|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Henry_Halleur
Flatan, notSatan
Registered: 10/23/04
Posts: 87
Last seen: 19 years, 8 days
|
do strains degenerate?
#3364300 - 11/15/04 02:07 PM (19 years, 4 months ago) |
|
|
is it true that a strain degenerates and becomes weaker if you grow from its prints again and again? how many "generations" does it take to degenerate a strain?
|
discman1
journeyman
Registered: 08/24/04
Posts: 962
Last seen: 19 years, 3 months
|
|
No, that doesen't make any sense.
Spores are considered 1st generation, nomatter what.
|
lesstutrey
All Weather Associate
Registered: 10/24/04
Posts: 495
Loc: Chicagoland
Last seen: 9 years, 6 months
|
|
i've heard this in pot... with clones, but never with mushrooms.
|
discman1
journeyman
Registered: 08/24/04
Posts: 962
Last seen: 19 years, 3 months
|
Re: do strains degenerate? [Re: lesstutrey]
#3364339 - 11/15/04 02:13 PM (19 years, 4 months ago) |
|
|
Quote:
lesstutrey said: i've heard this in pot... with clones, but never with mushrooms.
Mushroom strains tend to begin degrading if you go beyond 3 generations.
Spores are the beginning, though.. they can't be likened to a clone. The genetic material is new and fresh.
|
lesstutrey
All Weather Associate
Registered: 10/24/04
Posts: 495
Loc: Chicagoland
Last seen: 9 years, 6 months
|
Re: do strains degenerate? [Re: discman1]
#3364380 - 11/15/04 02:20 PM (19 years, 4 months ago) |
|
|
so what you're saying is if you clone shrooms flesh it will degrade after 3 or so generations, but it doesn't matter if you collect spores from spore prints from spore prints?
|
ZeroArmy27
I didn't go to work for a month.
Registered: 08/31/04
Posts: 1,169
Loc: Middle of nowhere
Last seen: 6 years, 29 days
|
Re: do strains degenerate? [Re: discman1]
#3364390 - 11/15/04 02:22 PM (19 years, 4 months ago) |
|
|
as opposed to a clone, where you take mycelium or tissue from the inside of the mushroom stipe and let that generate. i also believe you meant to use degrade instead of degenerate... degenerate isn't a word, is it? EDIT - you posted before me, but yeah, you have it.
-------------------- "a monkey would fuck you up if you tried to put it in a autoclave" - Psychoslut "it's not like the admins and mods are a tight-knit group of hippies that spend their life together in a log cabin tie-dying shirts and stringing beads inbetween bonghits." - Wiccan_Seeker
Edited by ZeroArmy27 (11/15/04 02:22 PM)
|
discman1
journeyman
Registered: 08/24/04
Posts: 962
Last seen: 19 years, 3 months
|
Re: do strains degenerate? [Re: lesstutrey]
#3364422 - 11/15/04 02:28 PM (19 years, 4 months ago) |
|
|
Quote:
lesstutrey said: so what you're saying is if you clone shrooms flesh it will degrade after 3 or so generations, but it doesn't matter if you collect spores from spore prints from spore prints?
Yup.
It couldn't work any other way. Just think of how many spores of spores of spores of... have been produced in the wild?
|
recalcitrant
My Own God
Registered: 04/20/02
Posts: 2,927
Loc: Canada West
Last seen: 7 years, 10 months
|
Re: do strains degenerate? [Re: ZeroArmy27]
#3364563 - 11/15/04 02:53 PM (19 years, 4 months ago) |
|
|
de?gen?er?ate ( P ) Pronunciation Key (d-jnr-t) adj. Having declined, as in function or nature, from a former or original state: a degenerate form of an ancient folk art. Having fallen to an inferior or undesirable state, especially in mental or moral qualities. Physics. Relating to two or more quantum states that share the same quantum numbers: degenerate energy levels. Physics. Characterized by great density and consisting of atoms stripped of electrons: degenerate matter. Medicine. Characterized by degeneration, as of tissue, a cell, or an organ. Biology. Having lost one or more highly developed functions, characteristics, or structures through evolution: a degenerate life form. Genetics. Having more than one codon that may code for the same amino acid.
n. A depraved, corrupt, or vicious person. A person lacking or having progressively lost normative biological or psychological characteristics.
from dictionary.com
-------------------- We have to answer our own prayers
|
ryan
Member since 1997
Registered: 03/01/01
Posts: 111
|
|
Quote:
Henry_Halleur said: is it true that a strain degenerates and becomes weaker if you grow from its prints again and again? how many "generations" does it take to degenerate a strain?
No, in fact this is how you improve strains. Just make sure to only use prints from the best fruits. Switch substrates or you may generate a sub-strain that is specific for only one substrate.
|
gbhtrfv
journeyman
Registered: 02/09/04
Posts: 154
Last seen: 17 years, 10 months
|
Re: do strains degenerate? [Re: ryan]
#3365821 - 11/15/04 06:53 PM (19 years, 4 months ago) |
|
|
The only exception that's been reported is with the penis envy strain. It's so degraded that you have to isolate a fruiting substrain or you won't get any fruits at all, even from spores.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: do strains degenerate? [Re: gbhtrfv]
#3365998 - 11/15/04 07:29 PM (19 years, 4 months ago) |
|
|
Right, its definately a degraded strain. Often favored because of the few spores it produces. But, that doesn't mean degradation happens because spores are used. I would think that if anything, spore mating would be on the right track to a healthier strain. But of course, like you said, you need to isolate the right ones. There are non fruiting substrains for any strain... much more likely for this particullar.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Henry_Halleur
Flatan, notSatan
Registered: 10/23/04
Posts: 87
Last seen: 19 years, 8 days
|
|
sorry for the wrong word. english is not my mother-tongue
|
Phynatikus
Psychonaught
Registered: 10/11/03
Posts: 154
Last seen: 13 years, 1 month
|
Re: do strains degenerate? [Re: ZeroArmy27]
#3367996 - 11/16/04 08:42 AM (19 years, 4 months ago) |
|
|
Quote:
ZeroArmy27 said: i also believe you meant to use degrade instead of degenerate... degenerate isn't a word, is it?
Yea it is, my mom used to call me a degenerate all the time...
|
|