Home | Community | Message Board

MagicBag Grow Bags
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: North Spore Bulk Substrate   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Extract   Myyco.com Isolated Cubensis Liquid Culture For Sale   Original Sensible Seeds Bulk Cannabis Seeds   MagicBag.co Certified Organic All-In-One Grow Bags   Mushroom-Hut Substrate Bags

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineHenry_Halleur
Flatan, notSatan
Registered: 10/23/04
Posts: 87
Last seen: 19 years, 8 days
do strains degenerate?
    #3364300 - 11/15/04 02:07 PM (19 years, 4 months ago)

is it true that a strain degenerates and becomes weaker if you grow from its prints again and again?
how many "generations" does it take to degenerate a strain?

Extras: Filter Print Post Top
Offlinediscman1
journeyman
Registered: 08/24/04
Posts: 962
Last seen: 19 years, 3 months
Re: do strains degenerate? [Re: Henry_Halleur]
    #3364313 - 11/15/04 02:09 PM (19 years, 4 months ago)

No, that doesen't make any sense.

Spores are considered 1st generation, nomatter what.

Extras: Filter Print Post Top
Offlinelesstutrey
All Weather Associate
 User Gallery

Registered: 10/24/04
Posts: 495
Loc: Chicagoland
Last seen: 9 years, 6 months
Re: do strains degenerate? [Re: Henry_Halleur]
    #3364315 - 11/15/04 02:09 PM (19 years, 4 months ago)

i've heard this in pot... with clones, but never with mushrooms.

Extras: Filter Print Post Top
Offlinediscman1
journeyman
Registered: 08/24/04
Posts: 962
Last seen: 19 years, 3 months
Re: do strains degenerate? [Re: lesstutrey]
    #3364339 - 11/15/04 02:13 PM (19 years, 4 months ago)

Quote:

lesstutrey said:
i've heard this in pot... with clones, but never with mushrooms.


Mushroom strains tend to begin degrading if you go beyond 3 generations.

Spores are the beginning, though.. they can't be likened to a clone. The genetic material is new and fresh.

Extras: Filter Print Post Top
Offlinelesstutrey
All Weather Associate
 User Gallery

Registered: 10/24/04
Posts: 495
Loc: Chicagoland
Last seen: 9 years, 6 months
Re: do strains degenerate? [Re: discman1]
    #3364380 - 11/15/04 02:20 PM (19 years, 4 months ago)

so what you're saying is if you clone shrooms flesh it will degrade after 3 or so generations, but it doesn't matter if you collect spores from spore prints from spore prints?

Extras: Filter Print Post Top
OfflineZeroArmy27
I didn't go to work for a month.

Registered: 08/31/04
Posts: 1,169
Loc: Middle of nowhere
Last seen: 6 years, 29 days
Re: do strains degenerate? [Re: discman1]
    #3364390 - 11/15/04 02:22 PM (19 years, 4 months ago)

as opposed to a clone, where you take mycelium or tissue from the inside of the mushroom stipe and let that generate.

i also believe you meant to use degrade instead of degenerate... degenerate isn't a word, is it?

EDIT -
you posted before me, but yeah, you have it.


--------------------
"a monkey would fuck you up if you tried to put it in a autoclave" - Psychoslut

"it's not like the admins and mods are a tight-knit group of hippies that spend their life together in a log cabin tie-dying shirts and stringing beads inbetween bonghits." - Wiccan_Seeker

Edited by ZeroArmy27 (11/15/04 02:22 PM)

Extras: Filter Print Post Top
Offlinediscman1
journeyman
Registered: 08/24/04
Posts: 962
Last seen: 19 years, 3 months
Re: do strains degenerate? [Re: lesstutrey]
    #3364422 - 11/15/04 02:28 PM (19 years, 4 months ago)

Quote:

lesstutrey said:
so what you're saying is if you clone shrooms flesh it will degrade after 3 or so generations, but it doesn't matter if you collect spores from spore prints from spore prints?


Yup.

It couldn't work any other way. Just think of how many spores of spores of spores of... have been produced in the wild? :wink:

Extras: Filter Print Post Top
Offlinerecalcitrant
My Own God

Registered: 04/20/02
Posts: 2,927
Loc: Canada West
Last seen: 7 years, 10 months
Re: do strains degenerate? [Re: ZeroArmy27]
    #3364563 - 11/15/04 02:53 PM (19 years, 4 months ago)

de?gen?er?ate ( P ) Pronunciation Key (d-jnr-t)
adj.
Having declined, as in function or nature, from a former or original state: a degenerate form of an ancient folk art.
Having fallen to an inferior or undesirable state, especially in mental or moral qualities.
Physics. Relating to two or more quantum states that share the same quantum numbers: degenerate energy levels.
Physics. Characterized by great density and consisting of atoms stripped of electrons: degenerate matter.
Medicine. Characterized by degeneration, as of tissue, a cell, or an organ.
Biology. Having lost one or more highly developed functions, characteristics, or structures through evolution: a degenerate life form.
Genetics. Having more than one codon that may code for the same amino acid.

n.
A depraved, corrupt, or vicious person.
A person lacking or having progressively lost normative biological or psychological characteristics.


from dictionary.com


--------------------

We have to answer our own prayers

Extras: Filter Print Post Top
Invisibleryan
Member since 1997
Registered: 03/01/01
Posts: 111
Re: do strains degenerate? [Re: Henry_Halleur]
    #3365554 - 11/15/04 06:05 PM (19 years, 4 months ago)

Quote:

Henry_Halleur said:
is it true that a strain degenerates and becomes weaker if you grow from its prints again and again?
how many "generations" does it take to degenerate a strain?




No, in fact this is how you improve strains. Just make sure to only use prints from the best fruits. Switch substrates or you may generate a sub-strain that is specific for only one substrate.

Extras: Filter Print Post Top
Offlinegbhtrfv
journeyman
Registered: 02/09/04
Posts: 154
Last seen: 17 years, 10 months
Re: do strains degenerate? [Re: ryan]
    #3365821 - 11/15/04 06:53 PM (19 years, 4 months ago)

The only exception that's been reported is with the penis envy strain. It's so degraded that you have to isolate a fruiting substrain or you won't get any fruits at all, even from spores.

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: do strains degenerate? [Re: gbhtrfv]
    #3365998 - 11/15/04 07:29 PM (19 years, 4 months ago)

Right, its definately a degraded strain. Often favored because of the few spores it produces. But, that doesn't mean degradation happens because spores are used. I would think that if anything, spore mating would be on the right track to a healthier strain. But of course, like you said, you need to isolate the right ones. There are non fruiting substrains for any strain... much more likely for this particullar.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
OfflineHenry_Halleur
Flatan, notSatan
Registered: 10/23/04
Posts: 87
Last seen: 19 years, 8 days
Re: do strains degenerate? [Re: Koala Koolio]
    #3367946 - 11/16/04 08:26 AM (19 years, 4 months ago)

sorry for the wrong word.
english is not my mother-tongue  :muppet:

Extras: Filter Print Post Top
OfflinePhynatikus
Psychonaught

Registered: 10/11/03
Posts: 154
Last seen: 13 years, 1 month
Re: do strains degenerate? [Re: ZeroArmy27]
    #3367996 - 11/16/04 08:42 AM (19 years, 4 months ago)

Quote:

ZeroArmy27 said:
i also believe you meant to use degrade instead of degenerate... degenerate isn't a word, is it?




Yea it is, my mom used to call me a degenerate all the time...

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: North Spore Bulk Substrate   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Extract   Myyco.com Isolated Cubensis Liquid Culture For Sale   Original Sensible Seeds Bulk Cannabis Seeds   MagicBag.co Certified Organic All-In-One Grow Bags   Mushroom-Hut Substrate Bags


Similar ThreadsPosterViewsRepliesLast post
* P Strain Not pinning strain 3,308 6 03/25/02 08:23 AM
by GaNjAShRooM
* What to do with these P strain cakes/casings? strain 2,341 1 04/20/02 04:08 PM
by World Spirit
* Less water = GOOD! How our character pasteurizes. keyeghost 700 4 10/11/02 11:18 PM
by keyeghost
* New Cubensis Strains? More like Vendor hype!
( 1 2 3 all )
Zen Peddler 7,866 42 04/17/11 03:50 PM
by mister
* mazapatec strain question newBforlife 2,650 14 06/25/10 09:53 AM
by felipero
* best strain? Broadway 30,470 18 02/09/12 01:52 PM
by Prisoner#1
* STRAIN DESCRIPTION ie the hawks eye psilocybong 9,703 15 04/10/04 12:08 PM
by llamaherder
* Strains
( 1 2 all )
godson 13,709 27 08/04/16 11:41 PM
by 555

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Shroomism, george castanza, RogerRabbit, veggie, mushboy, fahtster, LogicaL Chaos, 13shrooms, Stipe-n Cap, Pastywhyte, bodhisatta, Tormato, Land Trout, A.k.a
841 topic views. 21 members, 101 guests and 133 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.027 seconds spending 0.01 seconds on 14 queries.