Home | Community | Message Board


Myco Supply
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Original Seeds Store Shop: Cannabis Seeds

Jump to first unread post. Pages: 1
Offlinerockstafarian
unsui

Registered: 08/22/03
Posts: 165
Last seen: 11 years, 10 months
lophora seed legality
    #3319688 - 11/04/04 02:20 PM (12 years, 7 months ago)

Are lophora williamsi seeds illegal in the U.S.? I was considering ordering some online to be mailed here from overeas. Thanks


--------------------
^ Above post is complete fiction. ^


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblegdman
badger, badger,badger...
Male User Gallery

Registered: 12/10/02
Posts: 16,286
Loc: Dancing In the Streets
Re: lophora seed legality [Re: rockstafarian]
    #3319704 - 11/04/04 02:24 PM (12 years, 7 months ago)

I think they are illegal, but they are so small...


--------------------


Got a question about a substance?  Erowid might already have your answer! Have questions about the  mushroom experience? The  Tripper's FAQ may have your answer or someone else might have had your question before.
         
I know up on the top you are seeing great sights, but down at the bottom we, too, should have rights.
  - Theodor Seuss Geisel Dr. Suess

"I didn't come here to be easily understood" - Steve


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleLifenergy
Yo Mama

Registered: 08/05/04
Posts: 766
Re: lophora seed legality [Re: gdman]
    #3319712 - 11/04/04 02:27 PM (12 years, 7 months ago)

Yes they are illegal in the USA. That doesn't mean they couldn't just be labeled as some other seed and then sent. Cacti seeds are near impossible to differentiate.


--------------------
Everything that we see is a shadow cast by that which we do not see.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinerockstafarian
unsui

Registered: 08/22/03
Posts: 165
Last seen: 11 years, 10 months
Re: lophora seed legality [Re: Lifenergy]
    #3319729 - 11/04/04 02:29 PM (12 years, 7 months ago)

i see what your saying lifenergy, but i cant exactly request a vendor to mislabel their product. any suggestions or good williamsi seed vendors?


--------------------
^ Above post is complete fiction. ^


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineDMTelepath
Nut

Registered: 10/29/04
Posts: 567
Loc: States of America
Last seen: 12 years, 4 months
Re: lophora seed legality [Re: rockstafarian]
    #3319761 - 11/04/04 02:35 PM (12 years, 7 months ago)

I bet that some vendors would send your some lophophora seeds, you'd just have to ask around, vendor to vendor (email them).


--------------------
Me, Myself, and GOD


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinetheocean06
Yeah, I've donefour already...

Registered: 07/10/04
Posts: 1,458
Last seen: 5 years, 11 months
Re: lophora seed legality [Re: rockstafarian]
    #3319790 - 11/04/04 02:41 PM (12 years, 7 months ago)

I could suggest one, along with the vendors

I Think We've all had our chances to take advantage


--------------------


The story of life is quicker then the blink of an eye, the story of love is hello, goodbye.            - Hendrix :bow:


Edited by neuro (11/04/04 11:27 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleStonehenge
Alt Center
Male User Gallery
Registered: 06/20/04
Posts: 11,256
Loc: S.E.
Re: lophora seed legality [Re: theocean06]
    #3319879 - 11/04/04 03:01 PM (12 years, 7 months ago)

Customs has never bothered anything I've gotten yet. If it's a pound or less they don't seem to care.


--------------------
“A democracy cannot exist as a permanent form of government. It can only exist until the voters discover that they can vote themselves largesse from the public treasury. From that moment on, the majority always votes for the candidates promising the most benefits from the public treasury with the result that a democracy always collapses over loose fiscal policy, always followed by a dictatorship.” (attributed to Alexis de Tocqueville political philosopher Circa 1835)

Trade list http://www.shroomery.org/forums/showflat.php/Number/18047755


Edited by neuro (11/04/04 11:26 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflinePsilopleix
Extended Symbol

Registered: 11/03/03
Posts: 455
Loc: aridzone1
Last seen: 4 years, 4 months
Re: lophora seed legality [Re: theocean06]
    #3320017 - 11/04/04 03:36 PM (12 years, 7 months ago)

thats a good site ocean, i may just have to try them.  :thumbup:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisiblePsychoslut
The Mother Fucking Bear-o-dactyl
 User Gallery
Registered: 12/10/02
Posts: 20,807
Loc: all up in ya
Re: lophora seed legality [Re: theocean06]
    #3320185 - 11/04/04 04:15 PM (12 years, 7 months ago)

Quote:

theocean06 said:
I could suggest one, along with the vendors




will they ship to the united states without any questions?


--------------------



[quote]KristiMidocean said:
Good now thats clear.WHO FUCKING CARES. If I am fat u all keep pointing it out like its suppose to be a secret.LIke u really have nothing better to do then make fat jokes. If o know its like I do I know yall can come up with NEW AND BETTER SHIT . This shit is old and boring . I left in the first place cause this shit got boring not because of the fat jokes . Fat jokes dont bother me but seriously its old[/quote]


Edited by neuro (11/04/04 11:30 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinerockstafarian
unsui

Registered: 08/22/03
Posts: 165
Last seen: 11 years, 10 months
Re: lophora seed legality [Re: Psychoslut]
    #3320202 - 11/04/04 04:19 PM (12 years, 7 months ago)

they just did for me


--------------------
^ Above post is complete fiction. ^


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinetheocean06
Yeah, I've donefour already...

Registered: 07/10/04
Posts: 1,458
Last seen: 5 years, 11 months
Re: lophora seed legality [Re: Psychoslut]
    #3320269 - 11/04/04 04:35 PM (12 years, 7 months ago)

Yup, they ship to the United States.

...Discreet Shipping...


--------------------


The story of life is quicker then the blink of an eye, the story of love is hello, goodbye.            - Hendrix :bow:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: lophora seed legality [Re: theocean06]
    #3320322 - 11/04/04 04:55 PM (12 years, 7 months ago)

It always bothers me when people post sources like this great vendor (once on ebay, now not allowed because ebay sucks) and things they ship and where, etc on a public message board. Sometimes I wonder if I'm just a selfish asshole, or if it really is reasonable? I realize that they are where its legal, but its still raising attention to sources publically.

What do you guys think? In my defense I think vendors such as this are among the better out there, and feel the need to keep them somewhat protected. After all, myself and many others have found site like this without direct public direction (aka, not a PM) but, not trying to complain, just wondering what you think.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinetheocean06
Yeah, I've donefour already...

Registered: 07/10/04
Posts: 1,458
Last seen: 5 years, 11 months
Re: lophora seed legality [Re: Koala Koolio]
    #3320374 - 11/04/04 05:07 PM (12 years, 7 months ago)

I was thinking the same thing, but you know what? In the end, their customers do the advertising. I'm helping them out by giving them business, and in the end that is what keeps them running so in the future I can purchase something from them again if I want. That is of course just the way I feel about it.


--------------------


The story of life is quicker then the blink of an eye, the story of love is hello, goodbye.            - Hendrix :bow:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: lophora seed legality [Re: theocean06]
    #3320950 - 11/04/04 07:25 PM (12 years, 7 months ago)

I guess thats true. But, more so before they had their new website and relied on ebay.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineEkstaza
stranger thanmost
 User Gallery

Registered: 04/11/03
Posts: 4,317
Loc: Around the corner
Last seen: 23 days, 19 hours
Re: lophora seed legality [Re: theocean06]
    #3320956 - 11/04/04 07:27 PM (12 years, 7 months ago)

Yeah, but when the pigs that lurk here at the shroomery learn about the really cool vendor that is sending illegal seeds to the USA, they are going to take note. This is how things get started. Then they escalate to problems for the vendor who in turn must stop supplying US customers. :thumbdown:


--------------------
YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinetheocean06
Yeah, I've donefour already...

Registered: 07/10/04
Posts: 1,458
Last seen: 5 years, 11 months
Re: lophora seed legality [Re: Ekstaza]
    #3321113 - 11/04/04 08:03 PM (12 years, 7 months ago)

Yeah I see what your talking about...I'm going to have to keep that in mind in the future and PM people the link instead of posting it in a thread.  It's too bad that you can't even post a link to a site without getting all paranoid that the DEA is taking notes :frown:


--------------------


The story of life is quicker then the blink of an eye, the story of love is hello, goodbye.            - Hendrix :bow:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleLifenergy
Yo Mama

Registered: 08/05/04
Posts: 766
Re: lophora seed legality [Re: theocean06]
    #3321260 - 11/04/04 08:34 PM (12 years, 7 months ago)

Yeah. The really really sad thing is...they probably are. :whatever:


--------------------
Everything that we see is a shadow cast by that which we do not see.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: lophora seed legality [Re: Lifenergy]
    #3321937 - 11/04/04 10:54 PM (12 years, 7 months ago)

its a very popular site here


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Original Seeds Store Shop: Cannabis Seeds

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Similar ThreadsPosterViewsRepliesLast post
* Opium Poppy Seeds...legality mikemushroom 2,032 6 08/24/16 09:00 AM
by extrajordanary
* Lophophora seeds legal in Germany? mycophyle 881 6 08/09/07 12:00 AM
by kadakuda
* pot seed, legal or not in toronto Anonymous 647 1 08/20/03 11:46 PM
by EnlightenedFreak
* Salvia seeds? Best Vendors dannycorona82 860 11 04/05/03 02:08 PM
by dannycorona82
* Envelope seed stealth method... Starter 4,388 7 05/29/04 02:14 PM
by Locus
* Legality of growing and selling poppies kybish 2,175 19 05/02/08 09:38 PM
by sturmer88
* Seeds in the mail reite 943 5 07/22/02 09:19 AM
by Dante606
* Legal Psychoactive plants in US/Canada
( 1 2 all )
fridaynights 25,879 36 02/15/15 09:46 PM
by gardenstate

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless
943 topic views. 3 members, 28 guests and 4 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
Crestline Sales - MycoPath
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.041 seconds spending 0.007 seconds on 19 queries.