Home | Community | Message Board

Magic-Mushrooms-Shop.com
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Original Sensible Seeds Shop: Autoflowering Cannabis Seeds, Bulk Cannabis Seeds, Feminized Cannabis Seeds, High THC Strains

Jump to first unread post Pages: 1 | 2 | Next >  [ show all ]
Offlinetoneloke
Stranger
 User Gallery
Registered: 11/21/04
Posts: 38
Last seen: 18 years, 11 months
Cigarettes!
    #3394530 - 11/21/04 08:24 PM (19 years, 2 months ago)

To smoke or not to smoke, that is the question.
Smoking cigarettes, good or bad?
You may choose only one


Votes accepted from (11/21/04 12:00 PM) to (No end specified)
You must vote before you can view the results of this poll



Extras: Filter Print Post Top
Offlinelilbil
republican hippy(only one)

Registered: 10/09/04
Posts: 114
Loc: Montana, usa
Last seen: 19 years, 1 month
Re: Cigarettes! [Re: toneloke]
    #3394602 - 11/21/04 08:39 PM (19 years, 2 months ago)

what!!!!!! cig are the shit, fuck you guys if you dont want them, give them to me :laugh:


--------------------
----------------------------------------------

if ignorance is bliss, then sadly my mom and dad are very happy......


Extras: Filter Print Post Top
Anonymous

Re: Cigarettes! [Re: toneloke]
    #3396610 - 11/23/04 12:54 AM (19 years, 2 months ago)

This poll is a little extreme. Everything in moderation, I say.


Extras: Filter Print Post Top
Invisiblesilversoul7
Chill the FuckOut!
 User Gallery

Registered: 10/10/02
Posts: 27,301
Loc: mndfreeze's puppet army
Re: Cigarettes! [Re: ]
    #3396875 - 11/23/04 02:24 AM (19 years, 2 months ago)

Quote:

Max Headroom said:
This poll is a little extreme. Everything in moderation, I say.



:thumbup:


--------------------


"It is dangerous to be right when the government is wrong."--Voltaire


Extras: Filter Print Post Top
InvisibleSuper_Blunt
Candyman
 User Gallery

Registered: 10/25/04
Posts: 3,140
Re: Cigarettes! [Re: silversoul7]
    #3396879 - 11/23/04 02:27 AM (19 years, 2 months ago)

I don't know I'd smoke 10 cigarettes at once if i had the money :lol:

at $9.00 a pack, this is only a fantasy of mine.


--------------------


Extras: Filter Print Post Top
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,112
Last seen: 2 years, 9 months
Re: Cigarettes! [Re: toneloke]
    #3396994 - 11/23/04 03:30 AM (19 years, 2 months ago)

to me, they're stupid and no point really in smoking them, no offense to the smokers though.


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Extras: Filter Print Post Top
InvisiblePsilostylin
Captain Save Em'
Registered: 03/13/04
Posts: 678
Loc: New Orleans!
Re: Cigarettes! [Re: Locus]
    #3397137 - 11/23/04 05:14 AM (19 years, 2 months ago)

$9 a pack! christ, dude, why even smoke? you could get a bag of weed for the price of 2 packs. around here cigarettes are from $2.75 to $4.00. i smoke way too much. i hate cigarettes.

a good addition to this poll would be... 'what brand of cigarettes do you smoke?' personally i smoke camel...but normally when i'm low on funds (which is most of the time), i smoke bronco's. a cheap columbian brand of smokes sold at $2.00 a pack. horible quality, but, when ya need a joe, it does the trick.


Extras: Filter Print Post Top
OfflineCaRnAgECaNdYS
Tool's groupie
Female User Gallery

Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet Flag
Last seen: 6 months, 22 days
Re: Cigarettes! [Re: toneloke]
    #3397312 - 11/23/04 07:39 AM (19 years, 2 months ago)

I used to smoke. I quit awhile back. I don't miss them at all, then again I didn't smoke that much to begin with. I only would smoke about 3 cigs a day.


--------------------

The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.


Extras: Filter Print Post Top
OfflineXbollweevilX
Student
Male User Gallery

Registered: 04/09/06
Posts: 174
Last seen: 11 years, 11 months
Re: Cigarettes! [Re: CaRnAgECaNdY]
    #5712154 - 06/04/06 06:06 PM (17 years, 7 months ago)

It's a love hate relationship.


--------------------
There is no such thing as a civilian.


Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 6 months
Re: Cigarettes! [Re: toneloke]
    #5712206 - 06/04/06 06:20 PM (17 years, 7 months ago)

Christ, I really dislike these polls. How about this?

If you don't smoke, don't vote in the second poll.
Do you smoke cigarettes?
You may choose only one
Do you want to quit smoking as much/entirely?
You may choose only one


Votes accepted from (06/04/06 06:20 PM) to (No end specified)
View the results of this poll | Filter by response



--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Edited by whatever123 (06/04/06 06:21 PM)


Extras: Filter Print Post Top
InvisibleLe_Canard
The Duk Abides

Registered: 05/16/03
Posts: 94,392
Loc: Earthfarm 1 Flag
Re: Cigarettes! [Re: toneloke]
    #5713054 - 06/04/06 10:12 PM (17 years, 7 months ago)

I smoke 'em. Wish I didn't though. I'm hooked like a big dog. :frown:


Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 6 months
Re: Cigarettes! [Re: Le_Canard]
    #5713584 - 06/05/06 12:34 AM (17 years, 7 months ago)

My poll > your poll


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Extras: Filter Print Post Top
OfflinePSylopHiLe
stoner
Male User Gallery

Registered: 06/04/06
Posts: 86
Last seen: 17 years, 1 month
Re: Cigarettes! [Re: whatever123]
    #5743603 - 06/12/06 08:38 PM (17 years, 7 months ago)

I am a former smoker and i have been clean for a month with no desire for a cigarette. All i can say is that it is a nasty, expensive habit.


--------------------
"Try not to let your mind wander, it might not come back"


Extras: Filter Print Post Top
Offlinedeadheadjpc2000
Blade
Male

Registered: 02/27/06
Posts: 1,277
Loc: Emerald Triangle, U.S.A.
Last seen: 15 years, 6 months
Re: Cigarettes! [Re: PSylopHiLe]
    #5745715 - 06/13/06 01:20 PM (17 years, 7 months ago)

And former smokers are the worst...


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Cigarettes! [Re: deadheadjpc2000]
    #5747173 - 06/13/06 08:14 PM (17 years, 7 months ago)

Yeah, that first poll was damn terrible.

How about a "have you ever tried to quit? how the hell did that go?" poll.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineMaverick
Lover of Earwigs!
Male User Gallery

Folding@home Statistics
Registered: 12/18/05
Posts: 13,437
Loc: Valleys of Willamette Flag
Last seen: 19 hours, 8 minutes
Re: Cigarettes! [Re: Koala Koolio]
    #5747176 - 06/13/06 08:15 PM (17 years, 7 months ago)

I finally quit smoking I think. I quit about a week ago. Should I pick it up again? ;P


Extras: Filter Print Post Top
OfflineEkstaza
stranger than most
 User Gallery

Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 9 months, 23 days
Re: Cigarettes! [Re: Maverick]
    #5747651 - 06/13/06 10:19 PM (17 years, 7 months ago)

Let's see, I started smoking at about age 12 and quit for a year when I was in high school. I started back because I wanted to date this chick who smoked. Real DUMB. I smoked from then on(except for 2 months when Uncle Sam had control of it) to the age of about 25 when I used the nicotine lozenges to kick the habit for another year. New Years Eve '03 was a blast. Lots of X and plenty of smokes. Newports go so well with MDMA. It's been off and on since then sometimes making it to the 6 month point only to give in while drunk. At the moment, I'm off of them with every intention of staying quitter. That reminds me, I NEED ANOTHER NICOTINE LOZENGE!

True Story


--------------------
YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.


Extras: Filter Print Post Top
Offlinevintage_gonzo
Stranger

Registered: 04/08/06
Posts: 457
Last seen: 15 years, 11 months
Re: Cigarettes! [Re: Ekstaza]
    #5747670 - 06/13/06 10:24 PM (17 years, 7 months ago)

i smoke cloves. they give a much greater buzz that marlboro lights ever did and taste better


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Cigarettes! [Re: vintage_gonzo]
    #5747908 - 06/13/06 11:37 PM (17 years, 7 months ago)

... and are much worse for you. :smile:


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineIamthewalrus
every evening Idied and everynight I wasreborn
Male User Gallery

Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 15 years, 3 months
Re: Cigarettes! [Re: Koala Koolio]
    #5748780 - 06/14/06 06:33 AM (17 years, 7 months ago)

I smoke but want to quit


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | Next >  [ show all ]

Original Sensible Seeds Shop: Autoflowering Cannabis Seeds, Bulk Cannabis Seeds, Feminized Cannabis Seeds, High THC Strains


Similar ThreadsPosterViewsRepliesLast post
* Smokers: Cigs, Weed, Both, Or None?
( 1 2 all )
Lifenergy 8,408 38 08/01/08 09:32 PM
by NIMH
* Do You Smoke Cigarettes?
( 1 2 all )
EffedS 5,868 30 04/17/04 01:45 AM
by Gumby
* Do you smoke pot?
( 1 2 3 4 all )
TheHateCamel 12,300 64 03/20/07 10:38 AM
by Meedio
* mary-jane
( 1 2 all )
lilbil 3,188 21 05/12/05 09:37 PM
by lilbilski4life
* Who doesn't like marijuana?
( 1 2 3 all )
TODAY 8,028 51 09/24/05 01:15 AM
by mar1juana
* Is Marijuana A Gateway Drug?
( 1 2 3 4 5 all )
Jackal 21,078 81 12/06/12 07:05 PM
by cpw1971
* do you consider yourself a drug addict.
( 1 2 3 all )
ZippoZM 9,536 42 01/16/21 11:05 AM
by Cyonic
* Legalization
( 1 2 3 4 all )
Ravus 15,871 72 04/28/17 06:47 AM
by Churning

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Ythan, Anno, Thor, Link, Seuss, geokills
3,799 topic views. 0 members, 1 guests and 3 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.083 seconds spending 0.056 seconds on 26 queries.