Home | Community | Message Board


Avalon Magic Plants
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop: Herb Grinder

Jump to first unread post. Pages: 1
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,103
Loc: ny/europe/other
Last seen: 6 days, 7 hours
P.T. time again
    #3156339 - 09/20/04 04:48 PM (13 years, 1 month ago)

Had poppy tea a few times before, though never had good effects, but let's take a look at the last experience because I have some questions as to why it didn't turn out too well. Took about 5 medium/small sized pods, crushed, etc.. made the tea. Drank it and after almost two hours became slightly relaxed and content, but that was about as far as it went. Now surely that could be because there were not enough pods and in turn didn't get much effects, but I also got a stomach ache that lasted for the rest of the night. It wasn't horrible or anything, but it was enough to concern me. The pods also didn't look moldy or anything so I don't know. And I'm worried that if I were to increase the number of pods that the ache would be worse. Any ideas?

Also, what would be the minimum amount of pods needed/worth using to make putty?


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: P.T. time again [Re: Locus]
    #3157321 - 09/20/04 09:00 PM (13 years, 1 month ago)

well, it's hard to base anything on a pod count. pods differ greatly. When we ground up dried pods, there was a little less than half a tablespoon per pod. Each person used 3 tablespoons for a dose. This was about 6 or 7 pods.. but some people didnt finish theirs and still got effects. Everyone was pretty fucked up, but none of us had any tolerance or anything. The pods were probably about medium. But, there were bigger and smaller ones in the mix. So we ground up a ton into a mixed powder.. that would be measured out.

And yes, the next day our stomachs felt awful. There was some puking, etc. But then there was recovery :smile:

Also, it could be your tea making. We threw the powder in about a half second before turning off the burner to the boiling water. (2 cups per person, each dose made seperately.. just to be safe). If you boiled the water with the pods in the whole time, it could certainly hurt the goodies.

Also, given that this was a borderline weak dose, and every single person felt it pretty hard, I've concluded that we're lightweights, and they were quite potent.

Hope I helped.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,103
Loc: ny/europe/other
Last seen: 6 days, 7 hours
Re: P.T. time again [Re: Koala Koolio]
    #3157828 - 09/20/04 10:58 PM (13 years, 1 month ago)

Well, thanks for your input elgr.

I think i'll just try increasing the dose. I know about not boiling and all of that. So I did it the right way. Though I got a stomach ache only a few an hour or two after consuming the tea so I don't know why that is.

Another question I have is that if the pod is easy to break and bends soft rather than has a hard shell is there anything wrong with it? Some that I have do that, while others are hard. .. .. ..


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: P.T. time again [Re: Locus]
    #3158060 - 09/20/04 11:41 PM (13 years, 1 month ago)

Good point. I noticed a couple were like that. Maybe they hadn't been dried for the same length of time. However, I also noticed that some of the ones that were more bendable were also more purple, and inside the seeds were clustered to the walls in a sappy way.

I just figured they were more potent. They still blended fine in the coffee grinder.

Maybe I would've had a stomach ache a few hours into it.. but there was some pain being killed :smile: .

I know.. I shouldn't have to say it, but like always be careful increasing dosages :smile:

Edit: Was just uploading a pic so.. I found this. Just to give you an idea of the average pod size.



Keep in mind everything from where the lighter turns into a bottle opener is 'extra length'


Edited by elgr (09/20/04 11:56 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflinePsilocybeingzz
Male User Gallery

Registered: 12/15/02
Posts: 14,463
Loc: International waters
Last seen: 5 years, 11 days
Re: P.T. time again [Re: Koala Koolio]
    #3158316 - 09/21/04 12:36 AM (13 years, 1 month ago)

Hmm, let me guess , Gary from over at ebay right? :smile:


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: P.T. time again [Re: Psilocybeingzz]
    #3158555 - 09/21/04 01:41 AM (13 years, 1 month ago)

No, that wouldn't make sense. They sell dried flowers for decorative purposes. Where as mine, on the other hand, were potent little guys. :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,103
Loc: ny/europe/other
Last seen: 6 days, 7 hours
Re: P.T. time again [Re: Koala Koolio]
    #3159463 - 09/21/04 01:22 PM (13 years, 1 month ago)

haha.

Mine look just like yours. you know what kind those are?


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleStonehenge
Alt Center
Male User Gallery
Registered: 06/20/04
Posts: 12,760
Loc: S.E.
Re: P.T. time again [Re: Locus]
    #3159613 - 09/21/04 02:11 PM (13 years, 1 month ago)

PT gives me nausea. Last couple times I tried it I puked and puked. It was a nice buzz other than that. Maybe I made it too strong.

Stoney


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: P.T. time again [Re: Stonehenge]
    #3159926 - 09/21/04 03:16 PM (13 years, 1 month ago)

Seems to be just the way it goes with this stuff. Maybe if you're used to it.

Locus, giganthemum


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,103
Loc: ny/europe/other
Last seen: 6 days, 7 hours
Re: P.T. time again [Re: Koala Koolio]
    #3160275 - 09/21/04 04:29 PM (13 years, 1 month ago)

though these gigantheums are pretty small compared to the usual aren't they?

wow, i only got two tablespoons and a little bit more from 8 pods. geez, small.


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: P.T. time again [Re: Locus]
    #3160316 - 09/21/04 04:37 PM (13 years, 1 month ago)

Yeah, some of the ones in that pic are pretty medium. There were some bigger, some smaller. They were sold as a medium-ish mix. Larger ones tend to be a bit more expensive.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,103
Loc: ny/europe/other
Last seen: 6 days, 7 hours
Re: P.T. time again [Re: Locus]
    #3163767 - 09/22/04 09:04 AM (13 years, 1 month ago)

nevermind.. hehe


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Edited by Locus (09/23/04 03:59 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineeve69
--=..Did Adam and ...?=--
Male User Gallery

Registered: 04/30/03
Posts: 3,871
Loc: isle de la muerte Flag
Last seen: 5 months, 9 days
Re: P.T. time again [Re: Locus]
    #3163914 - 09/22/04 10:14 AM (13 years, 1 month ago)

There's lots to say about the old PT. Let's see.

When I first started dosing I used to drink cups and cups as long as it lasted. I noticed very strong euphoria with very red telltale eyes and so on. Didn't hurt my stomach so much but certainly felt nausea. But then would come maintenence dose and then withdrawls, pretty bad too.

So then later I kept it down to one big dose for two days with a weeks breather between. No major withdrawls, no really bugged out eyes, but more nausea.

When I started it was easy to get good deals on pods, say 100 mediums for 25 bucks. Now, only shitty purple pods with little M content are available at that price. The market has boomed.

Consequently, the buzz gets less frequent.


--------------------
...or something







Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,103
Loc: ny/europe/other
Last seen: 6 days, 7 hours
Re: P.T. time again [Re: eve69]
    #3163923 - 09/22/04 10:19 AM (13 years, 1 month ago)

..


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Edited by Locus (09/23/04 04:00 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,103
Loc: ny/europe/other
Last seen: 6 days, 7 hours
Re: P.T. time again [Re: Locus]
    #3163946 - 09/22/04 10:32 AM (13 years, 1 month ago)

ah.. finally successful.


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Edited by Locus (09/23/04 04:00 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAlsius
Non-photo Blue

Registered: 07/21/04
Posts: 123
Last seen: 12 years, 7 months
Re: P.T. time again [Re: Locus]
    #3166217 - 09/22/04 08:18 PM (13 years, 1 month ago)

On the rare occasion I drink pod tea(usually when I'm sick, this stuff makes asthma much more bearable), I stay high for somewhere around 10 hours. That's with 5 medium sized pods. Is this just me?


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,103
Loc: ny/europe/other
Last seen: 6 days, 7 hours
Re: P.T. time again [Re: Alsius]
    #3170256 - 09/23/04 04:01 PM (13 years, 1 month ago)

nah, not just you. it lasts a long time.


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Amazon Shop: Herb Grinder

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Similar ThreadsPosterViewsRepliesLast post
* Empty Stomach? Pirate_Patrick 762 4 05/22/05 12:15 PM
by Locus
* NO more Kratom tea..PLEASE!!
( 1 2 all )
thremix 9,089 36 08/01/05 09:22 AM
by Locus
* Poppies - from Poppyseed to Opium
( 1 2 3 4 ... 32 33 )
AsanteA 230,843 646 04/27/14 05:28 PM
by 4ku2sh0
* Poppy pod extract? MyExcuse 4,562 18 08/07/07 11:02 AM
by logancircle
* Cactus Soil PriitK 2,372 10 02/12/12 06:17 PM
by blackdogs
* HBWR - iamshaman,com irishboy 2,144 19 11/08/06 08:26 PM
by shane
* Hawian Baby Rosewood HARVEST!!!!!!!!!!
( 1 2 3 all )
bluelou 3,156 41 07/06/05 11:00 AM
by bluelou
* HBWR preparation: zero nausea quick onset guaranteed
( 1 2 all )
Adden 19,645 35 02/12/09 02:08 AM
by Dr. uarewotueat

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless
649 topic views. 1 members, 8 guests and 4 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
World Seed Supply
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.034 seconds spending 0.005 seconds on 19 queries.