Home | Community | Message Board


Everything Mushrooms
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop: San Pedro

Jump to first unread post. Pages: 1 | 2 | Next >  [ show all ]
Invisibleadoseofparn0z
Eye Opener
 User Gallery

Registered: 10/13/03
Posts: 820
Need Help With Identifying San Pedro Related Cactii *DELETED*
    #3338318 - 11/09/04 07:11 PM (12 years, 8 months ago)

Post deleted by adoseofparn0z

Reason for deletion: Old post.



--------------------
For a reliable vendor with high quality merchandise at a great price, try BBB


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Need Help With Identifying San Pedro Related Cactii [Re: adoseofparn0z]
    #3338325 - 11/09/04 07:13 PM (12 years, 8 months ago)

looks like a bridgsii if its a trich.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleHanky
wiffle bat.
Male User Gallery
Registered: 08/30/03
Posts: 56,993
Loc: Great Southern Land.
Re: Need Help With Identifying San Pedro Related Cactii [Re: Koala Koolio]
    #3338388 - 11/09/04 07:29 PM (12 years, 8 months ago)

Myrtillocactus geometrizans.


Edited by hanky (11/09/04 07:32 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineGr0wer
always improving
Male

Registered: 09/16/03
Posts: 5,998
Loc: El Paso, TX
Last seen: 11 hours, 12 minutes
Re: Need Help With Identifying San Pedro Related Cactii [Re: Hanky]
    #3338442 - 11/09/04 07:45 PM (12 years, 8 months ago)

It looks to be montsrose too.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineneuro
Phytophiliac
 User Gallery

Registered: 08/11/99
Posts: 6,617
Loc: Rigel 7
Last seen: 7 months, 18 days
Re: Need Help With Identifying San Pedro Related Cactii [Re: Gr0wer]
    #3338462 - 11/09/04 07:50 PM (12 years, 8 months ago)

>>It looks to be montsrose too.

Why do you say that?


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblezee_werp
a fractalcreature
 User Gallery

Registered: 03/25/03
Posts: 1,026
Loc: Aotearoa
Re: Need Help With Identifying San Pedro Related Cactii [Re: neuro]
    #3338677 - 11/09/04 08:49 PM (12 years, 8 months ago)

Yeah, doesn't look monstrose at all to me.

I agree with the Myrtillocactus geometrizans ID...not related to San Pedro at all (well, maybe distantly, but its not a trichocereus). I'm pretty sure those things don't contain any active alkaloids, certainly not mescaline. They look cool though (I like their blue tinge) and they make excellent graft stock for petote or other slow growing cacti.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineGr0wer
always improving
Male

Registered: 09/16/03
Posts: 5,998
Loc: El Paso, TX Flag
Last seen: 11 hours, 12 minutes
Re: Need Help With Identifying San Pedro Related Cactii [Re: zee_werp]
    #3338725 - 11/09/04 09:00 PM (12 years, 8 months ago)

excessive puping. One pup is coming out right next to the tip.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineHooty
Reality isRelative

Registered: 02/24/03
Posts: 2,467
Last seen: 6 years, 2 months
Re: Need Help With Identifying San Pedro Related Cactii [Re: Gr0wer]
    #3339077 - 11/09/04 10:47 PM (12 years, 8 months ago)

I wouldn't call that exciessive.


--------------------


Without love in the dream
It will never come true


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleHanky
wiffle bat.
Male User Gallery
Registered: 08/30/03
Posts: 56,993
Loc: Great Southern Land.
Re: Need Help With Identifying San Pedro Related Cactii [Re: Hooty]
    #3340010 - 11/10/04 04:46 AM (12 years, 8 months ago)

This is my cereus peruvians monstrose,thats what i call excessive haha.



--------------------
Coaster is an idiot...
[quote]Coaster said:
but i thnk everything thats pure is white?
[/quote]




Post Extras: Print Post  Remind Me! Notify Moderator
Offlinefaslimy
Dead Man
 User Gallery
Registered: 04/04/04
Posts: 3,436
Last seen: 1 year, 6 months
Re: Need Help With Identifying San Pedro Related Cactii [Re: Hanky]
    #3340177 - 11/10/04 06:18 AM (12 years, 8 months ago)

I swear hanky thats not a cereus, it sooo looks like a myrtillocactus montrose. its beautiful though, i've seen pics of large ones looking wicked

heres a euphorbia i have pupping like mad



Edited by faslimy (11/10/04 06:24 AM)


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleHanky
wiffle bat.
Male User Gallery
Registered: 08/30/03
Posts: 56,993
Loc: Great Southern Land.
Re: Need Help With Identifying San Pedro Related Cactii [Re: faslimy]
    #3340181 - 11/10/04 06:28 AM (12 years, 8 months ago)

Cereus peruvianus 'Monstrose'

Cristated Forms, less common. Cristation is the most extreme form of mutation and instead of growing from a central point the plant grows along a ridge with some parts producing normal growth.

http://www.maccactus.com/cereus%20peruvianus%20monstrose.html

http://www.columnar-cacti.org/cereus/c_peruvianus_monstrose.jpg

I know what my cactus is.


--------------------
Coaster is an idiot...
[quote]Coaster said:
but i thnk everything thats pure is white?
[/quote]




Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleHanky
wiffle bat.
Male User Gallery
Registered: 08/30/03
Posts: 56,993
Loc: Great Southern Land.
Re: Need Help With Identifying San Pedro Related Cactii [Re: Hanky]
    #3340187 - 11/10/04 06:33 AM (12 years, 8 months ago)

Ps. That euphorbia is beautiful. :thumbup:


--------------------
Coaster is an idiot...
[quote]Coaster said:
but i thnk everything thats pure is white?
[/quote]




Post Extras: Print Post  Remind Me! Notify Moderator
Offlinekadakuda
The Great"Green".......East
 User Gallery

Registered: 05/21/04
Posts: 7,048
Loc: Asia
Last seen: 11 months, 1 day
Re: Need Help With Identifying San Pedro Related Cactii [Re: Hanky]
    #3340200 - 11/10/04 06:47 AM (12 years, 8 months ago)

i dunno it does look myrto like, but then cerus peruv. has liek a billion faces so i dont even bother trying anymore. the only ones i keep now are my cristates, they are so cool looking.

and i agree that euphorbia is pretty sweet. and so is that monstrous! i really wish i kept my cacti collection, kickin myself everyday.


--------------------
The seeds you won't sow are the plants you dont grow.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinefaslimy
Dead Man
 User Gallery
Registered: 04/04/04
Posts: 3,436
Last seen: 1 year, 6 months
Re: Need Help With Identifying San Pedro Related Cactii [Re: kadakuda]
    #3340218 - 11/10/04 06:57 AM (12 years, 8 months ago)




see the resemblance?


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAelph
Playing in thedirt again

Registered: 05/31/04
Posts: 122
Loc: Metro Hotlanta
Last seen: 12 years, 6 months
Re: Need Help With Identifying San Pedro Related Cactii [Re: adoseofparn0z]
    #3340250 - 11/10/04 07:17 AM (12 years, 8 months ago)

I agree... it is a Myrtillocactus geometrizans. I have some Myrtillos and there is no way you can confuse them with a Trichocereus.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinekadakuda
The Great"Green".......East
 User Gallery

Registered: 05/21/04
Posts: 7,048
Loc: Asia
Last seen: 11 months, 1 day
Re: Need Help With Identifying San Pedro Related Cactii [Re: faslimy]
    #3340265 - 11/10/04 07:23 AM (12 years, 8 months ago)

y ai agree. those spines look way diff tean the peruvians ive seen, but everyday it seems i see a new look of them. they are crazy variable. but coitenly does look myrto like.

either way im impressed...its a beaut.


--------------------
The seeds you won't sow are the plants you dont grow.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleLifenergy
Yo Mama

Registered: 08/05/04
Posts: 766
Re: Need Help With Identifying San Pedro Related Cactii [Re: kadakuda]
    #3340411 - 11/10/04 08:47 AM (12 years, 8 months ago)

He didn't say it was a Trichocereus, he said it's a Cereus Peruvianus. Big difference.


--------------------
Everything that we see is a shadow cast by that which we do not see.


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblezee_werp
a fractalcreature
 User Gallery

Registered: 03/25/03
Posts: 1,026
Loc: Aotearoa
Re: Need Help With Identifying San Pedro Related Cactii [Re: Lifenergy]
    #3340557 - 11/10/04 10:06 AM (12 years, 8 months ago)

Not that big of a difference really. The spine sets of Cereus peruvianus and Trichocereus peruvianus do look very similar, the main obvious difference between the two seems to be rib shape (when it comes to appearance anyway :wink:) Hankys monstrose does look like Myrtillocactus, but I guess I wouldn't put money on it not being a cereus of some description. We'd need a closer look at the spines for a more accurate ID I reckon. Whatever it is though Hanky, its a fucking cool looking cactus!


Post Extras: Print Post  Remind Me! Notify Moderator
InvisiblePsilostylin
Captain Save Em'
Registered: 03/13/04
Posts: 678
Loc: New Orleans!
Re: Need Help With Identifying San Pedro Related Cactii [Re: zee_werp]
    #3347717 - 11/11/04 06:14 PM (12 years, 8 months ago)

i would have to agree with hanky and say that it is a myrtillocactus geometrizans....i have one just like it at home...though it's not pupping as much. i'm about 97% sure that's what it is.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinekadakuda
The Great"Green".......East
 User Gallery

Registered: 05/21/04
Posts: 7,048
Loc: Asia
Last seen: 11 months, 1 day
Re: Need Help With Identifying San Pedro Related Cactii [Re: Lifenergy]
    #3348401 - 11/11/04 09:03 PM (12 years, 8 months ago)

cereus is what i was refering too. sorry, bad typo.

i dont and never have grown or even seen, in real life, a peruvian trich.


--------------------
The seeds you won't sow are the plants you dont grow.


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1 | 2 | Next >  [ show all ]

Amazon Shop: San Pedro

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Similar ThreadsPosterViewsRepliesLast post
* Identifying San Pedro (pics) Hooty 2,434 15 07/30/11 06:30 PM
by Karl Okane
* identifying san pedro cactus. LoveForGrowth 4,563 1 02/01/04 05:12 PM
by AJ420
* san pedro recalcitrant 890 4 01/06/04 05:51 AM
by felixhigh
* So I'm growing a San Pedro cactus... InTheFade 1,474 14 12/19/05 01:24 AM
by Hooty
* San pedro SurCal 753 8 06/30/07 02:17 PM
by durban_poison
* San Pedro Cacti Pic *DELETED* Rappenstein 582 5 01/28/08 01:02 AM
by casgoodie
* Growing Caapi,San Pedro,and Salvia *DELETED* shroom_me 771 4 10/22/06 07:25 AM
by CptnGarden
* san pedro dosage question *DELETED* blacksabbathrulz 1,278 10 01/16/04 03:53 PM
by EvilGir

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless
3,375 topic views. 3 members, 9 guests and 6 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
Edabea
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.025 seconds spending 0.003 seconds on 18 queries.