Home | Community | Message Board

Magic-Mushrooms-Shop.com
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinethegnomeking
friendly stoner

Registered: 07/05/04
Posts: 237
Loc: New Jersey
Last seen: 11 years, 16 days
How long does LSD stay good for?
    #3223015 - 10/06/04 01:48 PM (19 years, 5 months ago)

I'm really exited. yesterday I ran into an old friend I haven't seen for months hangin out at another friends house, he told me that over the summer, somewhere around july, he had aquired a decent amount of acid, and had been selling it for a period of time, he happened to have 4 hits left he had been saving in an altoids case, it took a little bit of convincing but I got him to do a little trade with me for 2 of them. He told me they were pretty mild, like 1 might give me a nice strong buzz and 2 would get me pretty good, my other friend who was there said he had taken one back in like the beginning of august and had a real nice time, but neither of them had taken any of them since August, so I wanted to know, how long does LSD stay good for before it starts losing it's potency, I tried to look for this information on erowid but I really couldn't find it, I really just wanna know whether or not I'm going to be disapointed or not. I mean I know this kid doesn't bullshit about such things and even if he was bullshitten me, he doesn't stand to gain much since I basically got them for free almost. I'm pretty exited though since the last time I had it I was in the 9th grade, and it was really shitty, like it took 3 hits just to get threshold effects. These hits though, are all white exept for a faint thin black line around the edges almost completly cut off on one of them and they look pretty small too, like a half centimeter squares. I'll probably be taking them either tonight or friday I'm not sure yet, but if anybody could help me out with this info that'd be great.  :zoom:


--------------------
1.Thou shalt not alter the consciousness of thy fellow man.
2.Thou shalt not prevent thy fellow man from altering his own consciousness.
-Timothy Leary

Extras: Filter Print Post Top
OfflinePsyclops
liberty hunter
 User Gallery

Registered: 11/14/03
Posts: 83
Last seen: 10 years, 9 months
Re: How long does LSD stay good for? [Re: thegnomeking]
    #3223424 - 10/06/04 03:50 PM (19 years, 5 months ago)

as long as you keep it in a cool dark place it shouldnt degrade much at all

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: How long does LSD stay good for? [Re: thegnomeking]
    #3223552 - 10/06/04 04:18 PM (19 years, 5 months ago)

Half a centimeter is almost a quarter inch, which is standard size. That sounds fine. And yeah, keep it cool and dark and it should last for a while. That doesn't mean forever though, it will definately lose some potency over time.

Extras: Filter Print Post Top
Offlinethegnomeking
friendly stoner

Registered: 07/05/04
Posts: 237
Loc: New Jersey
Last seen: 11 years, 16 days
Re: How long does LSD stay good for? [Re: thegnomeking]
    #3223599 - 10/06/04 04:30 PM (19 years, 5 months ago)

do you know how much time?


--------------------
1.Thou shalt not alter the consciousness of thy fellow man.
2.Thou shalt not prevent thy fellow man from altering his own consciousness.
-Timothy Leary

Extras: Filter Print Post Top
OfflineRuNE
bomberman

Folding@home Statistics
Registered: 09/23/00
Posts: 2,331
Loc: tartarus
Last seen: 8 years, 1 month
Re: How long does LSD stay good for? [Re: thegnomeking]
    #3225220 - 10/06/04 10:19 PM (19 years, 5 months ago)


If they were good in august, they should still be good, especialy if he kept them in that altoids case.

The best storage is no air, no light, no heat.
This usualy means tightly wrapped in seran wrap, aluminum foil, in a ziplock baggie in the freezer.  Or the seran+aluminum between the pages of a thick book in the shade.  This will make it last for years.

Hope you have a good trip.  :thumbup:


:sun:


--------------------
~Happy sailing~

Extras: Filter Print Post Top
Offlinebendychicken
Stranger
Male User Gallery


Registered: 12/22/10
Posts: 246
Loc: Central Florida Flag
Last seen: 1 year, 5 months
Re: How long does LSD stay good for? [Re: RuNE]
    #15341647 - 11/08/11 07:55 PM (12 years, 4 months ago)

I know a guy who just took 2 hits of paper that have been in a cool/dry/dark place for over 2 years and tripped his nuts off......

He had taken the same amount from the same strip 2 years earlier with the same results. Based on his experience, it would seem LSD degrades very little if kept cool, dry and in the dark.

Extras: Filter Print Post Top
Jump to top Pages: 1


Similar ThreadsPosterViewsRepliesLast post
* Some kid thought LSD genetically mutates the DNA of your children...
( 1 2 3 all )
Fluxburn 12,653 54 01/28/18 12:24 PM
by papel
* LSD in Ontario? print question duggan18 3,304 8 04/27/06 10:57 PM
by LSD_rules
* LSD's Triumphant Return
( 1 2 3 4 all )
Ravus 8,959 61 08/22/06 02:55 PM
by thehandtruck
* will LSD last?
( 1 2 all )
danlennon3 11,963 26 10/01/18 11:06 AM
by nube424
* The Altoids & Freezer Experiment fatppl12 7,082 18 11/28/11 01:41 AM
by AcidStrippedMind
* altoids and acid leafing 17,291 12 03/14/12 02:16 AM
by JimLahey
* Acid on Altoids? F0SS1L 4,918 14 01/25/05 02:34 AM
by montana
* LSD POTENCY chaos05 2,428 13 04/28/06 08:30 PM
by sacred_mushroom

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
16,102 topic views. 3 members, 46 guests and 60 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.024 seconds spending 0.007 seconds on 14 queries.