Home | Community | Message Board


World Seed Supply
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Jump to first unread post. Pages: 1 | 2 | Next >  [ show all ]
Offlineambit_euphoria
bmon

Registered: 11/30/04
Posts: 6
Loc: FL, US
Last seen: 11 years, 10 months
lsd=disability?
    #3471868 - 12/09/04 07:14 PM (12 years, 4 days ago)

Can LSD really fuck up your chromosomes enough to cause a physical or mental disability in your future kids?


--------------------
"When the power of love overcomes the love of power, the world will know peace"

Jimi Hendrix


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleHeavyToilet
The Heaviest OfThem All
Male

Registered: 08/06/03
Posts: 9,458
Loc: British Columbia
Re: lsd=disability? [Re: ambit_euphoria]
    #3471881 - 12/09/04 07:17 PM (12 years, 4 days ago)

It doesn't 'fuck up' your chromosomes at all.


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblethegatewaydrug
my burning sunwill some dayrise

Registered: 11/16/04
Posts: 6,987
Loc: wherever i may roam
Re: lsd=disability? [Re: HeavyToilet]
    #3471894 - 12/09/04 07:19 PM (12 years, 4 days ago)

i 2nd heavytoilet it wont fuck up your chromosomes, my friends dad did SO much acid and my friend turned out fine (sorta :grin:)


--------------------
May God have mercy upon my enemies, because i won't.

General George S. Patton
:paranoid:


Edited by thegatewaydrug (12/09/04 07:22 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleDark_Star
dick butterfly
I'm a teapot User Gallery

Registered: 08/21/04
Posts: 27,983
Loc: Under the Grecian fog
Re: lsd=disability? [Re: thegatewaydrug]
    #3473372 - 12/09/04 11:36 PM (12 years, 3 days ago)

I 3rd it, that's pure anti-drug bullshit.


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinejoe666
The ReverendToke DBK
 User Gallery

Registered: 09/13/01
Posts: 19,986
Loc: Southern by grace of God
Last seen: 7 days, 10 hours
Re: lsd=disability? [Re: ambit_euphoria]
    #3473649 - 12/10/04 12:27 AM (12 years, 3 days ago)



--------------------
"A politician is like a baby's diaper, it should be changed often and for the same reason"-Coy Turner Sr.

"what is a weed, a plant whose virtues have not yet been discovered"--Ralph Waldo Emerson

"I'm sippin Hennessy, riding on my muthafucking enemies" -Meek Mill.



Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: lsd=disability? [Re: joe666]
    #3473685 - 12/10/04 12:35 AM (12 years, 3 days ago)

ohh sweet propaganda, how i love you.

But you know, if you do it 7 times you're legally insane. And don't try to lie to the doctor and tell him you did it 6 times. Unless you're a good liar. But even then they'll follow you around and wait till you hit that 7th time and off to the mental hospital you go.

oh yeah, and I hate propaganda.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineCenebite
Closet CaseShroomer
 User Gallery

Registered: 10/27/04
Posts: 348
Last seen: 4 months, 8 days
Re: lsd=disability? [Re: Koala Koolio]
    #3473740 - 12/10/04 12:46 AM (12 years, 3 days ago)

my god i've actually heard people say that and believe it! how freakin dumb are you..


Post Extras: Print Post  Remind Me! Notify Moderator
OfflinePeyoteZen
Save The Republic
Male User Gallery

Registered: 05/05/03
Posts: 16,779
Loc: America Again!
Last seen: 19 hours, 13 minutes
Re: lsd=disability? [Re: Cenebite]
    #3474586 - 12/10/04 03:49 AM (12 years, 3 days ago)

HA! Thats funny
A friend of mine has done acid several dozen times, and i have never once done acid.
And its funny cuz he is sooo much better off than me.
I am a complete dumbass compared to him.
Could be the LSD, could not be.  Who knows...
But one things for sure, it certainly didn't make him any dumber than normal.
Especially not insane  :crazy2:

:tongue2:


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
OfflinePhluck
Carpal Tunnel
 User Gallery

Registered: 04/11/99
Posts: 11,393
Loc: Canada
Last seen: 10 months, 13 days
Re: lsd=disability? [Re: ambit_euphoria]
    #3474675 - 12/10/04 04:23 AM (12 years, 3 days ago)

LSD and mushrooms have the exact same risks.

Actually, mushrooms seem to cause a little more confusion in me, (I've spoken to some who agree, and some who don't), and mushrooms also tend to cause a little more stomach discomfort for me (again, spoken to some who agree, and some who don't).


--------------------
"I have no valid complaint against hustlers. No rational bitch. But the act of selling is repulsive to me. I harbor a secret urge to whack a salesman in the face, crack his teeth and put red bumps around his eyes." -Hunter S Thompson
http://phluck.is-after.us


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleGlassOnion
Stranger
Registered: 06/23/04
Posts: 282
Loc: Antartica
Re: lsd=disability? [Re: Phluck]
    #3478553 - 12/10/04 09:58 PM (12 years, 2 days ago)

As far as giving your future children disabilities I def don't think that will happen.

But i've heard that trace amounts of lsd remain on your spinal cord for your entire life.

Never tried it myself and i never intend to.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinelilbil
republican hippy(only one)

Registered: 10/09/04
Posts: 114
Loc: Montana, usa
Last seen: 11 years, 11 months
Re: lsd=disability? [Re: GlassOnion]
    #3478607 - 12/10/04 10:08 PM (12 years, 2 days ago)

ahhhh...releaf, with that bs out of the way, im going to go drop lsd, woot woot.
TY SHROOMERY


--------------------
----------------------------------------------

if ignorance is bliss, then sadly my mom and dad are very happy......


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleRavus
Not an EggshellWalker
 User Gallery

Registered: 07/18/03
Posts: 7,991
Loc: Cave of the Patriarchs
Re: lsd=disability? [Re: GlassOnion]
    #3479073 - 12/10/04 11:49 PM (12 years, 2 days ago)

Hahahahaha

Someone was telling me that yesterday. LSD gets you "fucked up" because it goes in your spine and tells your brain what to do

Reminded me of an S&M sex act

It's all bullshit, LSD is water soluble, passes through your body, stays in your body as much time as most water soluble drugs, goes into your brain and mimics serotonin, and doesn't kill chromosomes any more than a cup of coffee

Jesus man, where do people get this shit from? It sounds like someone started it as a joke when tripping on acid and people took it seriously or something


--------------------
So long as you are praised think only that you are not yet on your own path but on that of another.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: lsd=disability? [Re: ambit_euphoria]
    #3480025 - 12/11/04 02:39 AM (12 years, 2 days ago)

goes into your brain and mimics serotonin.

That should be your first clue. The very reason lsd gets through the blood brain barrier is it's similarity to serotonin. And yes, this similarity is what causes interactions with your serotonin receptors causing you to trip.

Now, does serotonin lodge itself in your spine? No. It is metabolized. Lsd, like other tryptamines including serotonin goes through the same thing. MAOs will metabolize it.

Now, the next obvious thing is how unstable the lsd molecule is. Have you ever heard about how *easily* it breaks down due to heat and light? The reactions to make it need special care just to not lose product. Leaving it in a hot car for a long time will degrade it. Half a life time in your body? You wish you could preserve it that well.

Finally, even if it were lodged in your body, (even if it was the inactive iso-LSD in you) do you know how small an lsd dose is? We're talking about a matter of a couple hundred micrograms. The amount that actually makes it into your brain, through the bbb is significantly less than the dose you actually take from what I've read. The amount of lsd that actually affects you is astoundingly small. Before your trip is over, little of it will remain. In a couple days you can be sure it will be gone from your system completely.

"Never tried it myself and i never intend to." Is this based on the spine lie you were told, or other reasons? I'm not one to convince someone that a drug is right when the don't believe so.. but I am one to inform people about myths and lies the best I can. Are you a fan of mushrooms? What in your mind makes psilocin acceptable but not lsd, if you don't mind me asking?


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinerunnerup
student

Registered: 03/23/04
Posts: 708
Loc: USA
Last seen: 6 years, 21 days
Re: lsd=disability? [Re: joe666]
    #3480245 - 12/11/04 03:33 AM (12 years, 2 days ago)

Quote:

joe666 said:
http://www.erowid.org/chemicals/lsd/lsd_writings3.shtml





Andrew Weil likes to argue lol


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinecherokee
tennis shoes
Male User Gallery

Registered: 10/25/02
Posts: 41,391
Loc: Nationwide Flag
Last seen: 6 months, 6 hours
Re: lsd=disability? [Re: Koala Koolio]
    #3481634 - 12/11/04 02:33 PM (12 years, 2 days ago)

LSD



Serotonin



Actually LSD and serotonin aren't too similar, structurally speaking anyways. LSD affects more than you're serotonin system.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: lsd=disability? [Re: cherokee]
    #3481704 - 12/11/04 02:54 PM (12 years, 2 days ago)



Yeah, ergot alkaloids tend to have the tetracyclic ring structure.. but theres still a resemblence to serotonin. And it of course does affect the serotonin system, but what else does it affect? Can't seem to find much info on that...


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinetwilight715
Just anotherFreak in theFreak Kingdom

Registered: 12/03/04
Posts: 106
Last seen: 11 years, 5 months
Re: lsd=disability? [Re: Koala Koolio]
    #3482168 - 12/11/04 05:11 PM (12 years, 2 days ago)

that excerpt from the weil book is quite interesting, i'd never read that before. thanks for the link.


--------------------
"He was too weird to live, and too rare to die."
- Hunter S. Thompson

"Mushrooms have no known adverse side-effects, other than leaving you feeling fatigued and probably surrounded by a load of mad paintings and some half-eaten chocolate bars."


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinebaraka
Male User Gallery

Folding@home Statistics
Registered: 07/16/00
Posts: 10,701
Loc: ohio
Last seen: 1 day, 56 minutes
Re: lsd=disability? [Re: Phluck]
    #3482298 - 12/11/04 05:41 PM (12 years, 2 days ago)

Quote:

Phluck said:
LSD and mushrooms have the exact same risks.

Actually, mushrooms seem to cause a little more confusion in me, (I've spoken to some who agree, and some who don't), and mushrooms also tend to cause a little more stomach discomfort for me (again, spoken to some who agree, and some who don't).




I completely agree with you on this. On higher doses of mushrooms i tend to get really confused. I get so lost in the moment i start forgetting where i am and whats goin on. LSD i can seam to take it higher to another level but still of a grasp of the situation.

I think LSD is more friendly and social of a trip then mushrooms are.

Mushroom seam to me a lot more dreamy then lsd is.


LSD is pretty safe physically. Taking lsd in the wrong setting or mindset can leave you with a really profound bad expierence that can mess with you for a while. Or sometimes a trip can go bad and some people should not take psychadelic drugs.

Just hanging out with someone for a bit i can normally tell if they would be able to handle a trip and i think i can tell pretty good of people that have tripped.


--------------------
This is the only time I really feel alive.


Edited by baraka (12/11/04 05:44 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAaronEvil
The GuitarVillain
Male

Registered: 09/27/04
Posts: 1,706
Loc: California
Last seen: 5 years, 7 months
Re: lsd=disability? [Re: ambit_euphoria]
    #3485301 - 12/12/04 07:42 AM (12 years, 1 day ago)

Well, LSD cant fuck you up but the dealers can. There was this kid at my highschool who thought he was getting acid but it turned out to be some other shit like laundry detergent or some shit like that which was just soaked on a small strip of papper. When he held it on his tongue it took it straight to his brain and he is fucked up now. Sad story. If you buy illegal stuff make sure you trust who you are buying from.


--------------------


There is not a lot of difference between a fox hole and a grave; but knowing that you dug your ditch and climbed in anyway.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAnnomM
※※※※※※
 User Gallery

Folding@home Statistics
Registered: 12/22/02
Posts: 6,364
Loc: Europe
Last seen: 24 days, 10 hours
Re: lsd=disability? [Re: AaronEvil]
    #3485317 - 12/12/04 08:04 AM (12 years, 1 day ago)

Are you sure that happened? A paper soaked in laundry detergent or some shit, straight to his brain and he is fucked up now?

Sounds like a bullshit story. A few hundert mcg laundry detergent does not go straight to your brain and fuck you up for the rest of your life.

Was it Laundry Super Detergent?


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1 | 2 | Next >  [ show all ]

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Similar ThreadsPosterViewsRepliesLast post
* Some kid thought LSD genetically mutates the DNA of your children...
( 1 2 3 all )
Fluxburn 8,346 53 05/04/15 03:03 AM
by Buck513
* LSD-dangerous or not? -must read
( 1 2 3 all )
PSylopHiLe 8,435 47 08/12/06 08:24 AM
by redgreenvines
* DEA Bulletin: DOC is currently more common than LSD
( 1 2 3 4 all )
Nunbuh_Chrubble 10,902 72 01/15/09 09:00 PM
by Desos
* Blotters: Discriminating Between LSD and RCs
( 1 2 all )
Desos 17,609 29 10/10/12 07:11 PM
by SurReality
* Other than LSD what would one find on blotter
( 1 2 3 all )
KillerPicklez
5,454 41 06/20/08 01:31 AM
by JackthaTripper
* What would happen if a schizo took lsd? skatealex2 1,685 19 01/29/09 11:53 PM
by deCypher
* A contemporary scientific overview of LSD action [with .pdf version attached for convenience] AsanteA 6,049 11 03/10/15 09:35 AM
by Chief Kief
* how do I reassure friends that mush, lsd won't make me crazy
( 1 2 all )
Noviseer 3,213 21 08/02/03 07:40 PM
by Noviseer

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Asante, Rose, sui, karode13, LSDreamer
3,733 topic views. 10 members, 350 guests and 18 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
World Seed Supply
Please support our sponsors.

Copyright 1997-2016 Mind Media. Some rights reserved.

Generated in 0.062 seconds spending 0.004 seconds on 16 queries.