Home | Community | Message Board

Magic Mushrooms Zamnesia
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Myyco.com Isolated Cubensis Liquid Culture For Sale   Kraken Kratom Red Vein Kratom   Original Sensible Seeds Bulk Cannabis Seeds   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   PhytoExtractum Maeng Da Thai Kratom Leaf Powder

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflinePsiloman
member
Male
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 6 months
A sixed ribed Pedro giving a five ribed one?
    #3416715 - 11/27/04 05:10 PM (19 years, 4 months ago)

Hello Dear Gardeners...

My question is simple...I have a San Pedro that during summertime it started pupping.My san pedro is six ribbed and it has produced one six ribbed cactus and one five ribbed...

Anyone know what is that? I dont know ,maybe its rare,maybe its quite common ,maybe i did something and induce such a growth...any ideas?

Extras: Filter Print Post Top
Offlinewhitegreyhat
Huge

Registered: 10/23/04
Posts: 327
Loc: Northeast USA
Last seen: 7 years, 7 months
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
    #3416780 - 11/27/04 05:26 PM (19 years, 4 months ago)

no i think its quite common, pedros can have like 4-6 ribs depending on something (dont know what though)

Extras: Filter Print Post Top
OfflineEkstaza
stranger than most
 User Gallery

Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 11 months, 21 days
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
    #3416847 - 11/27/04 05:39 PM (19 years, 4 months ago)

I've had several san pedros do this. It's just chance.

I've also seen cactii lose or gain a rib mid stalk.


--------------------
YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.

Extras: Filter Print Post Top
Offlinefaslimy
Dead Man
 User Gallery
Registered: 04/04/04
Posts: 3,436
Last seen: 8 years, 3 months
Re: A sixed ribed Pedro giving a five ribed one? [Re: Ekstaza]
    #3416856 - 11/27/04 05:41 PM (19 years, 4 months ago)

Pedro can have more than 6 ribs, the 7 ribbed pedro was prized by the natives who harvested it and would be more desirable than the others.

Extras: Filter Print Post Top
OfflinePsiloman
member
Male
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 6 months
Re: A sixed ribed Pedro giving a five ribed one? [Re: faslimy]
    #3416919 - 11/27/04 05:57 PM (19 years, 4 months ago)

Thanks for the answers my friends!

I find many lifeforms of this planet so interesting and the only way one can appreciate their true beauty is to observe them...Be it a five star going into a six star pedro,be it changing mid stalk its amazing ,dont you think?

Extras: Filter Print Post Top
OfflineGr0wer
always improving
Male

Registered: 09/16/03
Posts: 6,056
Loc: El Paso, TX Flag
Last seen: 6 years, 19 days
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
    #3417680 - 11/27/04 09:53 PM (19 years, 4 months ago)

It seems the more healthy they are the more ribs they have. You can have the rib count change allong a log going up or down depending on there environment. I had mine go down one when i brought it in and put it under floros.

Extras: Filter Print Post Top
Offlinefelixhigh
Scientist
Male User Gallery

Registered: 06/24/01
Posts: 7,565
Loc: Ly
Last seen: 28 days, 19 hours
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
    #3417734 - 11/27/04 10:15 PM (19 years, 4 months ago)

sure is possible...
but i was going to say, you have a slight chance of having a trichocereus scopulicola and not a pachanoid (they're more prone to giving 5 (or 4!) ribbed pups)...
are its areoles rather close or pachanoid spaced?


FH

Extras: Filter Print Post Top
InvisibleGumby
Fishnologist
 User Gallery

Registered: 06/13/01
Posts: 26,656
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
    #3418488 - 11/28/04 03:37 AM (19 years, 4 months ago)

Here's my thoughts:

omg uv radiation + cacti cells = DNA mutation= -1 rib

Awesome, eh?

Extras: Filter Print Post Top
InvisibleMerkin
neep.
 User Gallery

Registered: 07/04/03
Posts: 27,537
Loc: Ass Flavoured Pie Factory
Re: A sixed ribed Pedro giving a five ribed one? [Re: faslimy]
    #3418551 - 11/28/04 04:33 AM (19 years, 4 months ago)

Quote:

faslimy said:
Pedro can have more than 6 ribs, the 7 ribbed pedro was prized by the natives who harvested it and would be more desirable than the others.




I gotta take some photos of my specimen pedro i was telling you about. It's 7 ribbed ^_^ hooray!


--------------------
Wheels of cheese wheeels of cheeeeese!!!

Extras: Filter Print Post Top
OfflinePsiloman
member
Male
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 6 months
Re: A sixed ribed Pedro giving a five ribed one? [Re: felixhigh]
    #3418826 - 11/28/04 08:25 AM (19 years, 4 months ago)

Felixhigh got me thinking and researching..I picked up my cactus from a cactus nursery and i was quite sure that it is a pachanoi...Now i thought it could be mislabelled as well...

I researched the net and found pictures of both Pachanoi and Scopulicola and checked the areoles.My cacti's areoles have a distance of a liltle less that 2 fingers it doesnt look as dense as Scopulicola but there is always that safety margin one must keep due to human error...I wish i had a camera now so i could post some pictures of it for all to see...

The aerole distance is about 3 cm average but not exceeding it but near the base when it was young and the ribs were not so pronounced the aeroles are denser.The distance i report is the one from the nively developed parts of my cacti..

I was also amazed to find that scopulicola has alkaloids found also in pachanoi! I would like to experiment with crossbreeding related species so to get nice hybrids!

Extras: Filter Print Post Top
Offlinefaslimy
Dead Man
 User Gallery
Registered: 04/04/04
Posts: 3,436
Last seen: 8 years, 3 months
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
    #3419863 - 11/28/04 04:49 PM (19 years, 4 months ago)

Skin tecture is the easiest way to find out. Pachanoi has smooth skin like lyno (sp?) when you rub it with your fingernail, scopulicola has a more rough sharks skin type texture

Extras: Filter Print Post Top
Offlinefelixhigh
Scientist
Male User Gallery

Registered: 06/24/01
Posts: 7,565
Loc: Ly
Last seen: 28 days, 19 hours
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
    #3420042 - 11/28/04 05:50 PM (19 years, 4 months ago)

good research psiloman!
it seems to be a pedro, by the areole spacing you say.
also, the scops frequently have more noticeable v notches...
i'm not sure if most people notice, in every pachanoi collection there often is one or a few scops around (look at Maverik's cacti post, that other post with cacti on the ground behind a fence can't remember the owner)...
it is said that the Juul's Giant hybrid is scop X peruvianus...


FH

Extras: Filter Print Post Top
OfflinePsiloman
member
Male
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 6 months
Re: A sixed ribed Pedro giving a five ribed one? [Re: felixhigh]
    #3426902 - 11/30/04 06:37 AM (19 years, 3 months ago)

Hmmm on skin texture....It feels like lyno (linen i guess it is called) which i have touched...DOesnt feel like a shark.One though could argue that i have never touched a shark and i can only hypothesize on how its skin feels by looking at it!

Felixhigh: Yes i have seen those V notches many times in cacti reputed to be san pedro.Its the depressed space on the aerole ,right? Some of them are pretty heavy V notched let me say....My cacti are completely devoid of V notches ,so i guess this reinforces the original ideas that they are Pedros.....

Hybridisation is very interesting! Let me add a though of mine! Here in Greece a plant called Colhicus Autamnalea (propably i just killed the spelling!!!!) grows abudantly.It is very rich in colhicine (es,i am familiar with the dangers ,handle with gloves,it is a mitotic poison,disinfect quickly any spill!!!!) and i am thinking of trying some crude extracts of this plant on my cactus.An idea woyld be to injure the top (where ribs grow from) slightly with a needle and put a drop of my colhicine crude extract...Propably new growth from the tip will be mutated,i can then transfer it to a tissue culture and see what happens...

Extras: Filter Print Post Top
Offlinerockstafarian
unsui

Registered: 08/22/03
Posts: 165
Last seen: 18 years, 8 months
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
    #3432457 - 12/01/04 11:35 AM (19 years, 3 months ago)

Heres a four ribber (pedro) from erowid



--------------------
^ Above post is complete fiction. ^

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: A sixed ribed Pedro giving a five ribed one? [Re: rockstafarian]
    #3432624 - 12/01/04 12:22 PM (19 years, 3 months ago)

My girlfriend has a 7ribbed one. Halfway up (actually closer to the top) 2 of the ribs just sort of stopped. Its now a 5 ripped pedro :smile:


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Myyco.com Isolated Cubensis Liquid Culture For Sale   Kraken Kratom Red Vein Kratom   Original Sensible Seeds Bulk Cannabis Seeds   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   PhytoExtractum Maeng Da Thai Kratom Leaf Powder


Similar ThreadsPosterViewsRepliesLast post
* San Pedro Verification ShattrdHarlequin 668 4 03/02/04 09:02 AM
by HarveyWalbanger
* Possible San Pedro at Home Depot megaman3 33,688 15 12/30/16 10:56 PM
by Mostly_Harmless
* questionable pedro zeta 887 8 02/16/04 10:30 AM
by eric_the_red
* Exclusive Pictorial: How To Prepare San Pedro (Photos)
( 1 2 3 4 5 6 7 8 all )
mjshroomer 69,788 140 09/15/16 03:31 AM
by Mostly_Harmless
* San Pedro Pics + Question Dava 2,004 8 06/22/03 02:22 PM
by Dava
* Pedro question chinacat72 1,846 13 03/20/04 05:18 AM
by chinacat72
* advice on best way to cut from my pedro Floydian 655 1 07/28/02 07:27 PM
by Floydian
* San Pedro Sighting! MeltingPenguin 1,081 6 04/04/02 08:38 AM
by Anonymous

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Mostly_Harmless, A.k.a
1,537 topic views. 2 members, 7 guests and 12 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.017 seconds spending 0.004 seconds on 12 queries.