Home | Community | Message Board

Original Seeds Store
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Original Sensible Seeds Autoflowering Cannabis Seeds   Mushroom-Hut Substrate Mix   North Spore Bulk Substrate   PhytoExtractum Kratom Powder for Sale

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinelafeeverte
absintheur
Registered: 10/05/04
Posts: 66
Loc: doin the best I can
Last seen: 11 years, 4 months
tissue clone of Psilocybe atlantis
    #3465407 - 12/08/04 03:31 PM (19 years, 1 month ago)

I cloned a tissue sample of p.atlantis in the early summer, of course there were contaminants, not having a glove box[old tech], or a laminar flow hood, therefore I promptly refrigerated at 35F. I now have a hood and plated out three plates with antibiotic MEA. Mycelium sprang to life in one day, with no contaminants at the moment. Does anyone know the growth parameters of this psilocybe? I was going to use rye grass seed as spawn, and case to fruit. Any hints on sclerotia formation on rye grass seed? I was thinking of using the growth parameters for p. mexicana, as this is also a grass loving species that fruits at the temps that p. atlantis fruits, any, and all advice would be greatly appreciated.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: tissue clone of Psilocybe atlantis [Re: lafeeverte]
    #3465469 - 12/08/04 03:44 PM (19 years, 1 month ago)

Awesome man.. congrats, really!

From what I've read you want to use mexicana technique. I'm sure there are variations as to its favorite temperature and all, given the fact that they're found a long ways from mexico (rather closer to tampanensis though)

Mj's site has some info about them, none on cultivation. The shroomery sclerotia tek says it works with atlantis, probably hasn't been tested though. So that or Una's tek is the way I would go.

Good luck man. Hope you get some prints :wink: I'm sure a lot of people would like to see this be as popular as mexi and tamp if possible. Not sure why it isn't. Maybe theres some flaw we don't know about that makes it tougher?


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinelafeeverte
absintheur
Registered: 10/05/04
Posts: 66
Loc: doin the best I can
Last seen: 11 years, 4 months
Re: tissue clone of Psilocybe atlantis [Re: Koala Koolio]
    #3465619 - 12/08/04 04:11 PM (19 years, 1 month ago)

Thanks, I just wanted a little input. Thanks for the advice, tissue culture is sure some tedious work. I've been thinking all along to try to use the parameters outlined by Stamets for p. mexicana or p. tampanensis to fruit, or at least generate sclerotia, these two species, basically using the same substrate that p. atlantis does. So I think I'll mess around with these abit, seeing as I can always generate slants, and refrigerate if need be. Once again thanks.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: tissue clone of Psilocybe atlantis [Re: lafeeverte]
    #3465712 - 12/08/04 04:25 PM (19 years, 1 month ago)

Once its definately contam free, do some karo.. this may require a good amount of experimenting.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinelafeeverte
absintheur
Registered: 10/05/04
Posts: 66
Loc: doin the best I can
Last seen: 11 years, 4 months
Re: tissue clone of Psilocybe atlantis [Re: Koala Koolio]
    #3465764 - 12/08/04 04:32 PM (19 years, 1 month ago)

Don't know nothing about karo, different tech, I know all kinds of techs are always evolving, but is this tech better than any others? Curious.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: tissue clone of Psilocybe atlantis [Re: lafeeverte]
    #3468160 - 12/08/04 11:15 PM (19 years, 1 month ago)

Well, once you get it contam free for sure, karo is a way to greatly increase your amount of culture. Its a liquid culture, so you'd fill a half pint or simillar with 100 ml of water, a teaspoon of karo syrup, and pc for 15 minutes.

This will give you 100 ml of culture water that will take off very quickly on grain. Colonized a pint in 6 days..


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Original Sensible Seeds Autoflowering Cannabis Seeds   Mushroom-Hut Substrate Mix   North Spore Bulk Substrate   PhytoExtractum Kratom Powder for Sale


Similar ThreadsPosterViewsRepliesLast post
* Selection of "Psilocybe atlantis"
( 1 2 all )
WorkmanV 8,831 33 08/23/05 08:21 AM
by blackout
* Sterile Tissue Cloning Procedure BigBlackNinja 2,095 9 03/20/03 09:54 AM
by Anonymous
* Psilocybe atlantis in vitro sclerotia pics Una 2,497 5 04/08/02 10:27 AM
by Una
* Dry tissue cloning/spore extraction ??? Bi0TeK 2,461 2 06/25/03 10:45 AM
by Bi0TeK
* tissue cloning & DNA degeneration with cubes? Quincunx 1,799 5 01/28/04 09:34 AM
by Suntzu
* Psilocybe antioquensis fruiting attempt WorkmanV 11,198 12 11/14/05 10:53 PM
by mskip23
* wild P. mexicana - strange growth on agar?
( 1 2 all )
Olgualion 9,790 33 03/23/03 01:39 PM
by Olgualion
* Cardboard cloning tek?
( 1 2 all )
ink 26,019 31 02/14/16 10:43 PM
by Eywa_devotee

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, Pastywhyte, bodhisatta
1,832 topic views. 2 members, 12 guests and 3 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.02 seconds spending 0.004 seconds on 12 queries.