Home | Community | Message Board


Mycohaus
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> Mushroom Hunting and Identification

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Jump to first unread post. Pages: 1 | 2 | Next >  [ show all ]
OfflineGumbyM
Fishnologist
Male User Gallery

Folding@home Statistics
Registered: 06/13/01
Posts: 26,647
Loc: BRICK CITY!
Last seen: 13 days, 15 hours
Trusted Identifier
Wewt wewt, new mods!
    #3466915 - 12/08/04 09:30 PM (11 years, 11 months ago)

Folks, we've got two new mods and we've dropped three.
Not going into details on why the three were dropped.

Lizard King is finally a mod again! Wewt! This guy was a mod on the hunting forums when I first joined. He was kind enough to take me under his wings and teach me a good majority of what I know now. Glad to have ya back LK!

Shroomydan is the other new mod. His name will be green as soon as the admins get to it. As any hunting forum regular knows, this guy REALLY knows his shit. He's nice to the n00bs too :smile: In addition, he's from the Ohio area, so he can help some of you out in the North East, because he better knows what's going on out there. Glad to have you as part of the team :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleBitterPill
 User Gallery

Registered: 10/01/04
Posts: 551
Loc: PNW
Re: Wewt wewt, new mods! [Re: Gumby]
    #3466933 - 12/08/04 09:33 PM (11 years, 11 months ago)

Nice, shroomydan deserves to be a mod. He's always helping out. Who got dropped?

-BP


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Wewt wewt, new mods! [Re: BitterPill]
    #3466952 - 12/08/04 09:34 PM (11 years, 11 months ago)

Quote:

BitterPill said:
Nice, shroomydan deserves to be a mod. He's always helping out. Who got dropped?

-BP




... Mjshroomer? why?

I'm not a regular poster here, due to my location, but I'm a regular reader definately. So, congrats.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
OfflinePsilygirl
cyan goddess
 User Gallery

Registered: 08/28/03
Posts: 4,418
Loc: PNW
Last seen: 15 days, 8 hours
Re: Wewt wewt, new mods! [Re: Gumby]
    #3466964 - 12/08/04 09:37 PM (11 years, 11 months ago)

congrats, shroomeydan and LK!! :cheers:

I think this team will do a better job for sure!


--------------------
"Love says 'I am everything.' Wisdom says 'I am nothing.' Between the two, my life flows."


Puget Sound Mycological Society


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineeris
underground
Male User Gallery

Registered: 11/18/98
Posts: 48,009
Loc: North East, USA
Last seen: 4 months, 27 days
Trusted Identifier
Re: Wewt wewt, new mods! [Re: Gumby]
    #3467469 - 12/08/04 11:13 PM (11 years, 11 months ago)

Quote:


In addition, he's from the Ohio area, so he can help some of you out in the North East





That is a good idea, I noticed a lot of them.
Shroomydan is a good poster, I like the fact that he has a broad interest in mushrooms (not just limited to actives).


--------------------
Immortal / Temporarily Retired
The OG Thread Killer
My mushroom hunting gallery


Edited by eris (12/08/04 11:14 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineGumbyM
Fishnologist
Male User Gallery

Folding@home Statistics
Registered: 06/13/01
Posts: 26,647
Loc: BRICK CITY!
Last seen: 13 days, 15 hours
Trusted Identifier
Re: Wewt wewt, new mods! [Re: eris]
    #3467484 - 12/08/04 11:16 PM (11 years, 11 months ago)

As does Lizard King. LK showed me the first morels I've ever seen :smile: Definitely a benefit having mods who are into the entire subject of mycology and not just the actives.


Post Extras: Print Post  Remind Me! Notify Moderator
Invisibleshroomydan
exshroomerite
 User Gallery

Registered: 07/04/04
Posts: 4,126
Loc: In the woods
Re: Wewt wewt, new mods! [Re: Gumby]
    #3467529 - 12/08/04 11:24 PM (11 years, 11 months ago)

You all say such kind words. :inlove:
Thank you.

I look forward to serving.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineToxicManM
Bite me, it's fun!
 User Gallery

Registered: 06/28/02
Posts: 6,478
Loc: Aurora, Colorado
Last seen: 2 days, 17 minutes
Trusted Identifier
Re: Wewt wewt, new mods! [Re: shroomydan]
    #3467614 - 12/08/04 11:38 PM (11 years, 11 months ago)

Congrats, newly green shaded guys.

Happy mushrooming!


--------------------
Happy mushrooming!


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblenewusername222
Stranger
Male User Gallery
Registered: 08/14/03
Posts: 2,327
Re: Wewt wewt, new mods! [Re: ToxicMan]
    #3467659 - 12/08/04 11:49 PM (11 years, 11 months ago)

Let me just say thanks to all of the mods for the work in keeping this forum running so smoothly and keeping the posts what they should be.  :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Wewt wewt, new mods! [Re: newusername222]
    #3467824 - 12/09/04 12:20 AM (11 years, 11 months ago)

Why isn't mj a mod anymore?


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineGumbyM
Fishnologist
Male User Gallery

Folding@home Statistics
Registered: 06/13/01
Posts: 26,647
Loc: BRICK CITY!
Last seen: 13 days, 15 hours
Trusted Identifier
Re: Wewt wewt, new mods! [Re: Koala Koolio]
    #3467831 - 12/09/04 12:22 AM (11 years, 11 months ago)

Quote:

Not going into details on why the three were dropped.




Can't say. Against policy.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Wewt wewt, new mods! [Re: Gumby]
    #3468127 - 12/09/04 01:10 AM (11 years, 11 months ago)

Sorry.. I missed that. Read every post under BitterPill's carefully to make sure it wasn't said already. You'd think I'd figure to reread the first.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleSuper_Blunt
Candyman
 User Gallery

Registered: 10/25/04
Posts: 3,140
Re: Wewt wewt, new mods! [Re: Koala Koolio]
    #3468243 - 12/09/04 01:34 AM (11 years, 11 months ago)

:birthday:


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinesuperblingtheory
ghettogepetto

Registered: 11/02/03
Posts: 921
Loc: Omnipresent
Last seen: 3 years, 11 months
Re: Wewt wewt, new mods! [Re: Super_Blunt]
    #3469511 - 12/09/04 10:32 AM (11 years, 11 months ago)

YAAAAAAAAAAAAAAAAAYYYYYY!


--------------------

Guts and danger, Airborne Ranger...


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinesuperblingtheory
ghettogepetto

Registered: 11/02/03
Posts: 921
Loc: Omnipresent
Last seen: 3 years, 11 months
Re: Wewt wewt, new mods! [Re: superblingtheory]
    #3469515 - 12/09/04 10:33 AM (11 years, 11 months ago)

Let's have a party for them- I'll start by rolling this joint.....


--------------------

Guts and danger, Airborne Ranger...


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLizard King
King Lizard

Registered: 10/04/99
Posts: 1,998
Loc: GA
Last seen: 10 years, 3 months
Re: Wewt wewt, new mods! [Re: superblingtheory]
    #3469652 - 12/09/04 11:22 AM (11 years, 11 months ago)

And I'll start by spaking it :smile: Hello all, let me first say its great to be back and that I will do the best job I can helping folks and keeping this forum running smoothly. I wish I had never left but life has other priorities. Between my buisness and all the moving I've done in the past two years it was near impossible for me to frequent this site enough to do my part as a mod so I stepped down. Now I have my life in order, things are going great for me and I have regular internet access for the first time in two years. Its great to be back home, and thanks for the kind words from everyone.

Now then, off to the Ps. cubensis fields, all this rain we are getting here in the southland accompanied with warm temps are bringing up some late season fruits that need pickin'. Be back later with a report and pics hopefully :smile:


LK,


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleGGreatOne234
Stranger
Registered: 12/24/99
Posts: 8,946
Re: Wewt wewt, new mods! [Re: Lizard King]
    #3472102 - 12/09/04 08:05 PM (11 years, 11 months ago)

congrats to all the new mods


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinedoo
addict -crazy as a shithouse rat
 User Gallery

Registered: 10/18/00
Posts: 604
Loc: Slingshit, China
Last seen: 1 year, 9 months
Re: Wewt wewt, new mods! [Re: GGreatOne234]
    #3472532 - 12/09/04 09:23 PM (11 years, 11 months ago)

LK, a moderator again.........ya'll must be scraping the bottom of the barrel...... :wink: hehehehe......just joking of course..... the man damn sure knows his 'shrooms.  He could find mushies on the moon :grin:
Haven't been hunting myself in awhile but I
figured I'd stop by the ol' Shroomery and see what folks have been finding lately.  Those  blue gymno pics shroomydan posted a few pages back are awesome. Makes me want to get back into the woods again, and see what I can find.

doo


--------------------
- Arguing with a woman, is like trying to blow out a light bulb-


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLizard King
King Lizard

Registered: 10/04/99
Posts: 1,998
Loc: GA
Last seen: 10 years, 3 months
Re: Wewt wewt, new mods! [Re: doo]
    #3473039 - 12/09/04 10:34 PM (11 years, 11 months ago)

Holy shiot, doo!!! What a suprise, thought I'd never hear from the ole shit house rat again. Good to see ya still posting.

How ya been lately?? My dredging buisness has been going great and I have moved out to the "country" on a big farm house with horses. Been doing alot of fishing lately, caught more bass this past year than I can ever remember. Bought a few new canoes and have been a religous river rat this past summer :smile: I hope you've been doing well, don't be a stranger and drop by more often.

Some pictures...




LK,


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKyKid
Stranger
Registered: 10/22/04
Posts: 605
Re: Wewt wewt, new mods! [Re: Lizard King]
    #3475528 - 12/10/04 12:39 PM (11 years, 11 months ago)

congrats new mods, not a hunter because of my location but i read this forum just as much as the others and i know things will go smooth with the new mods. also shroomydan how good is the picking in Ohio, its only a short drive from me, I'm more then willing to make a trip of it if the picking is worth it, but even if i don't get shit the experience would be worth it since Ive never hunted for wild species before and it has been something Ive wanted to do for so long now. well the season is almost over I'm guessing but there's next year coming on so quick


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1 | 2 | Next >  [ show all ]

Mushrooms, Mycology and Psychedelics >> Mushroom Hunting and Identification

Similar ThreadsPosterViewsRepliesLast post
* Mj, Bitterpill and Friend's Sunday Cyan Hunt mjshroomer 914 11 12/20/04 09:28 AM
by motaman
* New mod: bluemeanie GumbyM 966 17 05/18/06 07:23 PM
by undersativaskies
* Christmas Psilocybes - BitterPill & GrouchnEligh BitterPill 823 6 12/26/04 02:36 PM
by GGreatOne234
* Mushroom hunting with shroomydan= WOOHOOGREATFINDS! *pics* Jenny 2,573 19 10/08/06 10:44 PM
by Dr. uarewotueat
* Shroomydan says goodbye shroomydan 1,187 14 08/28/04 04:56 PM
by jellynutz
* Thanks for the mods and helpers of the Hunting forum! Anonymous 1,246 10 09/11/03 01:05 AM
by Anonymous
* Hunting Forum Needs New Policy(MODS-and regulars read) GaNjAShRooM 2,378 16 06/04/04 11:46 AM
by Anonymous
* Welcome Wagon: New Mod. GumbyDude! Sporz 983 6 07/21/02 08:42 AM
by NewHunter

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, karode13, Alan Rockefeller, TimmiT, Joust
2,287 topic views. 9 members, 38 guests and 15 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
Edabea
Please support our sponsors.

Copyright 1997-2016 Mind Media. Some rights reserved.

Generated in 0.064 seconds spending 0.003 seconds on 16 queries.