Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Mushroom-Hut Mono Tub Substrate   North Spore Injection Grain Bag   Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Extract   Unfolding Nature Unfolding Nature: Being in the Implicate Order   PhytoExtractum Buy Bali Kratom Powder   MagicBag.co Certified Organic All-In-One Grow Bags by Magic Bag   Bridgetown Botanicals Bridgetown Botanicals   Myyco.com Isolated Cubensis Liquid Culture For Sale

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinewrine420
I walk the line
Registered: 09/29/03
Posts: 15
Last seen: 15 years, 1 month
What do you think I should read before my next trip?
    #4220918 - 05/25/05 11:47 PM (18 years, 10 months ago)

Anyone have any suggestions for books to read before the trip? I'm really wanting to make this next experience more spiritual and whatnot, so I have been preparing alot. My last experience with shrooms was a little too immature. I didn't really know the power or feel the alignment, and I'm hoping to change that by being much more prepared mentally this time.

I'm reading Thus Spoke Zarathustra, I've gone back over the Tao Te Ching, and I've delved into the Sai Baba Gita. Does anyone have anything to suggest to get me in that philosophical mind? Thanks Will

Extras: Filter Print Post Top
OfflineRoseM
Devil's Advocate
Female User Gallery

Registered: 09/24/03
Posts: 22,518
Loc: Mod not God Flag
Last seen: 1 year, 7 months
Re: What do you think I should read before my next trip? [Re: wrine420]
    #4220946 - 05/26/05 12:06 AM (18 years, 10 months ago)

*******************************************************************

Mushroom Dosage Calculator

Toxicology of Mushrooms


The Psychedelic Experience by Timothy Leary
A MUST READ! This link is gold, Timothy Leary's Psychedelic Experience ONLINE!!! Tim Leary was the guru of LSD, and he wrote many books. The Psychedelic Experience is the handbook for many trippers around the world. The Psyc[gradient:#CC9900,#0033FF]hede[/gradient][gradient:#CCFF00,#0033FF]lic E[/gradient][gradient:#006633,#0033FF]xper[/gradient][gradient:#333399,#0033FF]ien[/gradient][gradient:#990099,#0033FF]ce[/gradient] contains a translation of The Tibetan Book of the Dead. :smile:

The [gradient:#FF0033,#0033FF]Psyc[/gradient][gradient:#CC9900,#0033FF]hede[/gradient][gradient:#CCFF00,#0033FF]lic E[/gradient][gradient:#006633,#0033FF]xper[/gradient][gradient:#333399,#0033FF]ien[/gradient][gradient:#990099,#0033FF]ce[/gradient] FAQ
If Leary's book is too long, this is a short, overview of Tim Leary's "Psychedelic Experience". It covers most important points.

More Leary Information

MP3's Guided Trips, music and speaches by Tim Leary, Albert Hoffman, Terrance McKenna... The Grateful Dead and many other tripper friendly MP3's
Learyfan (among others) have shared a lot of classic MP3's and Video with all of us. Follow this link, if you want something to listen to, especially during a trip. :smile:

[gradient:#336600,#666633]Recordings of Terrance McKenna[/gradient]
Many hours of McKenna speeches. Like Leary, Terrance McKenna was a well known psychedelic philosopher and shaman. Terrance McKenna is not as easy for newbie trippers to approach as Leary. In his books and lectures, he often takes on very difficult topics. Terrance definitely was a brilliant man. Thank God there are so many recordings of him... although his voice may take a little getting used to.


[gradient:#336600,#666633]More McKenna Information[/gradient]

Aldous Huxley's The Doors of Perception
* A poetic look into the mescaline trip as experienced by renowned intellectual Aldous Huxley. A wonderful introduction to psychedelic thought in general.   

Albert Hoffman's LSD: My Problem Child
LSD inventor Albert Hoffman describes his experiences during the formative stages of the psychedelic thought and experience in the 20th century.

Handbook of Therapeutic use of LSD 25
Although it was formulated around LSD psychotherapy it offers valuable insights to the aspiring psychonaut.  Well, there it is... start reading!

Spiritual & Ritual use of Psychoactives

Comments on the Psilocybin Mushroom
by Elfstone
A cool, but slightly incomplete article that in some ways picks up where McKenna left off. Very informative. It also contains a cool interactive project. I hope he updates this article some day.

D.M. Turner's Essential Psychedelic Guide
This practical guide is very informative and accurate. (D.M. Turner's Essential Psychedelic Guide) It's more concise and easier to navigate/understand than, say, the Vaults of Erowid or Shulgin's books. Of course it leaves out a lot of points that more lengthy resources might go after. (Thanks DadeMurphy for this link)

A Beginner's Approach to Psychedelic Mushrooms

How to Avoid a Bad Trip

Working with Difficult Psychedelic Experiences
by Maps.org
[gradient:#336633,#99CCFF]*******************************************************************[/gradient]


If you are new to tripping, please pick a few (any) of these above links and read 'em from start to finish. Read up before you ever trip... if you can. It is good to know a thing or two about tripping before you actually trip. The more you know, the more you might understand... and enjoy.

You can learn a lot from a mushroom.

[gradient:#336633,#99CCFF]*******************************************************************[/gradient]

Discussion threads and answers, are often subjective. Please take the information contained in the Tripper's FAQ with a grain of salt. Many answers are not FACT, just opinion. There is much to be learned about the science of tripping.
[gradient:#336633,#99CCFF]*******************************************************************[/gradient]

[gradient:#0099FF,#0033FF]Tripper's FAQ[/gradient]


1. Are magic mushrooms safe for me to eat?
2. Are contaminated/rotten/wild mushrooms safe for me to eat?
3. What is the history of magic mushrooms?
4. Why are mushrooms legal in some countries and illegal in others?
5. I am tripping for the first time, what do I need to know?
6. What size dose should I take? Is dosage the same for first time trippers and experienced trippers?
7. Why Trip?
8. How do I trip?
9. How long does a mushroom trip last?
10. How often can I trip on mushrooms?
11. What are some of the things to avoid while tripping?
12. What do the different trip levels (1-5) mean?
13. What are the best ways for me to injest mushrooms and what are the differences between the different methods of injestion?
14. What is a trip guide? Do I need one or am I one?
15. What is all this stuff about set and setting?
16. Why do people trip in nature?
17. Is tripping with others a good idea?
18. Should I trip alone?
19. Is tripping in public a good idea?
20. Should I trip with sober people?
21. What is some good tripping music?
22. Should I watch television or movies while tripping? What are some good shows to watch?
23. What are some good trip toys?
24. What is, and how can I avoid/reduce come up anxiety?
25. Why do some people throw up while coming up and, can it be avoided, controled?
26. How do I avoid a bad trip?
27. How do I stay positive during a trip?
28. What if I take too much?
*29. Can I redose, and if so, when? Needs more info
30. What is the link between spirituality and tripping?
31. Does tripping let you reach enlightenment? For how long? What is enlightenment?
32. What is ego loss?
33. What can meditation do for me while tripping?
*34. What are hallucinations really, and what do they look like? Needs more info
*35. Can you talk to mushrooms? Can they talk to you? Needs more info
36. What is and how do I control tripper's paranoia?
37. How can I stop a trip (ie: sober up)?
38. What is comedown anxiety and how can it be avoided/reduced?
*39. How to I reintegrate into sobriety? What is a mushroom hangover like? Needs more info
40. Why are trips so hard to talk about after they are over?
*41. Will tripping affect my dreams and daily life? Needs more info
42. How will a mushroom trip change me? What if I want to stay the same?
*43. What are flashbacks? Needs more info
*44. Why do only a select group of people like to trip? Needs more info
45. What things about mushrooms/tripping are most often misunderstood?
46. Is it true that psychedelics can trigger mental illness?
*47. Can I trip and never come back on mushrooms? Needs more info
48. How many mushrooms would I have to eat to die?
49. Do magic mushrooms harm my liver?
50. Has anyone ever died from eating magic mushrooms?
*51. How have trippers and tripping changed modern society? Needs more info
*52. Is it safe to combine mushrooms with other drugs? Which drugs? Needs more info
53. How can I use my trips to help in sober life?
[gradient:#336633,#99CCFF]*******************************************************************[/gradient]


--------------------
Fiddlesticks.


Extras: Filter Print Post Top
Offlinegnrm23
Carpal Tunnel
Registered: 08/29/99
Posts: 6,488
Loc: n. e. OH, USSA
Last seen: 5 months, 21 days
alan watts: the joyous cosmology [Re: Rose]
    #4221546 - 05/26/05 06:04 AM (18 years, 10 months ago)



--------------------
old enough to know better
not old enough to care

Extras: Filter Print Post Top
Offlinegnrm23
Carpal Tunnel
Registered: 08/29/99
Posts: 6,488
Loc: n. e. OH, USSA
Last seen: 5 months, 21 days
Re: alan watts: the joyous cosmology [Re: gnrm23]
    #4221549 - 05/26/05 06:06 AM (18 years, 10 months ago)

now if only the pictures within the book were available online...
some amazing b/w photos, lemme tell ya...


--------------------
old enough to know better
not old enough to care

Extras: Filter Print Post Top
Invisiblecrazytalken
SELECT
 User Gallery

Registered: 04/06/05
Posts: 122
Re: What do you think I should read before my next trip? [Re: wrine420]
    #4223418 - 05/26/05 04:36 PM (18 years, 10 months ago)

New Maps of Hyperspace -  Erowid-Mckenna-Maps of Hyperspace

I firsts heard this guy on NPR but if you wanna learn some trippy science check it out.  MKaku.org This guy has a great way of making topics like this understandable.

Also, just for fun check out this page. I came across it lastnight and decided i need to read it all before i trip. Look at #25    :shocked:Beyond 2012

These things usually get my mind on the right level before a trip. Your brain will disect every aspect of these theories and youll probably even realize your own.  :grin:


--------------------
**"Both the psychedelic dream state and the waking psychedelic state acquire great import because they reveal to life a task: to become familiar with this dimension that is causing being, in order to be familiar with it at the moment of passing from life." -Terence McKenna


Extras: Filter Print Post Top
Offlineemptywisdom
simple being oflight
 User Gallery

Registered: 03/29/05
Posts: 2,107
Loc: Lemuria
Last seen: 8 years, 6 months
Re: What do you think I should read before my next trip? [Re: crazytalken]
    #4226802 - 05/27/05 01:41 PM (18 years, 9 months ago)

The book on the taboo against knowing who you are by alan watts


--------------------

Extras: Filter Print Post Top
Invisibleorechron
LIVEWRONG
 User Gallery

Registered: 05/20/05
Posts: 299
Loc: Fallout Zone
Re: What do you think I should read before my next trip? [Re: emptywisdom]
    #4226927 - 05/27/05 02:12 PM (18 years, 9 months ago)

The Trial, Cat's Cradle, and a bunch of Zen Koans. A perfect primer for a more spiritually inquisitive trip. Many of the themes explored in the two books are parallel to Nietzsche's but, to your benefit, aren't so dry. In my experience the novels makes a more vivid imprint of the ideas explored in Thus Spoke than Thus Spoke was capable of. That's not to say you shouldn't continue your reading but I suggest you also find something more entertaining to supplement and support what you've read.


--------------------
Live by the foma that make you brave, and kind, and healthy, and happy.

Extras: Filter Print Post Top
Invisiblegema
Freedom from the Known

Registered: 10/24/04
Posts: 1,767
Loc: t(here)
Re: What do you think I should read before my next trip? [Re: wrine420]
    #4229677 - 05/28/05 10:42 AM (18 years, 9 months ago)

try any books by Jiddu Krishnamurti and have your answers questioned.

http://www.amazon.com/exec/obidos/search-handle-form/002-0395616-7552048

good luck on your search.

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: What do you think I should read before my next trip? [Re: gema]
    #4229888 - 05/28/05 12:08 PM (18 years, 9 months ago)

Reading A Seperate Reality definately had a profound effect on a trip of mine.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
Offlinewrine420
I walk the line
Registered: 09/29/03
Posts: 15
Last seen: 15 years, 1 month
Re: What do you think I should read before my next trip? [Re: Koala Koolio]
    #4230833 - 05/28/05 05:19 PM (18 years, 9 months ago)

You know, I've never read any of Kafka. I think I might just pick him up and give him a good read. Cat's Cradle? Isnt that by Vonnegut. And concerning McKenna, I've found about every piece of mp3 possible of his and listened to a good deal of them. Leary and Robert Anton Wilson are also on my playlist.

Extras: Filter Print Post Top
OfflineKalix
'Head

Registered: 03/20/05
Posts: 1,504
Last seen: 18 years, 3 months
Re: What do you think I should read before my next trip? [Re: wrine420]
    #4231013 - 05/28/05 06:30 PM (18 years, 9 months ago)

Recordings of Terrance McKenna
Many hours of McKenna speeches. Like Leary, Terrance McKenna was a well known psychedelic philosopher and shaman. Terrance McKenna is not as easy for newbie trippers to approach as Leary. In his books and lectures, he often takes on very difficult topics. Terrance definitely was a brilliant man. Thank God there are so many recordings of him... although his voice may take a little getting used to.

Definetely lotsa McKenna.. :thumbup:
http://mckenna.psychedelic-library.org/

Edited for URL

Edited by Kalix (05/28/05 06:31 PM)

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Mushroom-Hut Mono Tub Substrate   North Spore Injection Grain Bag   Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Extract   Unfolding Nature Unfolding Nature: Being in the Implicate Order   PhytoExtractum Buy Bali Kratom Powder   MagicBag.co Certified Organic All-In-One Grow Bags by Magic Bag   Bridgetown Botanicals Bridgetown Botanicals   Myyco.com Isolated Cubensis Liquid Culture For Sale


Similar ThreadsPosterViewsRepliesLast post
* Tripper's FAQ: Read this First!
( 1 2 3 4 all )
RoseM 32,276 66 02/27/10 02:56 PM
by forreverendgreen
* The Psychedelic Experience Forum (Tripper's FAQ, Psychedelic Library and Rules) READ BEFORE POSTING! RoseM 14,082 7 10/06/16 10:36 PM
by PrimalSoup
* trip reports reactions please justthiz 5,808 8 11/25/16 12:58 PM
by acidninja
* Help me rate my trip The_Greater_God 2,679 7 01/04/16 08:35 PM
by FruitOfLife
* Trip Report - The Coltrane Trip! - Level 4/5 urbanism 2,852 10 06/24/03 09:06 PM
by jonas
* Modern Rock/Alternative Trip Music Album????
( 1 2 all )
PooGrower 6,393 38 06/29/06 02:57 AM
by iMark
* good strain for visuals
( 1 2 3 all )
mad_scientist 14,707 43 06/10/02 09:29 AM
by mad_scientist
* What is a F@&#ING Sweeeeeeeetttttttt Trip?!?!?!?! Trip_Out_7 10,070 14 07/12/22 08:06 AM
by LogicaL Chaos

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
2,062 topic views. 2 members, 36 guests and 35 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.033 seconds spending 0.01 seconds on 14 queries.