|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Gumby
Fishnologist
Registered: 06/13/01
Posts: 26,656
|
Wewt wewt, new mods!
#3466915 - 12/08/04 07:30 PM (19 years, 3 months ago) |
|
|
Folks, we've got two new mods and we've dropped three. Not going into details on why the three were dropped.
Lizard King is finally a mod again! Wewt! This guy was a mod on the hunting forums when I first joined. He was kind enough to take me under his wings and teach me a good majority of what I know now. Glad to have ya back LK!
Shroomydan is the other new mod. His name will be green as soon as the admins get to it. As any hunting forum regular knows, this guy REALLY knows his shit. He's nice to the n00bs too In addition, he's from the Ohio area, so he can help some of you out in the North East, because he better knows what's going on out there. Glad to have you as part of the team
|
BitterPill
Registered: 10/01/04
Posts: 551
Loc: PNW
|
Re: Wewt wewt, new mods! [Re: Gumby]
#3466933 - 12/08/04 07:33 PM (19 years, 3 months ago) |
|
|
Nice, shroomydan deserves to be a mod. He's always helping out. Who got dropped?
-BP
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: Wewt wewt, new mods! [Re: BitterPill]
#3466952 - 12/08/04 07:34 PM (19 years, 3 months ago) |
|
|
Quote:
BitterPill said: Nice, shroomydan deserves to be a mod. He's always helping out. Who got dropped?
-BP
... Mjshroomer? why?
I'm not a regular poster here, due to my location, but I'm a regular reader definately. So, congrats.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Psilygirl
cyan goddess
Registered: 08/28/03
Posts: 4,418
Loc: PNW
Last seen: 7 years, 4 months
|
Re: Wewt wewt, new mods! [Re: Gumby]
#3466964 - 12/08/04 07:37 PM (19 years, 3 months ago) |
|
|
congrats, shroomeydan and LK!!
I think this team will do a better job for sure!
-------------------- "Love says 'I am everything.' Wisdom says 'I am nothing.' Between the two, my life flows." Puget Sound Mycological Society
|
eris
underground
Registered: 11/17/98
Posts: 48,024
Loc: North East, USA
Last seen: 6 months, 16 days
|
Re: Wewt wewt, new mods! [Re: Gumby]
#3467469 - 12/08/04 09:13 PM (19 years, 3 months ago) |
|
|
Quote:
In addition, he's from the Ohio area, so he can help some of you out in the North East
That is a good idea, I noticed a lot of them. Shroomydan is a good poster, I like the fact that he has a broad interest in mushrooms (not just limited to actives).
-------------------- Immortal / Temporarily Retired The OG Thread Killer My mushroom hunting gallery
Edited by eris (12/08/04 09:14 PM)
|
Gumby
Fishnologist
Registered: 06/13/01
Posts: 26,656
|
Re: Wewt wewt, new mods! [Re: eris]
#3467484 - 12/08/04 09:16 PM (19 years, 3 months ago) |
|
|
As does Lizard King. LK showed me the first morels I've ever seen Definitely a benefit having mods who are into the entire subject of mycology and not just the actives.
|
shroomydan
exshroomerite
Registered: 07/04/04
Posts: 4,126
Loc: In the woods
|
Re: Wewt wewt, new mods! [Re: Gumby]
#3467529 - 12/08/04 09:24 PM (19 years, 3 months ago) |
|
|
You all say such kind words. Thank you.
I look forward to serving.
|
ToxicMan
Bite me, it's fun!
Registered: 06/28/02
Posts: 6,725
Loc: Aurora, Colorado
Last seen: 3 hours, 10 minutes
|
Re: Wewt wewt, new mods! [Re: shroomydan]
#3467614 - 12/08/04 09:38 PM (19 years, 3 months ago) |
|
|
Congrats, newly green shaded guys.
Happy mushrooming!
-------------------- Happy mushrooming!
|
Supernova
Stranger
Registered: 08/13/03
Posts: 3,151
|
Re: Wewt wewt, new mods! [Re: ToxicMan]
#3467659 - 12/08/04 09:49 PM (19 years, 3 months ago) |
|
|
Let me just say thanks to all of the mods for the work in keeping this forum running so smoothly and keeping the posts what they should be.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: Wewt wewt, new mods! [Re: Supernova]
#3467824 - 12/08/04 10:20 PM (19 years, 3 months ago) |
|
|
Why isn't mj a mod anymore?
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Gumby
Fishnologist
Registered: 06/13/01
Posts: 26,656
|
|
Quote:
Not going into details on why the three were dropped.
Can't say. Against policy.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: Wewt wewt, new mods! [Re: Gumby]
#3468127 - 12/08/04 11:10 PM (19 years, 3 months ago) |
|
|
Sorry.. I missed that. Read every post under BitterPill's carefully to make sure it wasn't said already. You'd think I'd figure to reread the first.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Super_Blunt
Candyman
Registered: 10/25/04
Posts: 3,140
|
|
--------------------
|
superblingtheory
ghettogepetto
Registered: 11/02/03
Posts: 921
Loc: Omnipresent
Last seen: 11 years, 3 months
|
Re: Wewt wewt, new mods! [Re: Super_Blunt]
#3469511 - 12/09/04 08:32 AM (19 years, 3 months ago) |
|
|
YAAAAAAAAAAAAAAAAAYYYYYY!
-------------------- Guts and danger, Airborne Ranger...
|
superblingtheory
ghettogepetto
Registered: 11/02/03
Posts: 921
Loc: Omnipresent
Last seen: 11 years, 3 months
|
|
Let's have a party for them- I'll start by rolling this joint.....
-------------------- Guts and danger, Airborne Ranger...
|
Lizard King
King Lizard
Registered: 10/03/99
Posts: 1,998
Loc: GA
Last seen: 17 years, 6 months
|
|
And I'll start by spaking it Hello all, let me first say its great to be back and that I will do the best job I can helping folks and keeping this forum running smoothly. I wish I had never left but life has other priorities. Between my buisness and all the moving I've done in the past two years it was near impossible for me to frequent this site enough to do my part as a mod so I stepped down. Now I have my life in order, things are going great for me and I have regular internet access for the first time in two years. Its great to be back home, and thanks for the kind words from everyone.
Now then, off to the Ps. cubensis fields, all this rain we are getting here in the southland accompanied with warm temps are bringing up some late season fruits that need pickin'. Be back later with a report and pics hopefully
LK,
--------------------
|
GGreatOne234
Stranger
Registered: 12/23/99
Posts: 8,946
|
Re: Wewt wewt, new mods! [Re: Lizard King]
#3472102 - 12/09/04 06:05 PM (19 years, 3 months ago) |
|
|
congrats to all the new mods
|
doo
addict -crazy as a shithouse rat
Registered: 10/17/00
Posts: 604
Loc: Slingshit, China
Last seen: 1 year, 9 months
|
|
LK, a moderator again.........ya'll must be scraping the bottom of the barrel...... hehehehe......just joking of course..... the man damn sure knows his 'shrooms. He could find mushies on the moon Haven't been hunting myself in awhile but I figured I'd stop by the ol' Shroomery and see what folks have been finding lately. Those blue gymno pics shroomydan posted a few pages back are awesome. Makes me want to get back into the woods again, and see what I can find.
doo
-------------------- - Arguing with a woman, is like trying to blow out a light bulb-
|
Lizard King
King Lizard
Registered: 10/03/99
Posts: 1,998
Loc: GA
Last seen: 17 years, 6 months
|
Re: Wewt wewt, new mods! [Re: doo]
#3473039 - 12/09/04 08:34 PM (19 years, 3 months ago) |
|
|
Holy shiot, doo!!! What a suprise, thought I'd never hear from the ole shit house rat again. Good to see ya still posting.
How ya been lately?? My dredging buisness has been going great and I have moved out to the "country" on a big farm house with horses. Been doing alot of fishing lately, caught more bass this past year than I can ever remember. Bought a few new canoes and have been a religous river rat this past summer I hope you've been doing well, don't be a stranger and drop by more often.
Some pictures...
LK,
--------------------
|
KyKid
Stranger
Registered: 10/22/04
Posts: 605
|
Re: Wewt wewt, new mods! [Re: Lizard King]
#3475528 - 12/10/04 10:39 AM (19 years, 3 months ago) |
|
|
congrats new mods, not a hunter because of my location but i read this forum just as much as the others and i know things will go smooth with the new mods. also shroomydan how good is the picking in Ohio, its only a short drive from me, I'm more then willing to make a trip of it if the picking is worth it, but even if i don't get shit the experience would be worth it since Ive never hunted for wild species before and it has been something Ive wanted to do for so long now. well the season is almost over I'm guessing but there's next year coming on so quick
|
shroomydan
exshroomerite
Registered: 07/04/04
Posts: 4,126
Loc: In the woods
|
Re: Wewt wewt, new mods! [Re: KyKid]
#3477112 - 12/10/04 03:42 PM (19 years, 3 months ago) |
|
|
The active Gyms I find are few and far between from June till September. You have to find a forest which stays damp from lots of shade usually within sight of water, It also needs to be a forest which has been there long enough to have rotten fallen logs. I've also found them in WV and Pa. I think the mushroom hunting is especially good here because we have such a diverse ecosystem. We also have been receiving above average rainfall for the last three or four years, which the mushrooms just love. I think it rained everyday in June and almost every day in July two years ago. I wounder sometimes if this is a semi-permanent change in weather patterns which is changing this area into a temperate rain forest. If that's the case then maybe some of the active wood-loving Psilocybes from the west coast could make this their home, or perhaps the extra rain will allow Psilocybe caerulipes to expand its habitat and become common. But I digress... Yeah, Ohio is a great place to hunt for edibles. Actives are here, but finding them can be like finding a needle in a haystack. The good news is that once you find them you can check that spot routinely. The active Gym logs from which I harvest produce 2 to 4 flushes per year and produce year after year until the log is completely decomposed, or until it is overrun by another mushroom. I Hope this helps you decide about making the drive.
Edited by shroomydan (12/10/04 03:46 PM)
|
Rebirtha
I really like bread
Registered: 09/22/03
Posts: 5,680
Loc: over there
Last seen: 1 month, 11 days
|
Re: Wewt wewt, new mods! [Re: shroomydan]
#3477567 - 12/10/04 04:56 PM (19 years, 3 months ago) |
|
|
i knew you'de be green sooner or later shroomydan! and as for you Lizard King, I'm glad you are back too
|
spores
haploid
Registered: 02/18/99
Posts: 2,486
Loc: Washington
|
Re: Wewt wewt, new mods! [Re: Gumby]
#3481177 - 12/11/04 10:18 AM (19 years, 3 months ago) |
|
|
welcome back LK and welcome shroomydan! I see you have your first fan already dan (TorpidCrucifix) , who's idiotic post concerning you I just sent to the dump, you might want to read it for a chuckle . keep it up. I know you both will do a great job, don't let anyone discourage you from keeping things in line, you did the right thing. DH
|
Snobrdr311
outdoorenthusiast
Registered: 09/03/01
Posts: 1,468
Loc: Midwest
Last seen: 10 years, 5 months
|
Re: Wewt wewt, new mods! [Re: Lizard King]
#3482767 - 12/11/04 05:41 PM (19 years, 3 months ago) |
|
|
Quote:
Lizard King said: Holy shiot, doo!!! What a suprise, thought I'd never hear from the ole shit house rat again. Good to see ya still posting.
How ya been lately?? My dredging buisness has been going great and I have moved out to the "country" on a big farm house with horses. Been doing alot of fishing lately, caught more bass this past year than I can ever remember. Bought a few new canoes and have been a religous river rat this past summer I hope you've been doing well, don't be a stranger and drop by more often.
Some pictures...
LK,
Nice fish LK, I do a lot of bassin myself in Wisconsin. Mainly smallmouth bass as they are more agressive and fight a lot harder.
Do you do any Turkey hunting down there in Jawga? Ya'll have a lot of birds from what I hear. Spring Turkey hunting rules if you haven't taken it up yet. I think I remember you saying you Deer hunt.
Anyway, cool pictures.
|
The_Red_Crayon
Exposer of Truth
Registered: 08/13/03
Posts: 13,673
Loc: Smokey Mtns. TN
Last seen: 6 years, 10 months
|
Re: Wewt wewt, new mods! [Re: Gumby]
#3483051 - 12/11/04 06:38 PM (19 years, 3 months ago) |
|
|
awesome Shroomy Dan is a mushroom god!
|
shroomydan
exshroomerite
Registered: 07/04/04
Posts: 4,126
Loc: In the woods
|
|
That's idiot, Crayola, mushroom idiot. Thanks for the compliment. That was funny DH; you'd think I pissed in his Wheaties or something.
Edited by shroomydan (12/11/04 10:44 PM)
|
Mitchnast
Toadmonger
Registered: 10/27/99
Posts: 8,656
Loc: Okanagan
Last seen: 5 days, 8 hours
|
Re: Wewt wewt, new mods! [Re: shroomydan]
#3484978 - 12/12/04 01:33 AM (19 years, 3 months ago) |
|
|
ive been a mod for gormet and mush cult. funny really. i mean i do know, pick, and cook cullinary mushrooms, and make medicines from fungi. and i do dabble in cultivation. but secretly, i wanted to be a mod in this forum. maybe while im on paternity leave starting in april i could fill such a service if anyone would think me fit.
|
Lizard King
King Lizard
Registered: 10/03/99
Posts: 1,998
Loc: GA
Last seen: 17 years, 6 months
|
Re: Wewt wewt, new mods! [Re: Snobrdr311]
#3485447 - 12/12/04 08:05 AM (19 years, 3 months ago) |
|
|
Snobrdr311, yeah I turkey hunt, where I live the turkeys are thick as hell, I always see them in the cow pastures when I'm cube hunting. I live on 50 acres where its legal to discharge firearms, I pan on doing quite a bit of spring turkey hunting. I know your passion for the smallmouth, nothing beats a day of catching the great bronzebacks. Here in GA we have shoal bass, they were just named a seperate species a few years ago, and they look and fight much like smallies. I do drive up to Tennessee every once in a while to do some smallie fishing, GA is completey void of smallmouth with the exception of two lakes in the mountains that were stocked.
Anyways, enough off topicness here. Sorry for rambling on, I'll post a weilii report with pics to make up for it
LK,
--------------------
|
doo
addict -crazy as a shithouse rat
Registered: 10/17/00
Posts: 604
Loc: Slingshit, China
Last seen: 1 year, 9 months
|
Re: Wewt wewt, new mods! [Re: Lizard King]
#3486434 - 12/12/04 01:49 PM (19 years, 3 months ago) |
|
|
I'm doing just fine LK. Very nice fish .I should get some dynamite, and go fishing with you sometime Check your PM
As for Mitchnast being a mod, he's got my vote if needed.
doo
-------------------- - Arguing with a woman, is like trying to blow out a light bulb-
|
Gumby
Fishnologist
Registered: 06/13/01
Posts: 26,656
|
Re: Wewt wewt, new mods! [Re: doo]
#3486874 - 12/12/04 03:50 PM (19 years, 3 months ago) |
|
|
If you guys ever go dynamite fishing I might just have to invite my self I've always wanted to do that.
|
|