Home | Community | Message Board


Everything Mushrooms
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Jump to first unread post. Pages: 1 | 2 | Next >  [ show all ]
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,096
Loc: ny/europe/other
Last seen: 1 month, 15 days
Poppy Stem Tea
    #3182349 - 09/26/04 01:58 PM (12 years, 10 months ago)

Recipe anyone? I have a good bunch of stems leftover and I'd like to know how many it takes, etc.


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAlsius
Non-photo Blue

Registered: 07/21/04
Posts: 123
Last seen: 12 years, 4 months
Re: Poppy Stem Tea [Re: Locus]
    #3182387 - 09/26/04 02:16 PM (12 years, 10 months ago)

Alot. Stems are very weak. I used 50+ and did not fell much of anything. Just pulverize them as best you can and follow your own tea proceddure as normal.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflinePsilocybeingzz
Male User Gallery

Registered: 12/15/02
Posts: 14,463
Loc: International waters
Last seen: 4 years, 9 months
Re: Poppy Stem Tea [Re: Locus]
    #3183165 - 09/26/04 06:16 PM (12 years, 10 months ago)

50 stems WILL get you quite high if the poppies are strong, so I would NOT use 50.



Just grind the material, and use about 3 times the ammount of powder as you do when you make pod tea and you should be set.

Personally I dont use often, and even a couple of nice stems are enough to get me high..throw in some roots from homegrown popppies and the potency increases.
:wink:

Drink some grapefruit juice, and then drink a tea.

I dont think stems are NEARLY as weak as some people say.


Edited by Psilocybeingzz (09/27/04 06:34 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,096
Loc: ny/europe/other
Last seen: 1 month, 15 days
Re: Poppy Stem Tea [Re: Psilocybeingzz]
    #3183177 - 09/26/04 06:21 PM (12 years, 10 months ago)

Thanks buddy :smile:


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Poppy Stem Tea [Re: Locus]
    #3183527 - 09/26/04 08:55 PM (12 years, 10 months ago)

It depends how long the stems are, of course. On mine they were only a couple inches long.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,096
Loc: ny/europe/other
Last seen: 1 month, 15 days
Re: Poppy Stem Tea [Re: Koala Koolio]
    #3183539 - 09/26/04 09:01 PM (12 years, 10 months ago)

Mine haven't been cut though.


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAlsius
Non-photo Blue

Registered: 07/21/04
Posts: 123
Last seen: 12 years, 4 months
Re: Poppy Stem Tea [Re: Locus]
    #3183712 - 09/26/04 09:53 PM (12 years, 10 months ago)

Mine were also on average 1-2 inches long(should have noted that in the beginning)


Post Extras: Print Post  Remind Me! Notify Moderator
InvisiblePsilostylin
Captain Save Em'
Registered: 03/13/04
Posts: 678
Loc: New Orleans!
Re: Poppy Stem Tea [Re: Alsius]
    #3183903 - 09/26/04 10:42 PM (12 years, 10 months ago)

"I dont think stems are NEARLY as weak as some people say."

agreed.
the stems contain a good deal of alkaloids, they should never be wasted.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,096
Loc: ny/europe/other
Last seen: 1 month, 15 days
Re: Poppy Stem Tea [Re: Psilostylin]
    #3183919 - 09/26/04 10:46 PM (12 years, 10 months ago)

It seems like this is a common misconception also. So it's good to have this out there.


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Poppy Stem Tea [Re: Locus]
    #3183932 - 09/26/04 10:50 PM (12 years, 10 months ago)

Real good to know. Good thing I have about 50 sitting in a box waiting to be thrown out.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,096
Loc: ny/europe/other
Last seen: 1 month, 15 days
Re: Poppy Stem Tea [Re: Koala Koolio]
    #3184056 - 09/26/04 11:27 PM (12 years, 10 months ago)

Hehe, that would have sucked. So when will ya put those to good use?
--

Anyone: So what about the best preperation for this? Do you mimic tea preperation? ..or keep it simmering in a pot for a while, or..?


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,096
Loc: ny/europe/other
Last seen: 1 month, 15 days
Re: Poppy Stem Tea [Re: Locus]
    #3187017 - 09/27/04 05:37 PM (12 years, 10 months ago)

Made some today, it was successful. Not bad. Turned out to be pretty close to a regular cuppa tea.


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflinePsilocybeingzz
Male User Gallery

Registered: 12/15/02
Posts: 14,463
Loc: International waters
Last seen: 4 years, 9 months
Re: Poppy Stem Tea [Re: Locus]
    #3187282 - 09/27/04 06:37 PM (12 years, 10 months ago)

Dont forget the grapefruit juice :wink:


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,096
Loc: ny/europe/other
Last seen: 1 month, 15 days
Re: Poppy Stem Tea [Re: Psilocybeingzz]
    #3187326 - 09/27/04 06:48 PM (12 years, 10 months ago)

Oh yeah, hehe. I know I know, I just didn't feel like going out today. But anyway, this has intensified and I'd say it's just as good as if I were to have made it from pods. :smile: Coolcool.


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAneglakya
mephiticconjurator

Registered: 03/17/02
Posts: 4,461
Last seen: 7 years, 2 months
Re: Poppy Stem Tea [Re: Psilocybeingzz]
    #3187330 - 09/27/04 06:49 PM (12 years, 10 months ago)

I can't believe one mentioned my previous post "Mamma's secret poppy tea recipe" or whatever.. do a search.. its got a ton of recipes.. should be sticky or some shit.. someone post the link for me, to busy to look.


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,096
Loc: ny/europe/other
Last seen: 1 month, 15 days
Re: Poppy Stem Tea [Re: Aneglakya]
    #3187340 - 09/27/04 06:51 PM (12 years, 10 months ago)

I did a search. There were no stem tea threads or recipes.


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineMaverik
Stranger
 User Gallery

Registered: 06/20/03
Posts: 210
Loc: West
Last seen: 4 years, 7 months
Re: Poppy Stem Tea [Re: Locus]
    #3192504 - 09/28/04 07:45 PM (12 years, 10 months ago)

http://www.shroomery.org/forums/showflat.php?Cat=&Number=2956999 - titled: "Mamma's secret recipe for PT." :smile:


--------------------
~ Dead to the Core ~


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,096
Loc: ny/europe/other
Last seen: 1 month, 15 days
Re: Poppy Stem Tea [Re: Maverik]
    #3192847 - 09/28/04 08:42 PM (12 years, 10 months ago)

Ah, thank you. I did a search beforehand using various words, but there were no results. Although, that thread is more of an overall poppy tea topic and doesn't thoroughly cover stem tea and it's preperation. If anyone has more to add to this thread on only stem tea then that would be good. As this would be more of a stem tea only information thread. But this thread doesn't have very much info either, haha. It would be good to change this though. But how much info can you have on stem tea anyway...  :tongue:


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisiblePsilostylin
Captain Save Em'
Registered: 03/13/04
Posts: 678
Loc: New Orleans!
Re: Poppy Stem Tea [Re: Locus]
    #3193102 - 09/28/04 09:36 PM (12 years, 10 months ago)

i tea the stems and leaves the same as the pods...sometimes using a little more lemon juice but all in all it's the same process...just blend the stems into a fine, fine powder and it should work for you. there may be a special recipe for just stems out there but i feel that the pod recipe works just fine...though i usually just use the stems along with the pods when making tea (why seperate? i understand to throw out the knuckles by why not use in the stems when teaing?)...i have made tea with just stems and i do nothing different.

pstyln


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,096
Loc: ny/europe/other
Last seen: 1 month, 15 days
Re: Poppy Stem Tea [Re: Psilostylin]
    #3193305 - 09/28/04 10:53 PM (12 years, 10 months ago)

I was under the impression that the nodules were the same thing as the "knuckles". Maybe I'm confused and imagining the wrong part, but is that correct or not? Or am I getting the above the pod and below the pod parts mixed up?


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Edited by Locus (09/29/04 12:39 AM)


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1 | 2 | Next >  [ show all ]

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Similar ThreadsPosterViewsRepliesLast post
* Poppy seed tea
( 1 2 all )
Poppygod 7,968 37 12/19/10 02:19 AM
by The.KK
* wormwood tea recipes CosmicFunGuy 5,404 8 10/20/06 04:16 PM
by thedudenj
* poppy seed tea Peteahsaurus 1,153 2 11/02/06 01:21 AM
by rocknliam
* Poppy stems and Poppy straw- extraction, questions flowstone 5,657 2 05/15/05 12:29 PM
by iamgod
* whats your favorite poppy tea recipe? sancho 13,525 9 07/11/03 08:15 PM
by biglo
* Opium poppy seeds tea shaganoz 2,895 16 11/14/02 11:09 PM
by XtrablueMushroom
* anyone familar with poppy straw tea? durban_poison 4,171 7 07/13/06 03:07 PM
by durban_poison
* poppy + shroom tea DexTek 768 3 08/22/02 10:41 AM
by Murple

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless
9,433 topic views. 1 members, 17 guests and 5 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
MRCA Tyroler Gluckspilze
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.035 seconds spending 0.003 seconds on 18 queries.