
Posts: 6,112
Last seen: 3 years, 1 day
|
Re: LSA = Wonderful Time!!! [Re: RobMarley420]
#4396977 - 07/12/05 05:56 PM (18 years, 8 months ago) |
|
|
yes actually breaking it up into paragraphs makes it much easier to read.
-------------------- The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein "Fear is the great barrier to human growth." ~ Dr. Robert Monroe ~~~*Dosis sola facit venenum*~~~ *Check my profile to listen to my music*
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: LSA = Wonderful Time!!! [Re: Locus]
#4399275 - 07/13/05 10:13 AM (18 years, 8 months ago) |
|
|
He suggested it in a kind way, often times people who don't use paragraphs get a bit more of an angry response. But, don't blame em, I'd be grumpy too if I had a headache The easier it is to read, the better.
Sounds like you had a great time though. The hbwr I got did absolutely nothing. Got em from a guy in the free seed thread right here too.. oh well.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Rex
boy with ballson chin.
Registered: 05/25/05
Posts: 46
Loc: Tasmania, AUS
Last seen: 10 years, 10 months
|
Re: LSA = Wonderful Time!!! [Re: Koala Koolio]
#4401860 - 07/13/05 11:00 PM (18 years, 8 months ago) |
|
|
got to love LSA
nice report, it seems to me that more and more people are starting to enjoy LSA now days
-------------------- The edge just has a better view
|
RobMarley420
LSD Enthusiast
Registered: 05/01/05
Posts: 12,554
Loc: Mushroom Mountain
|
Re: LSA = Wonderful Time!!! [Re: Koala Koolio]
#4402392 - 07/14/05 02:53 AM (18 years, 8 months ago) |
|
|
Quote:
elgr said: Sounds like you had a great time though. The hbwr I got did absolutely nothing. Got em from a guy in the free seed thread right here too.. oh well.
Was that guy's name popnganja420? The seeds I ate in this trip report I got through PopnGanja420. I didn't get them through that thread but he contacted me through a personal message after seeing one of my posts asking what the LSA trip is like. We got to talking and he sent me 20 seeds for free! What a hero! It's almost like crack, first time's for free! But he turned me onto the wonderful drug LSA, and I thank him. I'm going to be buying 50 more seeds.
--------------------
|
|