Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   Left Coast Kratom Buy Kratom Capsules   PhytoExtractum Kratom Powder for Sale   MagicBag.co Certified Organic All-In-One Grow Bags by Magic Bag

Jump to first unread post Pages: 1 | 2  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
InvisibleLifenergy
Yo Mama

Registered: 08/05/04
Posts: 766
Sales at ShamansPalace
    #3433514 - 12/01/04 03:47 PM (19 years, 3 months ago)

Just letting everyone know that ShamansPalace is having a great looking sale on their dried San Pedro, and they have dried Peruvianus too. Check it out. http://www.shamanspalace.com/index.php?cPath=23


--------------------
Everything that we see is a shadow cast by that which we do not see.

Extras: Filter Print Post Top
Offlinetheocean06
Yeah, I've donefour already...

Registered: 07/10/04
Posts: 1,458
Last seen: 12 years, 8 months
Re: Sales at ShamansPalace [Re: Lifenergy]
    #3433537 - 12/01/04 03:51 PM (19 years, 3 months ago)

They have Peruvian Torch and a sale on San Pedro :eek:

I have been looking for a legit place selling PT incense, and I now have found it.

I hope they will still be selling it come spring time...when I purchase some.



Shaman's Palace = Kicks some serious bootie :bananamusic:


--------------------


The story of life is quicker then the blink of an eye, the story of love is hello, goodbye.            - Hendrix :bow:

Extras: Filter Print Post Top
OfflineGus
Back in town.

Registered: 07/16/03
Posts: 1,503
Loc: Quebec, Canada
Last seen: 15 years, 3 months
Re: Sales at ShamansPalace [Re: theocean06]
    #3434290 - 12/01/04 06:44 PM (19 years, 3 months ago)

Dammit I just bought a pound from him and I asked first if he had PT :frown:
Great site tho, he sent me a lot of free stuff

Extras: Filter Print Post Top
Offlinerunnerup
student

Registered: 03/23/04
Posts: 708
Loc: USA
Last seen: 13 years, 4 months
Re: Sales at ShamansPalace [Re: Gus]
    #3434387 - 12/01/04 07:09 PM (19 years, 3 months ago)

he's awsome man

Extras: Filter Print Post Top
OfflineTheShroomHermit
Divine Hermit of the Everything
 User Gallery

Registered: 02/19/02
Posts: 7,575
Loc: border of Canada and Mexi...
Last seen: 9 months, 11 days
Re: Sales at ShamansPalace [Re: Lifenergy]
    #3434389 - 12/01/04 07:10 PM (19 years, 3 months ago)

So, how many sessions is this 14gram bag of incense going to last?

Extras: Filter Print Post Top
Offlinegnrm23
Carpal Tunnel
Registered: 08/29/99
Posts: 6,488
Loc: n. e. OH, USSA
Last seen: 5 months, 21 days
Re: Sales at ShamansPalace [Re: TheShroomHermit]
    #3441432 - 12/03/04 09:12 AM (19 years, 3 months ago)

~ one 14-hour voyage...


--------------------
old enough to know better
not old enough to care

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Sales at ShamansPalace [Re: gnrm23]
    #3441929 - 12/03/04 11:28 AM (19 years, 3 months ago)

14 grams? Doesn't sound like much.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Edited by elgr (02/05/06 05:36 PM)

Extras: Filter Print Post Top
OfflineGus
Back in town.

Registered: 07/16/03
Posts: 1,503
Loc: Quebec, Canada
Last seen: 15 years, 3 months
Re: Sales at ShamansPalace [Re: Koala Koolio]
    #3454560 - 12/06/04 12:15 PM (19 years, 3 months ago)

Yep exactly.
I once burned 30g of PT and I wish I had burn more because the smell was awsome but still too much subtle.

14g is not enough Im pretty sure

Extras: Filter Print Post Top
OfflineGoaM
damaged
 User Gallery

Registered: 08/14/04
Posts: 1,815
Loc: khole
Last seen: 8 years, 5 months
Re: Sales at ShamansPalace [Re: Gus]
    #3458644 - 12/07/04 06:06 AM (19 years, 3 months ago)

Hmmm. So for a decent scent that will linger about my home I should burn between 2 to 4 14g bags for a 14 hour burn? And this is for PT not SP? Are the scents for the two varieties offered similar in pungency and character from this particular vendor? Or just go with the PT?

Thanks,

Tweaker X


--------------------
 

Extras: Filter Print Post Top
OfflineGus
Back in town.

Registered: 07/16/03
Posts: 1,503
Loc: Quebec, Canada
Last seen: 15 years, 3 months
Re: Sales at ShamansPalace [Re: GoaM]
    #3459343 - 12/07/04 11:33 AM (19 years, 3 months ago)

yes I suggest burning more like 3 or 4 bags but again I never tried san pedro. Its kinda stupid to say this, but I think that with Cacti you're better off taking slighty too much than not enough because I cant imagine freaking out on cacti, compared to shrooms lets say, which is fairly easy.

Extras: Filter Print Post Top
Offlinemr_minds_eye
Disposable Wage Whore
Male User Gallery
Registered: 01/22/02
Posts: 1,948
Loc: Samsara
Last seen: 11 years, 2 months
Re: Sales at ShamansPalace [Re: Gus]
    #3467103 - 12/08/04 08:01 PM (19 years, 3 months ago)

Quote:

Gus said:
Yep exactly.
I once burned 30g of PT and I wish I had burn more because the smell was awsome but still too much subtle.

14g is not enough Im pretty sure



I 2nd that. There used to be a site removed , I believe and that was the case with thier stuff. It was still better than MDMA in my opinion though.


-edit: sorry, but lets not mention them in reference to some RCs, even though i think that site address is down, the company is still in business.


--------------------
Our quest for discovery fuels our creativity in all fields, not just science. If we reached the end of the line, the human spirit would shrivel and die. But I don't think we will ever stand still: we shall increase in complexity, if not in depth, and shall always be the center on an expanding horizon of possibilities.
-Stephen Hawking

Edited by neuro (12/08/04 11:14 PM)

Extras: Filter Print Post Top
OfflineGoaM
damaged
 User Gallery

Registered: 08/14/04
Posts: 1,815
Loc: khole
Last seen: 8 years, 5 months
Re: Sales at ShamansPalace [Re: Gus]
    #3469155 - 12/09/04 06:11 AM (19 years, 3 months ago)

Quote:

Gus said:
yes I suggest burning more like 3 or 4 bags but again I never tried san pedro. Its kinda stupid to say this, but I think that with Cacti you're better off taking slighty too much than not enough because I cant imagine freaking out on cacti, compared to shrooms lets say, which is fairly easy.




Hey, right on. I often get a come up anxiety with shrooms. I prefer doing them with MDMA. Flipping is the best. But you say mescaline is a lot kinder on the adrenergic system than shrooms? This is something I really must try. I'm a few sheets to the wind with LSD. I've eaten a fair amount of shrooms. So I think mescaline is in order now. The discriptions sound wonderful. I'll have to procure a qp in the new year. Fourteen hours seems just about right to me.  :smile:

Tweaker


--------------------
 

Extras: Filter Print Post Top
OfflineGoaM
damaged
 User Gallery

Registered: 08/14/04
Posts: 1,815
Loc: khole
Last seen: 8 years, 5 months
Re: Sales at ShamansPalace [Re: mr_minds_eye]
    #3469186 - 12/09/04 06:28 AM (19 years, 3 months ago)

Quote:

mr_minds_eye said:
I 2nd that. There used to be a site removed , I believe and that was the case with thier stuff. It was still better than MDMA in my opinion though.


-edit: sorry, but lets not mention them in reference to some RCs, even though i think that site address is down, the company is still in business.




seriously, come on now[/url]

Tweaker


edit: begging for sources openly is like shooting yourself in the foot with a shot gun.


--------------------
 

Edited by neuro (12/10/04 10:51 AM)

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Sales at ShamansPalace [Re: GoaM]
    #3469673 - 12/09/04 09:29 AM (19 years, 3 months ago)

No begging for sources.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
OfflineGus
Back in town.

Registered: 07/16/03
Posts: 1,503
Loc: Quebec, Canada
Last seen: 15 years, 3 months
Re: Sales at ShamansPalace [Re: GoaM]
    #3470681 - 12/09/04 01:21 PM (19 years, 3 months ago)

Man... Neuro deleted the info and you ask for it in the same exact thread ? Wanna get banned or what? :grin:
Next time have at least a little bit of dignity and Pm the dude.

Extras: Filter Print Post Top
InvisibleVvellum
Stranger

Registered: 05/24/04
Posts: 10,920
Re: Sales at ShamansPalace [Re: Gus] * 1
    #3470790 - 12/09/04 01:46 PM (19 years, 3 months ago)

:banbanban: :banbanban:

Extras: Filter Print Post Top
OfflineGoaM
damaged
 User Gallery

Registered: 08/14/04
Posts: 1,815
Loc: khole
Last seen: 8 years, 5 months
Re: Sales at ShamansPalace [Re: Gus]
    #3474434 - 12/10/04 01:04 AM (19 years, 3 months ago)

Quote:

Gus said:
Man... Neuro deleted the info and you ask for it in the same exact thread ? Wanna get banned or what? :grin:
Next time have at least a little bit of dignity and Pm the dude.




LOL. So what are you saying,  Pretty Please isn't dignified?! HAHA. Point taken though. It would have been a better thing to PM.

Tweaker


--------------------
 

Extras: Filter Print Post Top
OfflineGoaM
damaged
 User Gallery

Registered: 08/14/04
Posts: 1,815
Loc: khole
Last seen: 8 years, 5 months
Re: Sales at ShamansPalace [Re: Vvellum]
    #3474443 - 12/10/04 01:07 AM (19 years, 3 months ago)

Quote:

bi0 said:
:banbanban: :banbanban:




Yeah, fuck you too. :flipthebird: :flipthebird: :flipthebird: :flipthebird:


--------------------
 

Extras: Filter Print Post Top
Offlineneuro
Phytophiliac
 User Gallery

Registered: 08/10/99
Posts: 6,633
Loc: Rigel 7
Last seen: 4 months, 14 days
Re: Sales at ShamansPalace [Re: GoaM]
    #3475586 - 12/10/04 10:52 AM (19 years, 3 months ago)

You're lucky I'm me and not some other mods, cause i'd bet my hat you'd be banned for atleast a day now. Sources rule is a site-wide rule and not to mention common sense.

Extras: Filter Print Post Top
Offlineguri
Master of theimprobablitydrive

Registered: 01/10/04
Posts: 576
Loc: PNWish.
Last seen: 15 years, 8 months
Re: Sales at ShamansPalace [Re: neuro]
    #3476512 - 12/10/04 02:05 PM (19 years, 3 months ago)

wait im kinda confused here, you can burn this inscense and trip like a normal mescaline trip?
or did i totally just misunderstand what was said?


--------------------
"If you don't believe drugs have done good things for us, then go home and burn all your records, all your tapes, and all your CDs because every one of those artists who have made brilliant music and enhanced your lives? The Beatles were so fucking high, they let Ringo sing a few songs." --Bill Hicks

Extras: Filter Print Post Top
OfflineWysefool
I AM SKELETON JELLY
Male User Gallery
Registered: 12/26/02
Posts: 6,643
Last seen: 7 days, 21 hours
Re: Sales at ShamansPalace [Re: guri]
    #3477957 - 12/10/04 06:02 PM (19 years, 3 months ago)

It's incense OF COURSE you can trip off it

(Psst... Wanna buy some Red Rock Opium?)


--------------------
]

Extras: Filter Print Post Top
OfflineGoaM
damaged
 User Gallery

Registered: 08/14/04
Posts: 1,815
Loc: khole
Last seen: 8 years, 5 months
Re: Sales at ShamansPalace [Re: neuro]
    #3485365 - 12/12/04 06:56 AM (19 years, 3 months ago)

Quote:

neuro said:
You're lucky I'm me and not some other mods, cause i'd bet my hat you'd be banned for atleast a day now. Sources rule is a site-wide rule and not to mention common sense.




Hmm. Thanks for your tolerence. I'm a little confused on the sources issue. I think I'll reread the faq. I followed some others lead and posted sources for glass in another thread. I hope thats not a bad.

TweakerX


--------------------
 

Extras: Filter Print Post Top
Offlinetheocean06
Yeah, I've donefour already...

Registered: 07/10/04
Posts: 1,458
Last seen: 12 years, 8 months
Re: Sales at ShamansPalace [Re: GoaM]
    #3485708 - 12/12/04 10:21 AM (19 years, 3 months ago)

It goes like this - you can't list a source to illegal activity (you have to go by US laws since this site is based in the US), such as sources for mescaline containing cacti when clearly the site states it is not for human consumption (hint*hint* - change your wording of your question) and especially RC's (which should be in ODD anyway), but you can if it is legal, such as a source for glassware.


--------------------


The story of life is quicker then the blink of an eye, the story of love is hello, goodbye.            - Hendrix :bow:

Extras: Filter Print Post Top
Jump to top Pages: 1 | 2  [ show all ]

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   Left Coast Kratom Buy Kratom Capsules   PhytoExtractum Kratom Powder for Sale   MagicBag.co Certified Organic All-In-One Grow Bags by Magic Bag


Similar ThreadsPosterViewsRepliesLast post
* TLC info on Lotus Absolute Oils in !!! Shamanspalace.com ShamansPalace 1,942 16 05/24/05 02:42 PM
by ShamansPalace
* Species of cacti that have mescaline,list please??? bluelou 3,026 11 07/12/05 12:07 PM
by Chemical_Bliss
* mescaline cacti
( 1 2 all )
Locus 3,211 24 05/03/08 11:46 AM
by schmutzen
* San Pedro separation of Mescalin new idea?
( 1 2 all )
GNIOM1498 7,231 20 09/14/16 09:11 PM
by Mostly_Harmless
* list of mescaline cacti in order 5meopsyco 18,531 5 10/06/05 10:05 PM
by spudamore
* what went wrong with my mescaline extraction?
( 1 2 all )
sancho 11,645 36 03/24/05 08:46 AM
by Randolph_Carter
* Mescaline a/b Extraction retread 4,114 9 10/09/04 11:26 PM
by retread
* Unusual Mescaline Questions eve69 3,938 15 06/17/07 08:41 PM
by thedudenj

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Mostly_Harmless, A.k.a
1,865 topic views. 0 members, 6 guests and 12 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.026 seconds spending 0.007 seconds on 14 queries.