Home | Community | Message Board


Everything Mushrooms
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Jump to first unread post. Pages: 1
OfflineMad_Buhdda_Abuser
member
Registered: 12/12/03
Posts: 129
Last seen: 12 years, 9 days
Share your 'Second trip' Experience, Mine wasn't to good....
    #3156975 - 09/20/04 07:27 PM (12 years, 2 months ago)

I just tripped this weekend with 4 of my boys and it wasn't all great--No real hallucinations but i heard that shrooms take a cuple of times to really feel it, True and if so how many times was it before you REALLY tripped?? Thz in advance
:mushroom2: :crazy2: :mushroom2:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Share your 'Second trip' Experience, Mine wasn't to good.... [Re: Mad_Buhdda_Abuser]
    #3157143 - 09/20/04 08:12 PM (12 years, 2 months ago)

It doesn't matter how many times you've done it. Generally people just increase the dosage as time goes on. A weak trip has more to do with tolerance (natural, or because it was done recently), weak shrooms, not having eaten on an empty stomach, etc.

So, what do you mean by REALLY tripped? what kind effects did you have anyway? theres a difference between a 'weak' trip and a non trip :wink:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleAyrios
Stranger

Registered: 12/08/02
Posts: 619
Re: Share your 'Second trip' Experience, Mine wasn't to good [Re: Mad_Buhdda_Abuser]
    #3157155 - 09/20/04 08:16 PM (12 years, 2 months ago)

I've only heard the 'can't feel it first couple times' thing applied to weed. I'd be surprised if this applied to mushrooms for some people... I'd feel more inclined to believe maybe some people get fake shit and then really trip once they've become more knowledgeable and know what to look for when buying/picking.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineMad_Buhdda_Abuser
member
Registered: 12/12/03
Posts: 129
Last seen: 12 years, 9 days
Re: Share your 'Second trip' Experience, Mine wasn't to good [Re: Mad_Buhdda_Abuser]
    #3157337 - 09/20/04 09:04 PM (12 years, 2 months ago)

Well i ate 3.5 grams of some Very Blue Shrooms first time i ate 2.5. My buddy from class last year told me that the 1st and second times wern't to good, then after the third time he had a crazy trip where he began to see warcraft come to life and like some sort of dna strands 3d come right at his face, sounded cool--My trip was ok at times i didn't really trip out but things i guesse looked different overall---there was one point where i was looking up at the stars and they were doing some weird shit. Im thinking that since shrooms are natural the trip outs are kind of like weed--first cuple of times i didn't feel shit then one time i just got retarded. Its like something just clicked and i was higher than mount everest haha--anyways any suggestions would be sweet ez Brothers!!


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleAdden
Saprotrophic Specimen
I'm a teapot User Gallery

Registered: 06/04/03
Posts: 34,131
Loc: Amongst the Dunes
Re: Share your 'Second trip' Experience, Mine wasn't to good [Re: Mad_Buhdda_Abuser]
    #3157515 - 09/20/04 09:47 PM (12 years, 2 months ago)

My first trip was very confusing. I didn't know what to do, or expect. I kinda set myself up for it, it was a bad setting and I wondered before they kicked in, "I wonder if something crazy will happen, like the carving on the cabinet talking to me". Well, it did, and it didn't blast me into a bad trip but kinda bugged me out so I left that room. I went outside and everything was different. I didn't know how to perceive it, or anything.

I then realized its all in your mind. I dosed less my second time, had a highly visual trip off of the same batch of shrooms, and a very enlightening one. Instead of being at a party scene, I was at my home, and had plenty of ganj. Gotta get your feet wet before you jump in, ykno?


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblelukeboots
fresh futuristic
Male User Gallery
Registered: 02/04/04
Posts: 19,728
Loc: Grand Ole Operating Syste...
Re: Share your 'Second trip' Experience, Mine wasn't to good [Re: Adden]
    #3157590 - 09/20/04 10:03 PM (12 years, 2 months ago)

my second trip was way better than my first one.. like s2dope, my first time was very confusing (and the whole trip was spent in the passenger seat of a car...terrible place to be tripping). my second time, however, was (i'm guessing) around 2.5 grams and it was incredibly enlightening and i was completely at peace with everything around me. i just got a chill thinking about how awesome it was :thumbup:


--------------------

funky ass music: Planet of Dinosaurs // Rich Whiskey


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblegdman
badger, badger,badger...
Male User Gallery

Registered: 12/10/02
Posts: 16,286
Loc: Dancing In the Streets
Re: Share your 'Second trip' Experience, Mine wasn't to good [Re: Mad_Buhdda_Abuser]
    #3157801 - 09/20/04 10:53 PM (12 years, 2 months ago)

My first trip blew me away... an 1/8 of what looked like (and where) very, very good cubes (grower must have been proud). Blew me away, I can't even remember some of it, my roomate said I was saying some funny stuff: "I am a kicthen sink." :lol: My second trip was at this concert, was nice :smile:.


--------------------


Got a question about a substance?  Erowid might already have your answer! Have questions about the  mushroom experience? The  Tripper's FAQ may have your answer or someone else might have had your question before.
         
I know up on the top you are seeing great sights, but down at the bottom we, too, should have rights.
  - Theodor Seuss Geisel Dr. Suess

"I didn't come here to be easily understood" - Steve


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblegdman
badger, badger,badger...
Male User Gallery

Registered: 12/10/02
Posts: 16,286
Loc: Dancing In the Streets
Re: Share your 'Second trip' Experience, Mine wasn't to good [Re: gdman]
    #3157812 - 09/20/04 10:54 PM (12 years, 2 months ago)

seriously those mushrooms I took my first time where beutiful, veils just barely breaking, caps attached to the stems (no shake) barely any bluing (except at the base a little) holy shit what I would give for some more of those.


--------------------


Got a question about a substance?  Erowid might already have your answer! Have questions about the  mushroom experience? The  Tripper's FAQ may have your answer or someone else might have had your question before.
         
I know up on the top you are seeing great sights, but down at the bottom we, too, should have rights.
  - Theodor Seuss Geisel Dr. Suess

"I didn't come here to be easily understood" - Steve


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineStinky
Toaster ofPop-tarts

Registered: 08/31/04
Posts: 61
Last seen: 12 years, 1 month
Re: Share your 'Second trip' Experience, Mine wasn't to good [Re: Mad_Buhdda_Abuser]
    #3161309 - 09/21/04 08:06 PM (12 years, 2 months ago)

My first trip was only with maybe only 1.5g dried, but apparently they were very potent because I had hallucinations and that classic feeling of a collective consciousness and partial ego-loss. It was during a beautiful afternoon outside, and we were in a great setting next to a river. It amazed me how spiritual I felt, leaving any sort of organized western religion in the dust.
My second trip was with a little less than an 1/8th, plus we smoked about two bowls each. It was at night, with very windy weather. While the enhanced visuals were definately there, I had no particularly spiritual feelings. It was more recreational than anything else.
Both trips were great, just in very different ways. I think setting had more to do with the result of the trip than anything else.


Edited by Stinky (09/21/04 08:07 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Similar ThreadsPosterViewsRepliesLast post
* Commonly Shared Trip Experiences Despite Our Individual Differences Big Red 432 2 10/17/08 12:06 PM
by Angel_Above
* when my friends trip affected mine Shnezbit 562 1 03/12/06 01:13 AM
by mecreateme
* Bad Trip Experience Compass 1,423 4 02/01/07 10:22 AM
by Wronguy
* Does anxiety decrease with more trip experience?
( 1 2 all )
Noviseer 4,777 28 08/21/16 06:52 PM
by Aldebaran
* Self centered trip experience.
( 1 2 all )
DaZeDmerlin 2,733 37 08/27/08 02:06 AM
by Noviseer
* Evaluate My Plans for First Tripping Experience: Sketchy105 1,442 6 03/04/04 05:24 AM
by Asante
* Tell me your most euphoric trip experience psychotropic89 1,752 19 03/11/09 12:39 PM
by AgingHippy
* youngest age for a trip?
( 1 2 all )
Gwero 1,382 26 10/04/08 12:11 PM
by TEAL_MUST_DIE

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Asante, Rose, sui, karode13, LSDreamer
605 topic views. 2 members, 338 guests and 23 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
Kraken Kratom
Please support our sponsors.

Copyright 1997-2016 Mind Media. Some rights reserved.

Generated in 0.056 seconds spending 0.008 seconds on 14 queries.