

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!
|
felixhigh
KIA


Registered: 06/24/01
Posts: 7,543
Loc: Ly
Last seen: 4 years, 10 months
|
Papaver somniferum - black seed >>> which strain??
#3234755 - 10/08/04 11:38 PM (13 years, 6 months ago) |
|
|
hi folks, i've been looking around my seed collection and these black papaver seeds have called my attention since they're usually in tones of gray or even blueish. does anybody has idea of what variety can it be?
FH
|
Stonehenge
Alt Center

Registered: 06/20/04
Posts: 14,337
Loc: S.E.
|
Re: Papaver somniferum - black seed >>> which stra [Re: felixhigh]
#3236283 - 10/09/04 01:57 PM (13 years, 6 months ago) |
|
|
Sounds like hens and chicks. They are mostly black though some should be dark blue or lighter colors. H+C are a good strain, I plan to grow some this fall. Does it get cool enough where you are to grow poppies?
-------------------- “A democracy cannot exist as a permanent form of government. It can only exist until the voters discover that they can vote themselves largesse from the public treasury. From that moment on, the majority always votes for the candidates promising the most benefits from the public treasury with the result that a democracy always collapses over loose fiscal policy, always followed by a dictatorship.” (attributed to Alexis de Tocqueville political philosopher Circa 1835)
Trade list http://www.shroomery.org/forums/showflat.php/Number/18047755
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: Papaver somniferum - black seed >>> which stra [Re: Stonehenge]
#3236421 - 10/09/04 03:04 PM (13 years, 6 months ago) |
|
|
I'm familliar with the more blue ones. But, after opening a bunch of giganthemum pods the seeds that I got were fairly black, in addition to many greyer ones which could be considered blueish. Also a good amount of very tiny brown specs. What are these.. undeveloped seeds?
Either way, I don't know how much luck you'll have identifying the strain by seeds, but good luck.
btw, those seeds are up for grabs in the thread at the top of this forum.
|
felixhigh
KIA


Registered: 06/24/01
Posts: 7,543
Loc: Ly
Last seen: 4 years, 10 months
|
Re: Papaver somniferum - black seed >>> w [Re: felixhigh]
#3236518 - 10/09/04 03:32 PM (13 years, 6 months ago) |
|
|
strange, i have some H&C and they're mostly brown... but i'm not saying it can't be. HC also has the tiniest papaver seeds i've ever seen... oh well, lets see what comes out of it! =)
i've planted some hyoscyamus niger (henbane) too! >=] hope they all pick...
FH
|
Locus



Registered: 03/11/04
Posts: 6,103
Loc: ny/europe/other
Last seen: 5 months, 10 days
|
Re: Papaver somniferum - black seed >>> w [Re: felixhigh]
#3236634 - 10/09/04 04:33 PM (13 years, 6 months ago) |
|
|
I've gotten all different shades of black and blue just from giganteums.
--------------------
The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe
~~~*Dosis sola facit venenum*~~~
*Check my profile to listen to my music*
|
felixhigh
KIA


Registered: 06/24/01
Posts: 7,543
Loc: Ly
Last seen: 4 years, 10 months
|
Re: Papaver somniferum - black seed >&g [Re: Locus]
#3236795 - 10/09/04 05:13 PM (13 years, 6 months ago) |
|
|
they're uniformly black! strictly black!
FH
|
Psilocybeingzz


Registered: 12/15/02
Posts: 14,463
Loc: International waters
Last seen: 5 years, 5 months
|
Re: Papaver somniferum - black seed >&a [Re: felixhigh]
#3236808 - 10/09/04 05:19 PM (13 years, 6 months ago) |
|
|
I think they might be Nigrum
I have some, and they are black.
Here is some infor on them....
" Its pods are more oval-shaped, smaller, and darker than those of other varieties. Openings in the pod allow the seeds to be removed without any drilling or breaking. Another advantage of this plant is that because it is less domesticated, it is hardier than the other varieties. That means that the whole plant also looks weedier."
(they could also be Peonys etc etc..grow some and show us the flowers, then I can tell you )
Psilo
Edited by Psilocybeingzz (10/09/04 05:21 PM)
| |
|
|
You cannot start new topics / You cannot reply to topics HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless 704 topic views. 7 members, 15 guests and 2 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
| | |
|
|
|