|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Psiloman
member
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 6 months
|
A sixed ribed Pedro giving a five ribed one?
#3416715 - 11/27/04 05:10 PM (19 years, 4 months ago) |
|
|
Hello Dear Gardeners...
My question is simple...I have a San Pedro that during summertime it started pupping.My san pedro is six ribbed and it has produced one six ribbed cactus and one five ribbed...
Anyone know what is that? I dont know ,maybe its rare,maybe its quite common ,maybe i did something and induce such a growth...any ideas?
|
whitegreyhat
Huge
Registered: 10/23/04
Posts: 327
Loc: Northeast USA
Last seen: 7 years, 7 months
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
#3416780 - 11/27/04 05:26 PM (19 years, 4 months ago) |
|
|
no i think its quite common, pedros can have like 4-6 ribs depending on something (dont know what though)
|
Ekstaza
stranger than most
Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 11 months, 21 days
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
#3416847 - 11/27/04 05:39 PM (19 years, 4 months ago) |
|
|
I've had several san pedros do this. It's just chance. I've also seen cactii lose or gain a rib mid stalk.
-------------------- YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.
|
faslimy
Dead Man
Registered: 04/04/04
Posts: 3,436
Last seen: 8 years, 3 months
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: Ekstaza]
#3416856 - 11/27/04 05:41 PM (19 years, 4 months ago) |
|
|
Pedro can have more than 6 ribs, the 7 ribbed pedro was prized by the natives who harvested it and would be more desirable than the others.
|
Psiloman
member
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 6 months
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: faslimy]
#3416919 - 11/27/04 05:57 PM (19 years, 4 months ago) |
|
|
Thanks for the answers my friends!
I find many lifeforms of this planet so interesting and the only way one can appreciate their true beauty is to observe them...Be it a five star going into a six star pedro,be it changing mid stalk its amazing ,dont you think?
|
Gr0wer
always improving
Registered: 09/16/03
Posts: 6,056
Loc: El Paso, TX
Last seen: 6 years, 20 days
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
#3417680 - 11/27/04 09:53 PM (19 years, 4 months ago) |
|
|
It seems the more healthy they are the more ribs they have. You can have the rib count change allong a log going up or down depending on there environment. I had mine go down one when i brought it in and put it under floros.
|
felixhigh
Scientist
Registered: 06/24/01
Posts: 7,565
Loc: Ly
Last seen: 29 days, 6 hours
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
#3417734 - 11/27/04 10:15 PM (19 years, 4 months ago) |
|
|
sure is possible... but i was going to say, you have a slight chance of having a trichocereus scopulicola and not a pachanoid (they're more prone to giving 5 (or 4!) ribbed pups)... are its areoles rather close or pachanoid spaced?
FH
|
Gumby
Fishnologist
Registered: 06/13/01
Posts: 26,656
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
#3418488 - 11/28/04 03:37 AM (19 years, 4 months ago) |
|
|
Here's my thoughts:
omg uv radiation + cacti cells = DNA mutation= -1 rib
Awesome, eh?
|
Merkin
neep.
Registered: 07/04/03
Posts: 27,537
Loc: Ass Flavoured Pie Factory
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: faslimy]
#3418551 - 11/28/04 04:33 AM (19 years, 4 months ago) |
|
|
Quote:
faslimy said: Pedro can have more than 6 ribs, the 7 ribbed pedro was prized by the natives who harvested it and would be more desirable than the others.
I gotta take some photos of my specimen pedro i was telling you about. It's 7 ribbed ^_^ hooray!
-------------------- Wheels of cheese wheeels of cheeeeese!!!
|
Psiloman
member
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 6 months
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: felixhigh]
#3418826 - 11/28/04 08:25 AM (19 years, 4 months ago) |
|
|
Felixhigh got me thinking and researching..I picked up my cactus from a cactus nursery and i was quite sure that it is a pachanoi...Now i thought it could be mislabelled as well...
I researched the net and found pictures of both Pachanoi and Scopulicola and checked the areoles.My cacti's areoles have a distance of a liltle less that 2 fingers it doesnt look as dense as Scopulicola but there is always that safety margin one must keep due to human error...I wish i had a camera now so i could post some pictures of it for all to see...
The aerole distance is about 3 cm average but not exceeding it but near the base when it was young and the ribs were not so pronounced the aeroles are denser.The distance i report is the one from the nively developed parts of my cacti..
I was also amazed to find that scopulicola has alkaloids found also in pachanoi! I would like to experiment with crossbreeding related species so to get nice hybrids!
|
faslimy
Dead Man
Registered: 04/04/04
Posts: 3,436
Last seen: 8 years, 3 months
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
#3419863 - 11/28/04 04:49 PM (19 years, 4 months ago) |
|
|
Skin tecture is the easiest way to find out. Pachanoi has smooth skin like lyno (sp?) when you rub it with your fingernail, scopulicola has a more rough sharks skin type texture
|
felixhigh
Scientist
Registered: 06/24/01
Posts: 7,565
Loc: Ly
Last seen: 29 days, 6 hours
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
#3420042 - 11/28/04 05:50 PM (19 years, 4 months ago) |
|
|
good research psiloman! it seems to be a pedro, by the areole spacing you say. also, the scops frequently have more noticeable v notches... i'm not sure if most people notice, in every pachanoi collection there often is one or a few scops around (look at Maverik's cacti post, that other post with cacti on the ground behind a fence can't remember the owner)... it is said that the Juul's Giant hybrid is scop X peruvianus...
FH
|
Psiloman
member
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 10 years, 6 months
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: felixhigh]
#3426902 - 11/30/04 06:37 AM (19 years, 3 months ago) |
|
|
Hmmm on skin texture....It feels like lyno (linen i guess it is called) which i have touched...DOesnt feel like a shark.One though could argue that i have never touched a shark and i can only hypothesize on how its skin feels by looking at it!
Felixhigh: Yes i have seen those V notches many times in cacti reputed to be san pedro.Its the depressed space on the aerole ,right? Some of them are pretty heavy V notched let me say....My cacti are completely devoid of V notches ,so i guess this reinforces the original ideas that they are Pedros.....
Hybridisation is very interesting! Let me add a though of mine! Here in Greece a plant called Colhicus Autamnalea (propably i just killed the spelling!!!!) grows abudantly.It is very rich in colhicine (es,i am familiar with the dangers ,handle with gloves,it is a mitotic poison,disinfect quickly any spill!!!!) and i am thinking of trying some crude extracts of this plant on my cactus.An idea woyld be to injure the top (where ribs grow from) slightly with a needle and put a drop of my colhicine crude extract...Propably new growth from the tip will be mutated,i can then transfer it to a tissue culture and see what happens...
|
rockstafarian
unsui
Registered: 08/22/03
Posts: 165
Last seen: 18 years, 8 months
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: Psiloman]
#3432457 - 12/01/04 11:35 AM (19 years, 3 months ago) |
|
|
Heres a four ribber (pedro) from erowid
-------------------- ^ Above post is complete fiction. ^
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: A sixed ribed Pedro giving a five ribed one? [Re: rockstafarian]
#3432624 - 12/01/04 12:22 PM (19 years, 3 months ago) |
|
|
My girlfriend has a 7ribbed one. Halfway up (actually closer to the top) 2 of the ribs just sort of stopped. Its now a 5 ripped pedro
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
|