Home | Community | Message Board


MRCA Tyroler Gluckspilze
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop: Peruvian Torch, San Pedro

Jump to first unread post. Pages: 1
Offlineday_tripper
Gatherer
 User Gallery

Registered: 11/01/03
Posts: 996
Loc: Pacific Coast
Last seen: 1 year, 8 months
slow mescaline i hope
    #4198235 - 05/20/05 04:11 AM (12 years, 2 months ago)

Took 30 grams dried peruvian torch 2 hours and 10 minutes ago, feeling a little off maybe, could be placebo... should i be worried my mesc was no good?

should be noted i did have a little food in my stomach when i took it.

how long does it take you guys to start feeling effects?


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinestefan
work in progress

Registered: 04/11/01
Posts: 8,932
Loc: The Netherlands
Last seen: 5 months, 21 days
Re: slow mescaline i hope [Re: day_tripper]
    #4198324 - 05/20/05 04:58 AM (12 years, 2 months ago)

you should feel more soon :thumbup:


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineday_tripper
Gatherer
 User Gallery

Registered: 11/01/03
Posts: 996
Loc: Pacific Coast
Last seen: 1 year, 8 months
Re: slow mescaline i hope [Re: stefan]
    #4198420 - 05/20/05 07:45 AM (12 years, 2 months ago)

no luck  :thumbdown:  i mixed it in a milkshake, that shouldn't have anything to do with it eh?


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: slow mescaline i hope [Re: day_tripper]
    #4198878 - 05/20/05 11:28 AM (12 years, 2 months ago)

No, but somewhere on erowid I read a suggestion against taking it in a milk product. Just to avoid stomach issues i believe. 30 grams is usually enough. But trich potency differs so much all the time. Sorry it wasn't good stuff.. maybe next time.

Congrats on downing it just mixed into a milkshake though. Blended with water alone cacti have the consistancy of a shake anyway. :smile:


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Amazon Shop: Peruvian Torch, San Pedro

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Similar ThreadsPosterViewsRepliesLast post
* Ending a mescaline trip (P. torch)
( 1 2 3 all )
BandStar 4,445 41 09/18/09 08:51 PM
by mattritt
* Mescaline V. Mushrooms in the woods
( 1 2 3 all )
Rocket75377 5,746 45 07/09/17 03:15 PM
by Bill_Oreilly
* amanitas and mescaline dreams frostbitten 1,308 3 09/14/06 09:09 PM
by frostbitten
* 1st Mescaline Trip Locus 811 12 10/28/07 07:48 PM
by Robo Shaman
* San pedro mescaline trip
( 1 2 all )
Cognitive_Shift 4,900 20 01/25/09 07:22 PM
by travelleler
* Mescaline help? feifen 1,773 14 01/26/09 11:37 PM
by ggpr
* How's the mind fuck on mescaline compared to shrooms?
( 1 2 3 all )
illerrre 10,341 48 09/17/09 05:58 AM
by starfirex
* just got some mescaline TheKid04 1,311 9 07/04/04 01:35 AM
by gdman

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Asante, Rose, sui, karode13
501 topic views. 5 members, 289 guests and 22 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
FreeSpores.com
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.024 seconds spending 0.008 seconds on 19 queries.