|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Bleuboxo
enthusiast
Registered: 04/05/01
Posts: 196
Loc: Geographic Location (Stat...
Last seen: 23 years, 4 months
|
Lets start fresh...DMT substrate
#315374 - 05/12/01 12:58 AM (23 years, 6 months ago) |
|
|
now, in SUPER POTENT SHROOMS post...we talked about adding a DMT substrate....that post got too long so ill start another topic...ive gathered a list full of plant names that all contain DMT, im trying to do research but cannot find the amounts of DMT in each plant, tree, shrub, grass. my best choice would be to go with a grass, its easy cultivated, takes less time than any of the other ones and probably has a decent amount of DMT in there anyways. Ill show the list, i know the Phalaris grasses....but those are the only grasses i know, do you recognize any other grasses on this list?
Phalaris Arundinacea
Phalaris Aquaticus
Aizoaceae Delosperma
Petalostylis Cassiodies
Lespedeza Bicolor
Mucuna Pruriens
Mimosaceae Anadenanthera
*Colubrina
*Contorta
*Excelsa
*Macrocarpa
*Peregrina
( black beans from the above tree species )
Desmanthus Illinoensis
Testulea Gabonensis
Malpighiaceae Banisteriopsis
*Muricata
*Rusbyana
Virola
*Calophylla
*Calophylloidea
*Rufula
*Sebifera
*Theiodora
The bark resin of these trees is used to prepare hallucinogenic snuffs in northwestern Brazil by boiling, drying and pulverizing it. Snuffs made from V. theiodora bark contain up to 11% 5-MeO-DMT and DMT. Also leaves, roots and flowers contain DMT.
Poaceae Arundo Donax
Phragmites Australis
Rubiaceae Psychotria
*carthaginensis
*viridis
Limonia Acidissima
Zanthoxylum Aborescens
***species ( lots of them under one genus )
it was discussed that psilocybin breaks down tryptamine into DMT eventually, then the DMT becomes psilocybin, well by adding a substrate that contains DMT we have just eliminated two steps. all we need to find is that one other step. and we know what to do its just time...but if you see any other grasses post. so far i think im going to order some phalaris aquaticus---arundinacea seeds and cultivate them. but if anyone else can point out any other grasses or easy cultivated plants....anything you see from the above list would help.
" Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
-------------------- " Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
|
Dirtmaster
addict
Registered: 11/20/00
Posts: 194
|
Re: Lets start fresh...DMT substrate [Re: Bleuboxo]
#315449 - 05/12/01 03:50 AM (23 years, 6 months ago) |
|
|
But you're just guessing that DMT can and will be used by the mycelium to produce more psilocybine. I don't see the rationale behind this, it's just groundless speculation.
|
Explorer
Stranger
Registered: 05/04/01
Posts: 24
Last seen: 20 years, 2 months
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#315514 - 05/12/01 08:14 AM (23 years, 6 months ago) |
|
|
It is not groundless speculation. It has been done. The chemistry makes perfect sense, so where's the problem? I grow Phalaris Arundinacea and have a continuous suply. Extracting it could possibly (more research needed) be brought down to 30 minutes or even less. My next batch will be given over to making substrate. I'll post the results, after an impartial, blind tasting, and that should end the argument about whether it's possible. I'm sure some people will still argue that the shrooms should be left to their own devices, but I think that it's just the same as adding a fertiliser to plants. It's just food for the fungus, and more fun for us. Maybe a mycelium could be grown on a mix containing Mimosa root bark? That would give it access to loads of N.N.DMT.
|
Bleuboxo
enthusiast
Registered: 04/05/01
Posts: 196
Loc: Geographic Location (Stat...
Last seen: 23 years, 4 months
|
Re: Lets start fresh...DMT substrate [Re: Explorer]
#315673 - 05/12/01 12:46 PM (23 years, 6 months ago) |
|
|
no it defintley is not groundless speculation....if oyu say this is groundless speculation than you are going against the shroomery itself. read Gartz' way of adding tryptamine to the substrate....DMT has already converted tryptamine...its at phase 3 of 4 at becoming psilocybin ( from the mushrooms perspective ) ...adding DMT casing or substrate would work. read the pathways to it on super potent shrooms thread. hey explorer...what plants produce the most amounts of DMT if you know. i heard phalaris aquaticus from a seed company somewhere in the US sells some pretty potent stuff. there prices are $10-15 for a seed packet. i would use mimmosa if it has more amounts but using the grasses are easier to cultivate and easier to use as a substrate/casing. any feedback on this?
" Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
-------------------- " Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
|
Anonymous
|
Re: Lets start fresh...DMT substrate [Re: Bleuboxo]
#315814 - 05/12/01 04:07 PM (23 years, 6 months ago) |
|
|
DMT should work. Sounds like a lot of trouble, but go for it!!!
|
Explorer
Stranger
Registered: 05/04/01
Posts: 24
Last seen: 20 years, 2 months
|
Re: Lets start fresh...DMT substrate [Re: ]
#315825 - 05/12/01 04:29 PM (23 years, 6 months ago) |
|
|
Here are some known concentrations
Acacia bark: 0.71% DMT
Mimosa root: 0.57% DMT
Virola shoots & flowers: 0.44% DMT
Desmanthus rootbark: 0.34% DMT
Phalaris: 0.17% DMT, 0.06% 5MeO
As you can see, although Mimosa does not have the highest concentrations, it is very easy to find in cultivation. None of the plants containing DMT are controlled in either US or UK law, and are completely legal to own.
More info on the boards at dmt.lycaeum.org
|
Ashaman
member
Registered: 04/07/01
Posts: 155
Last seen: 13 years, 2 months
|
Re: Lets start fresh...DMT substrate [Re: Explorer]
#315827 - 05/12/01 04:33 PM (23 years, 6 months ago) |
|
|
mimosa root may be just .57%, but the rootbark contains most of the DMT and comes in at about 1%
|
Bleuboxo
enthusiast
Registered: 04/05/01
Posts: 196
Loc: Geographic Location (Stat...
Last seen: 23 years, 4 months
|
Re: Lets start fresh...DMT substrate [Re: Ashaman]
#315842 - 05/12/01 04:55 PM (23 years, 6 months ago) |
|
|
thanks for the great info guys. i also was wondering about extraction of DMT and adding a considerable amount to the substrate. i read in a couple of places that its not that hard to make extractions but ive just sent out the last of my laboratory equiptment and theres no possible way to buy more equiptment....so cultivating a plant/grass/tree are the only options i have. im interested in phalaris and mimmosa. i guess im down to two and was wondering what is mimmosa?? is it hard to grow? is it a tree/shrub? thanks again.
" Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
-------------------- " Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
|
BrownPastures
old hand
Registered: 03/15/01
Posts: 968
Loc: here
|
Re: Lets start fresh...DMT substrate [Re: Bleuboxo]
#316012 - 05/12/01 11:31 PM (23 years, 6 months ago) |
|
|
What if you didn't even bother to extract the DMT and just mix straight or ground some of the grasses/beans or what ever into cakes??? would this work or do you have to extract it??
"like a Japanese Cowboy or a blind man on skates"Ween
"you must make sure that the lady's pure for the Funky Cold Medina"Tone Loc
|
Bleuboxo
enthusiast
Registered: 04/05/01
Posts: 196
Loc: Geographic Location (Stat...
Last seen: 23 years, 4 months
|
Re: Lets start fresh...DMT substrate [Re: BrownPastures]
#316044 - 05/13/01 01:41 AM (23 years, 6 months ago) |
|
|
well i myself am not 100% positive it will work. from an ounce of bark the alkaloid level was a little over 10g from a recent extraction. if you are going to grow any type of mushroom on a substrate, it should have at LEAST a minumum amount of DMT. there has to be a way of finding out how much DMT ( extract or substrate ) actually needs to be converted into .15g of tryptamine. in the gartz experiment they inculded the dosage of .15g of tryptamine to the substrate cake. how much DMT should be needed to make fruits 3-4 times potent? you have to determine this. tryptamine gets broken up eventually into DMT. c - a = b? so .15 grams of tryptamine is exactly the same as .15 grams of DMT? just some questions i had sitting in my head. Sorry i couldnt answer your question Brown Pastures, but there is so much research that i have to do before i can answer your question. or maybe someone else on the board can answer it. i also did read about someone adding mimosa root bark ( ground up into a powder ) into there substrate and him and several of his friends could not handle all but one mushroom... i just want to prove this theory about potent shrooms. it would be nice to grow a couple hundred, shred them to a fine powder and pack one mushroom a pill....one pill is all you would need, and then you'd tons of trips for the rest of the year. hehe. cheers.
" Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
-------------------- " Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
|
Explorer
Stranger
Registered: 05/04/01
Posts: 24
Last seen: 20 years, 2 months
|
Re: Lets start fresh...DMT substrate [Re: BrownPastures]
#316047 - 05/13/01 01:43 AM (23 years, 6 months ago) |
|
|
Bleuboxo - You really don't need to bother growing any DMT containing plants. Mimosa Hostilis root bark is available from loads of entheogen supply companies and is completely legal to buy and own - for identification purposes only of course.
Of all the DMT containing varieties, Mimosa root bark would probably make the best substrate component, or if an extraction is necessary, then Mimosa is best for that too.
As I have already said, pending verification, it seems that for non-consumable use a butane extraction might work on Mimosa. The DMT alkaloids should be enough to nourish shrooms without having to convert them to freebase, although as freebase the product is very pure, and so may limit the chances of having contams in. The boiling point for DMT means that excessive temps should be avoided (it melts at about 57 degrees C).
If the butane extraction is sufficient, then no lab equipment is needed. All that is required is a foot long PVC pipe, 2-3 inches in diameter. Fit a cottonn T-shirt tightly over one end and use a thick piece of cardboard with a hole in the middle over the other end. Fill the pipe 2/3 full with roughly ground Mimosa Hostilis root bark. Then Hold the pipe over a pyrex beaker using a thick glove. The pipe will freeze, so you don't want to be holding it with an unprotected hand. Then insert the nozzle of a can of lighter re-fil gas into the hole in your cardboard sheet and spray the whole can through. Depending on the size of your can and pipe, you might need more than one can. The pipe will frost over on the outside in about a minute, then liquid butane will start streaming out of the bottom along with the DMT alkaloids. Once you have finished, the beaker will be full of bubbling butane, boiling off at room temperature. Make sure this is done in a VERY well ventilated area, and avoid all sources of sparks or ignition. To boil off the butane quicker you can rest the beaker in a pan of hot water. The tarry material that is left in the bottom of the beaker should contain all the goodies from the Mimosa.
I have included the above for informational purposes only.
Now this method should grab the DMT alkaloids, but I haven't tested the end product to see exactly what it contains, and so can't be 100% sure. I can't test it by taking it either, as I don't get off on DMT (although it is possiblt that I need a psilocin pre-dose).
Hope some of this helps.
|
Bleuboxo
enthusiast
Registered: 04/05/01
Posts: 196
Loc: Geographic Location (Stat...
Last seen: 23 years, 4 months
|
Re: Lets start fresh...DMT substrate [Re: Bleuboxo]
#316049 - 05/13/01 01:46 AM (23 years, 6 months ago) |
|
|
oh i forgot to add...maybe you can reverse the process_
instead of adding DMT or extracting it, maybe you can extract tryptamine from DMT? it'll be like extracing milk from cheese in a way if you see what im saying. then thats the way to determining how much actual DMT you would need for those super potenters_if it actually increases potency...so much research needs to be done;
" Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
-------------------- " Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
|
Explorer
Stranger
Registered: 05/04/01
Posts: 24
Last seen: 20 years, 2 months
|
Re: Lets start fresh...DMT substrate [Re: Bleuboxo]
#316051 - 05/13/01 01:48 AM (23 years, 6 months ago) |
|
|
In the report I've seen, 100mgs of DMT was added to a half-pint jar which resulted in a 3-4 times increase in psilocin levels. An active dose of psilocin is roughly 10mg so your increasing the half-pint jar by about ten doses. If the DMT is converted by this unknown hydroxilase then all of the DMT that the mycelium comes in contact with should be converted to psilocin.
|
Bleuboxo
enthusiast
Registered: 04/05/01
Posts: 196
Loc: Geographic Location (Stat...
Last seen: 23 years, 4 months
|
Re: Lets start fresh...DMT substrate [Re: Explorer]
#316062 - 05/13/01 02:17 AM (23 years, 6 months ago) |
|
|
explorer thanks, i acutally have 4 bottles of butane for this mini blowtorch i have. i will be sure to try this method. i have actually seen mimosa bark somewhere on the net, im sure i can find it again. im trying to get the best info i can on my projects, i just moved in a new apartment so im short on cash. the butane method seems fairly inexpensive, and im only doing 1-2 casings with root bark by itself. this project should be fairly inexpensive all together.
" Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
-------------------- " Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
|
Dirtmaster
addict
Registered: 11/20/00
Posts: 194
|
Re: Lets start fresh...DMT substrate [Re: Bleuboxo]
#316096 - 05/13/01 04:53 AM (23 years, 6 months ago) |
|
|
this is all bullshit. just because tryptamine might raise potency, that doesn't mean dmt or tryptophan or lsd will raise potency. groundless speculation...
|
Psilocybin
member
Registered: 01/30/01
Posts: 128
Last seen: 21 years, 8 months
|
Re: Lets start fresh...DMT substrate [Re: Bleuboxo]
#316098 - 05/13/01 04:59 AM (23 years, 6 months ago) |
|
|
From what I have read the only way to extract DMT is through acid base extractions. Im not an expert, but I have seen many people that swear by acid base extractions, and seeing as how the butane extraction sounds so easy I dont know why they wouldn't have switched if it works that well. Have you actually heard reports of butane extraction or is that theoretical? And if so, on what principals?
This sounds like a very promising way to increase potency, I think anyone that can obtain DMT should run some tests. And for anyone that does know a good source, would you mind sharing? maybe a little hint, or just PM me if you want to avoid posting it in public. I know of one with a good reputation but it is currently out of stock of mimosa rootbark.
|
Psilocybin
member
Registered: 01/30/01
Posts: 128
Last seen: 21 years, 8 months
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#316104 - 05/13/01 05:21 AM (23 years, 6 months ago) |
|
|
Dirtmaster, the reason tryptamine and DMT work is that when the fungus makes psiloc(yb)in (the stuff that makes you trip) it converts chemicals already found in your substrate(nitrogen, phosphorus) to make the psilocybin. It does this is in several steps, by making simpler chemicals into more complex ones, therefore if you add more of the simpler ones, the fungus will convert them into more complex ones. Tryptamine is 2 steps before psilocybin, and DMT is the step right before psilocybin. DMT and psilocybin are very similiar chemically, but psilocybin is over 100 times more potent when ingested, so you can use only a small amount of DMT to make a large amount of psilocybin.
lsd and tryptophan are not similiar to psilocybin in anyway, and the fungus will be unable to use them. And there have been tests that PROVE, with chemical analysis, that tryptamine increses potency, so this is definitly not groundless speculation.
|
Humidity
Mad Scientist
Registered: 04/01/00
Posts: 358
Loc: Somewhere in Northeast OH
Last seen: 20 years, 10 months
|
Re: Lets start fresh...DMT substrate [Re: Psilocybin]
#316344 - 05/13/01 02:50 PM (23 years, 6 months ago) |
|
|
I don't think that extracting DMT is nessesary. If you dry the plant that you get your DMT from and grind it to a fine powder it could be added to substrate or possibly casings. Once the mycellum grows through the substrate it will gain access to the DMT.
The only benifit that I see from doing a extraction would be that you can take a measurement of the exact amount of DMT that you are adding.
-------------------- _____________________________________________________________________________________
"The greatest enemy of knowledge is not ignorance, it is the illusion of knowledge." -Stephen Hawking
|
Dirtmaster
addict
Registered: 11/20/00
Posts: 194
|
Re: Lets start fresh...DMT substrate [Re: Psilocybin]
#316440 - 05/13/01 06:15 PM (23 years, 6 months ago) |
|
|
you know nothing of biochemistry and you are wrong. just because tryptamine may increase potency it doesn't mean dmt will. tryptamine and dmt are not the same. you don't understand that shifting one atom can totally change the properties of a molecule.
|
Humidity
Mad Scientist
Registered: 04/01/00
Posts: 358
Loc: Somewhere in Northeast OH
Last seen: 20 years, 10 months
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#316558 - 05/13/01 09:24 PM (23 years, 6 months ago) |
|
|
Dirtmaster I don't know if you saw this:
L-tryptophan --> tryptamine
tryptamine --> N-methyltryptamine
N-methyltryptamine --> N,N-dimethyltryptamine
N,N-dimethyltryptamine (DMT) --> psilocin & psilocybin
This is the pathway for psilocybin production in fungi. You can see that N,N-dimethyltryptamine (DMT) is the immediate precursor to psilocin & psilocybin.
In Theory adding DMT will increase potency since it is a precursor just like tryptamine is.
-------------------- _____________________________________________________________________________________
"The greatest enemy of knowledge is not ignorance, it is the illusion of knowledge." -Stephen Hawking
|
Bleuboxo
enthusiast
Registered: 04/05/01
Posts: 196
Loc: Geographic Location (Stat...
Last seen: 23 years, 4 months
|
Re: Lets start fresh...DMT substrate [Re: Humidity]
#316604 - 05/13/01 11:07 PM (23 years, 6 months ago) |
|
|
ive found several sources of mimosa bark but they are all in different currency except one. , so if anyone can translate we'll start from here.
http://infinite.org/herbdb/pages/H13.html = $4.00lb.
http://www.kingbong.com/ayahuasca.html = ? UKdollars
http://www.botanic-art.com/planten-en.htm = ?euro dollar
" Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
-------------------- " Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
|
DarK_SavioR
addict
Registered: 05/06/01
Posts: 454
Loc: Down the Street
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: Bleuboxo]
#316611 - 05/13/01 11:26 PM (23 years, 6 months ago) |
|
|
http://www.kingbong.com/ayahuasca.html = $21.27 for 10g, $35.45 for 25g, $127.61 for 100g
http://www.botanic-art.com/planten-en.htm = $7.01 for 25g, $12.26 for 50g, $21.01 for 100g, $49.03 for 200g
1 USD = 1.14234 EUR
1 USD = 0.705318 GBP (UK Pounds)
If it works I might order some ; ) Theoretically it should work though, I'll be looking for results. Good Luck.
-------------------- Vitamin C chase, kill the taste. You can tell its nasty by the look on my face.
Ralphster44 & The FSR!
All thats stated above is for humor and a lie!!
|
Bleuboxo
enthusiast
Registered: 04/05/01
Posts: 196
Loc: Geographic Location (Stat...
Last seen: 23 years, 4 months
|
Re: Lets start fresh...DMT substrate [Re: DarK_SavioR]
#316615 - 05/13/01 11:31 PM (23 years, 6 months ago) |
|
|
holy shit king bong is a ripoff! thanks for converting savior! id say whenever i get all this stuff in, about a month from that.. do you think 100g is enough for a small shoebox casing and a couple jars of substrate?
" Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
-------------------- " Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
|
DarK_SavioR
addict
Registered: 05/06/01
Posts: 454
Loc: Down the Street
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: DarK_SavioR]
#316618 - 05/13/01 11:34 PM (23 years, 6 months ago) |
|
|
Also, in case you need to know this... One Pound is equal to 454 grams, heh.
Here's a couple calculators that might come in handy if you need to convert any more currency or weight.
Weight Convertor
Universal Currency Convertor, uses live currency rates.
"Now chew em up and slam the orange juice. Vitamin C chase, kill the taste. You can tell its nasty by the look on my face."
-------------------- Vitamin C chase, kill the taste. You can tell its nasty by the look on my face.
Ralphster44 & The FSR!
All thats stated above is for humor and a lie!!
|
DarK_SavioR
addict
Registered: 05/06/01
Posts: 454
Loc: Down the Street
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: DarK_SavioR]
#316620 - 05/13/01 11:42 PM (23 years, 6 months ago) |
|
|
Just thaught I'd show you all this picture of a mimosa tree ; ) those little flowers look cool as hell
-------------------- Vitamin C chase, kill the taste. You can tell its nasty by the look on my face.
Ralphster44 & The FSR!
All thats stated above is for humor and a lie!!
|
DarK_SavioR
addict
Registered: 05/06/01
Posts: 454
Loc: Down the Street
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: DarK_SavioR]
#316621 - 05/13/01 11:45 PM (23 years, 6 months ago) |
|
|
Another species of mimosa, you might wanna see how much dmt the different species have... I think I might know a few places where you could order the plants and/or seeds.... I'll go look around for more info and shit and post whatever I can get ahold of
-------------------- Vitamin C chase, kill the taste. You can tell its nasty by the look on my face.
Ralphster44 & The FSR!
All thats stated above is for humor and a lie!!
|
DarK_SavioR
addict
Registered: 05/06/01
Posts: 454
Loc: Down the Street
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: DarK_SavioR]
#316625 - 05/14/01 12:01 AM (23 years, 6 months ago) |
|
|
http://www.buyitonline.ca/ethnobotanix/p875.html - Bark, 100g for $125, 50g for $75, 1oz for $50
http://www.gnosticgarden.com/seeds.htm - A lot of seeds for plants which contain tryptamine. Maybe it'd be easier to get ahold of dried leaves or other things from these plants than the mimosa bark and shit, possibly a lot cheaper also... here's one of the plants:
Acacia acuminata - Mangard, Raspberry-Jam Tree
(Leguminosae) Small tree or shrub up to 40 foot tall with yellow to orange flowers in fragrant spikes up to a foot long. The wood has a strong raspberry scent and was used by aboriginals to make weapons. Leaves contain up to 1.5% base mainly consisting of tryptamine with a phenethylamine type base also present. - 5g seeds ?2.50
-------------------- Vitamin C chase, kill the taste. You can tell its nasty by the look on my face.
Ralphster44 & The FSR!
All thats stated above is for humor and a lie!!
|
Bleuboxo
enthusiast
Registered: 04/05/01
Posts: 196
Loc: Geographic Location (Stat...
Last seen: 23 years, 4 months
|
Re: Lets start fresh...DMT substrate [Re: DarK_SavioR]
#316635 - 05/14/01 12:36 AM (23 years, 6 months ago) |
|
|
thanks for all the info savior! best bet would be to try a little first, then test it out to see if it worked. probably a few times. i would buy a whole plant if knew it was defintley going to work, but i can never be sure. im very optimistic about this whole project though. it should be getting some potent results. if not, there is always the acacia acuminata shurb which contains tryptamine and we all know that tryptamine is a defintite result...im set to buy 100g a mimosa bark and put some in the jars as substrate w/ rye. then mix it in with a mixture of mimosa bark & castings. case afterwards with coir. a somple project. anyone want to help me in this quest and take down, and compate notes? we'll get alot done if more people are working on this and actually compare what we are doing ( dosage, type of plant, substrate, etc...) im going to make a propaganda sheet.
" Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
-------------------- " Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
|
DarK_SavioR
addict
Registered: 05/06/01
Posts: 454
Loc: Down the Street
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: Bleuboxo]
#316640 - 05/14/01 12:41 AM (23 years, 6 months ago) |
|
|
No prob on the info, I'm gonna go read up and compare plants and there percentages of tryptamine and dmt and see what all I can find that you can order and stuff. Hopefully I'll get some extra dough to order some of this stuff to play with... also, does anyone know anyway of figuring out the percentage of psilocybe in the shrooms? Aside from eating them and estimating ; )
-------------------- Vitamin C chase, kill the taste. You can tell its nasty by the look on my face.
Ralphster44 & The FSR!
All thats stated above is for humor and a lie!!
|
Humidity
Mad Scientist
Registered: 04/01/00
Posts: 358
Loc: Somewhere in Northeast OH
Last seen: 20 years, 10 months
|
Re: Lets start fresh...DMT substrate [Re: DarK_SavioR]
#316722 - 05/14/01 04:39 AM (23 years, 6 months ago) |
|
|
Wow great research everyone!
Just a thought. Let's hope that the mimosa bark does not contain any unwanted substances like anti-fungal chemicals. If that is the case a extraction might be nessisary or one of the other DMT sources could be tried.
-------------------- _____________________________________________________________________________________
"The greatest enemy of knowledge is not ignorance, it is the illusion of knowledge." -Stephen Hawking
|
Dirtmaster
addict
Registered: 11/20/00
Posts: 194
|
Re: Lets start fresh...DMT substrate [Re: Humidity]
#316725 - 05/14/01 04:46 AM (23 years, 6 months ago) |
|
|
yes i saw that, and no it doesn't mean that dmt will work just because tryptamine does. the fact that they are both precursors in no way implies that both can be absorbed by the mycelium or that this leads to higher concentrations of psylocybin. if you had ever studied biochemistry you would know that cells' and organisms' reaction to different chemicals are drastically different depending on the exact structure of the molecule.
|
gray1
addict
Registered: 04/30/01
Posts: 430
Loc: brooklyn
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster] 1
#316760 - 05/14/01 07:20 AM (23 years, 6 months ago) |
|
|
dirty-
whether supplementing substrates will increase psilocybin/psilocin yield remains to be determined, that is the purpose of this post/experiment.
most people here are suggesting that, based on the metabolic pathways from l-tryptophan to psilocybin/psilocin, it may be possible to increase potency by supplementing with pre-cursors.
this is completely reasonable and worthy of further investigation.
why continue to contribute negative feedback, if you're not interested in this don't post.
c12h16n24ohdmt
|
gray1
addict
Registered: 04/30/01
Posts: 430
Loc: brooklyn
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#316761 - 05/14/01 07:21 AM (23 years, 6 months ago) |
|
|
dirty-
whether supplementing substrates will increase psilocybin/psilocin yield remains to be determined, that is the purpose of this post/experiment.
most people here are suggesting that, based on the metabolic pathways from l-tryptophan to psilocybin/psilocin, it may be possible to increase potency by supplementing with pre-cursors.
this is completely reasonable and worthy of further investigation.
why continue to contribute negative feedback, if you're not interested in this don't post.
c12h16n24ohdmt
|
Humidity
Mad Scientist
Registered: 04/01/00
Posts: 358
Loc: Somewhere in Northeast OH
Last seen: 20 years, 10 months
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#316848 - 05/14/01 10:55 AM (23 years, 6 months ago) |
|
|
Dirtmaster
Since this chemical is produced by the fungi I do not see why there would be a reason that it could not be absorbed. Its not like we are trying to add caffeine to the subsrate to increase potency. If that was the case I would be on your side saying no way. However, this is a chemical that is the same as the one produced by the fungi so I don't see why it could not be utilized.
I do agree with you there are factors that might affect the absorption, the size of the chemical structure and the overall charge (+, neutral, or -). There might be other factors as well. If you have taken a biochemistry class you should know what these factors are and give us a good explaination of why this will definately fail.
Like gray1 and others have said this is just a theory and the experiments will show if it works or not, but if you have some really good info that will prove this will not work I will be glad to see it. Don't just give negative feedback with out some proof.
Edited by Humidity on 05/14/01 12:59 PM.
-------------------- _____________________________________________________________________________________
"The greatest enemy of knowledge is not ignorance, it is the illusion of knowledge." -Stephen Hawking
|
DarK_SavioR
addict
Registered: 05/06/01
Posts: 454
Loc: Down the Street
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: gray1]
#316850 - 05/14/01 11:00 AM (23 years, 6 months ago) |
|
|
Dirt, the chance still remains that the other chemicals could very well be used by the mycelium and the only way to find out is to test it. You should be more optimistical ; ) It would be nice to be able to case with slightly more expensive stuff and get more potent shrooms. Also, if nobody read my other post... does anyone know a way of judging how much psilocybe is in a shroom? (besides eating it and taking a guess)
Also, I found a chart with other plants and stuff containing the other pre-cursors, here's the link
Did you all know that the tomato plant contains tryptamine? heh, I don't know how much though.
Chart of the other pre-cursors
"Now chew em up and slam the orange juice. Vitamin C chase, kill the taste. You can tell its nasty by the look on my face."
Edited by DarK_SavioR on 05/14/01 01:29 PM.
-------------------- Vitamin C chase, kill the taste. You can tell its nasty by the look on my face.
Ralphster44 & The FSR!
All thats stated above is for humor and a lie!!
|
gray1
addict
Registered: 04/30/01
Posts: 430
Loc: brooklyn
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: DarK_SavioR]
#316858 - 05/14/01 11:18 AM (23 years, 6 months ago) |
|
|
i've just begun reading PIHKAL by Dr. Shuglin and in the idtoruction he explains the process by which he compares the psychoactive effects of different phenylethylamine analogs, read that if you can get ahold of it.
obviously, ingesting them will be highly subjective. a more analytical mehtod would be extracting alkaloids from equal amounts of different test groups and comparing yield. probably would be valuable only if you are proficient in extraction and can readily obtain consistent yields.
by the way, i highly reccomend reading Pihkal.
has anyone read Thikal?
gray1
c12h16n24ohdmt
|
Dirtmaster
addict
Registered: 11/20/00
Posts: 194
|
Re: Lets start fresh...DMT substrate [Re: Humidity]
#317141 - 05/14/01 04:35 PM (23 years, 6 months ago) |
|
|
i'm not saying that i'm sure it won't work. but there is no reason it will work either. that is why suggesting dmt as a supplement is "highly speculative". in absence of evidence to the contrary, one can assume that dmt probably does not work.
that the chemical is produced by the mycelium does not mean it can be absorbed or lead to higher potency. i could elaborate on the subject of biochemistry here, it would be lengthy and boring. suffice to say that most proteins transporting molecules over cell membranes are specific, ie geared toward one particular molecule, with a particular shape, size, polarity etc. and even if dmt was absorbed there is no reason why it would lead to more psilocybine being produced. indeed, exactly the opposite could happen.
the overwhelming majority of molecules cannot be absorbed or utilized by shrooms. thus, chances are dmt won't work.
and i will post my opinion regardless of what anyone says. if you guys truly seeked the truth you would find dissenting opinions refreshing, not threatening. especially so since i probably am better equipped to answer these questions than any of you.
Edited by Dirtmaster on 05/14/01 06:49 PM.
|
Dirtmaster
addict
Registered: 11/20/00
Posts: 194
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#317151 - 05/14/01 04:45 PM (23 years, 6 months ago) |
|
|
and yo, don't get me wrong here, i'm not discouraging folks from trying out new things.
feel free to experiment all you want. experientia docet stultos.
|
jonnyshaggs420
Pooh-Bah
Registered: 08/08/00
Posts: 1,965
Loc: Mid-West
Last seen: 19 years, 2 months
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#317156 - 05/14/01 04:46 PM (23 years, 6 months ago) |
|
|
The transport sites on cells don't only allow one type of molecule in. They are not 100% specialized. There are many competitor molecules for many of the sites. DMT could has very little chemical difference then Tryptamine. While the organism will react differently to the slight chemical change, its chances of affecting its uptake of DMT over tryptamine is not very large. After all DMT differs from tryptamine by only two methyl groups. Considering there is a minute amount of DMT in every living organism, shrooms probably utilize the small amount present in dung already and that could be part of the reason you can get more potent shrooms from poop.
I can see a world where this is no poverty and no war, I can also see us attacking that world because they would never expect it.
-------------------- Vote Jonnyshaggs in the next election for GOD...Its the responsible choice
|
jonnyshaggs420
Pooh-Bah
Registered: 08/08/00
Posts: 1,965
Loc: Mid-West
Last seen: 19 years, 2 months
|
Re: Lets start fresh...DMT substrate [Re: jonnyshaggs420]
#317157 - 05/14/01 04:48 PM (23 years, 6 months ago) |
|
|
Psilocin only differs from tryptamine by a single oxygen atom.
I can see a world where this is no poverty and no war, I can also see us attacking that world because they would never expect it. Edited by jonnyshaggs420 on 05/14/01 06:49 PM.
-------------------- Vote Jonnyshaggs in the next election for GOD...Its the responsible choice
|
Dirtmaster
addict
Registered: 11/20/00
Posts: 194
|
Re: Lets start fresh...DMT substrate [Re: jonnyshaggs420]
#317162 - 05/14/01 04:51 PM (23 years, 6 months ago) |
|
|
you have no idea what you're talking about. in this context, two methyl groups is an enormous difference, so is one oxygen atom.
|
jonnyshaggs420
Pooh-Bah
Registered: 08/08/00
Posts: 1,965
Loc: Mid-West
Last seen: 19 years, 2 months
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#317168 - 05/14/01 04:59 PM (23 years, 6 months ago) |
|
|
If we were talking about complete diffusion into a normal cell than it would be completely different, but seeing as these cells are specialized for nutrient uptake they are not that selective, somewhat like the roots of plants. If you have alot of metals in your soil your plants will take them into there system and store them. If the mycelium will take it up then it will use it.
I can see a world where this is no poverty and no war, I can also see us attacking that world because they would never expect it.
-------------------- Vote Jonnyshaggs in the next election for GOD...Its the responsible choice
|
Bleuboxo
enthusiast
Registered: 04/05/01
Posts: 196
Loc: Geographic Location (Stat...
Last seen: 23 years, 4 months
|
Re: Lets start fresh...DMT substrate [Re: jonnyshaggs420]
#317214 - 05/14/01 05:40 PM (23 years, 6 months ago) |
|
|
well hey, enough speculating, we'll specualte after someone tries it and posts results. not a flame. its just stuff we dont even need to get in to. if it works hey good job for us for discovering it. let it be known that i have just ordered 50g of mimosa bark and it should get here within a week. after that about 10-12 days til jars are fully colonized and ready to be cased. after that im going to add all of this bark to the casing and see if that works. in a month expect results.
" Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
-------------------- " Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
|
Dirtmaster
addict
Registered: 11/20/00
Posts: 194
|
Re: Lets start fresh...DMT substrate [Re: Bleuboxo]
#317254 - 05/14/01 06:04 PM (23 years, 6 months ago) |
|
|
bleuboxo, i think we are in agreement. please do experiment.
the only problem is that you'll never know if it actually does raise potency since you don't have a lab, and thus neither can grow batches under controlled conditions nor gauge potency with acceptable accuracy.
as to johnny's statement that it is certain the mycelium will make more psilocybine given that it does absorb the dmt, that's incorrect. it might just as well inhibit the production of psilocybine.
|
DarK_SavioR
addict
Registered: 05/06/01
Posts: 454
Loc: Down the Street
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#317270 - 05/14/01 06:17 PM (23 years, 6 months ago) |
|
|
Either way there's three possible turnouts... 1) it works, more potent shrooms, 2) It does nothing at all, 3) its worse than using normal casing.
Only one way to find out. As for the potentcy of the shrooms. We're not gonna be getting down to the specific percentage (at least not right now), I'm pretty sure you could tell if the shrooms are more potent than normal... if so, thats when we'll get down to the specific percentages. As for now, all we can do is guess and check. Everyone is making good points as to what could happen, but in the end everyone is just making guesses based on what they know. Saying its gonna work is just as ignorant as saying it isn't going to work, all anyone can say right now is that it might work.
Blueboxo... You should innoculate other cakes with the same spores and case them normally just to compare results in the end.
Edited by DarK_SavioR on 05/14/01 08:20 PM.
-------------------- Vitamin C chase, kill the taste. You can tell its nasty by the look on my face.
Ralphster44 & The FSR!
All thats stated above is for humor and a lie!!
|
Anonymous
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#317278 - 05/14/01 06:23 PM (23 years, 6 months ago) |
|
|
And how are you better equiped then everyone else at this BB? I don't find chemistry boring!! Explain to us how mycelium won't take up any of the substances recommended on this or any other related post. Why won't the mycelium absorb DMT, but will absorb Pure tryptamine? Teach us!!! Everyone here is very interested. I passed college biochem.
|
Dirtmaster
addict
Registered: 11/20/00
Posts: 194
|
Re: Lets start fresh...DMT substrate [Re: ]
#317365 - 05/14/01 07:37 PM (23 years, 6 months ago) |
|
|
sorry, i'm tired of repeating myself, i have explained several times already. do what you will and good luck.
|
Bleuboxo
enthusiast
Registered: 04/05/01
Posts: 196
Loc: Geographic Location (Stat...
Last seen: 23 years, 4 months
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#317581 - 05/14/01 11:57 PM (23 years, 6 months ago) |
|
|
well actually my whole room is a lab. i live with my girlfriend in a one bedroom ghetto apt. in DC...so i just turned the bedroom into a sterile environment. the walls are covered with cardboard, the floor is vinyl tile ( one big tile ). its very easy to clean and many containers in the room. i was planning to do one casing with mimosa, and the others without. trust me, if it raises potency i will know it. the strain is B+ and cambodian. these two strains will be cased with mimosa and the other casings wont. ive ate them enough to say i know the regular dosage. its about 2g for a light trip. if i eat 1g off the mimosa casings, and they give me a buzz, i know it has worked. i just sold all my lab equip. so i cant do any testing either, but i never was that advanced in the 1st place.
" Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
-------------------- " Insanity is just a thread of reality...the make-as-you-go part of living, the bare second reflex of dying _Stavros Christou... by_"
|
Explorer
Stranger
Registered: 05/04/01
Posts: 24
Last seen: 20 years, 2 months
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#317674 - 05/15/01 01:34 AM (23 years, 6 months ago) |
|
|
Hey, Dirtmaster, your brain does it all the time. Your brain manufactures DMT br methylating tryptamine twice. All the mycelium needs to do is remove one oxygen atom. Dr. Richard Strassman, in DMT - The Spirit Molecule, describes Psilocin as "orally active DMT". Certain Psilocybe strains even contain tiny amounts of DMT, which would suggest that the mycelium is using the accepted conversion path from tryptophan to psilocin, via DMT. Where else is it getting the psilocin from? It will take Tryptamine, Tryptophan, or perhaps any chemical on that path of precursors, as raw materiial for making psilocin/psilocybin. This isn't exactly speculation if we're following someone elses work, is it? That's what I'm doing. I read that DMT added to substrate made shrooms up to 4 times more potent. Why should that work, I thought? Then I began studying. It does make sense.
And, Bleuboxo, I think the DMT was added earlier, for the mycelium to feed on, prior to innoculation. The mycelium should be exposed from the word go, that way the mycelium will already be super-potent before it's left the jar. Could be wrong, but that's how it was reported. Just casing with mimosa bark won't give you much of a hike. In the experiment I'm following, 100mg of pure, crystaline N.N.DMT was added to a 50/50 rice flour vermiculite mix in a half=pint jar. This was then innoculated, colonized and fruited as normal to produce these super shrooms. If Mimosa bark is to be used without extraction, I'd say it would have to be used with something like vermiculite as the initial substrate to innoculate.
Edited by Explorer on 05/15/01 03:45 AM.
|
Explorer
Stranger
Registered: 05/04/01
Posts: 24
Last seen: 20 years, 2 months
|
Re: Lets start fresh...DMT substrate [Re: Explorer]
#317681 - 05/15/01 01:49 AM (23 years, 6 months ago) |
|
|
For information on the theory behind extraction of DMT from organic sources, check this manual out.
http://www.tryptamine.net/dmt/
It is free to download and distribute, just don't take credit for it and don't make any money out of it.
|
DarK_SavioR
addict
Registered: 05/06/01
Posts: 454
Loc: Down the Street
Last seen: 22 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: Explorer]
#317740 - 05/15/01 06:41 AM (23 years, 6 months ago) |
|
|
wow, thats a nice site. Thanks for posting that up, I'm sure it can/will come in handy ; )
"Now chew em up and slam the orange juice. Vitamin C chase, kill the taste. You can tell its nasty by the look on my face."
-------------------- Vitamin C chase, kill the taste. You can tell its nasty by the look on my face.
Ralphster44 & The FSR!
All thats stated above is for humor and a lie!!
|
synaptic
newbie
Registered: 05/23/01
Posts: 36
|
Re: Lets start fresh...DMT substrate [Re: DarK_SavioR]
#330329 - 05/31/01 01:35 AM (23 years, 6 months ago) |
|
|
maya-ethnobotanicals.com -- fast service, good customer support
has pre-ground mimosa hostilis root bark "incense"..
my friend snagged 150gm for $64US with shipping.. received in a week from around the world.
product looks nice.. have yet to extract it
|
synaptic
newbie
Registered: 05/23/01
Posts: 36
|
Re: Lets start fresh...DMT substrate [Re: Humidity]
#330331 - 05/31/01 01:39 AM (23 years, 6 months ago) |
|
|
> L-tryptophan --> tryptamine
> tryptamine --> N-methyltryptamine
> N-methyltryptamine --> N,N-dimethyltryptamine
> N,N-dimethyltryptamine (DMT) --> psilocin & psilocybin
Instead of seeking to boost psilocin/psilocybin levels, I think another important quest would be to disable the reaction that converts DMT to psilocybin/in. DMT producing mushrooms would be a far greater renewable resource than harvesting root bark from Mimosa trees that take years and years to grow.
Sure, DMT isn't active orally without MAO inhibitors. Someone said that Psilocybin/in is a more potent tryptamine than DMT. I don't think that's true at all. I think DMT is just more readily destroyed by the body than psilocybin/in because it's part of the normal chemistry of the body. DMT seems like far more potent, imho. There are good points to a 30-60 minute duration too.
|
Opi
newbie
Registered: 11/12/00
Posts: 22
Last seen: 22 years, 8 months
|
Re: Lets start fresh...DMT substrate [Re: synaptic]
#330368 - 05/31/01 03:13 AM (23 years, 6 months ago) |
|
|
Which is more potent depends on if you judge potency in milligrams, or by a typical dose.
OPI
|
uneasyone
tokin theMacGyver bong
Registered: 06/12/03
Posts: 299
Loc: SE united states
Last seen: 10 years, 10 months
|
Re: Lets start fresh...DMT substrate [Re: Humidity]
#1649347 - 06/20/03 06:48 PM (21 years, 5 months ago) |
|
|
why bother with extraction why not just order dmt from jmar chemical co. they'll sell it to anyone and it would be alot more convenient
http://www.jmarchemical.com/5meodmt.html
you can also buy pure tryptamine from the same company for the low price of 99 dollars for 50 grams
http://www.goemerchant7.com/index.cgi?PageToView=catalog&Department=123021&Cartid=30801055798227&Merchant=JMCReSale&ExpandedDepts=113036
uneasy1
-------------------- anything i might say is just something i heard from the voices in my head
uneasy1
|
brainnoise
journeyman
Registered: 05/23/00
Posts: 69
Last seen: 21 years, 5 months
|
Re: Lets start fresh...DMT substrate [Re: Humidity]
#1650097 - 06/20/03 11:58 PM (21 years, 5 months ago) |
|
|
Would the DMT containing Grasses have to have the DMT extracted? Would it be easier to just grind up the grasses (or the root bark) and add it to your substrate? What would be a more sujective way of measuring the psylicyban content of the modified substrate over the control substrate? I have thought of doing a basic chemistry extraction: since psylocybes are water soluble, you can make a tea concentrate with dry mushies only- water weighs too much and could significantly effect the data. filter the resulting fluid and standardize then dry it- this should leave a residue.
In theory, the "enhanced" substrate would leave more residue. would that work? or are the amounts to minute to give us significant results.
I am not sure what the necessity of adding enhancers to the mushies, alas the addition of any protein, I believe would enhance the psylocybian content of any mushy.
|
micro
bunbun has a gungun
Registered: 05/09/03
Posts: 7,532
Loc: Brick City
|
Re: Lets start fresh...DMT substrate [Re: brainnoise]
#1650789 - 06/21/03 11:07 AM (21 years, 5 months ago) |
|
|
-------------------- Any research paper or book for free
(Avatar is Maxxy, a character by Mizzyam, RIP)
|
ripper225
Stranger
Registered: 09/23/05
Posts: 16
Last seen: 17 years, 10 months
|
Re: Lets start fresh...DMT substrate [Re: micro]
#4712121 - 09/25/05 10:36 PM (19 years, 2 months ago) |
|
|
dirtmaster you tool AAHAHAA
so anyways, how'd this experiement turn out?
|
shymanta
Mad Scientist
Registered: 01/27/05
Posts: 907
|
Re: Lets start fresh...DMT substrate [Re: ripper225]
#4712296 - 09/25/05 11:10 PM (19 years, 2 months ago) |
|
|
Another source of DMT is a toad venom. It has DMT, 5-MeO-DMT, and 5-HO-DMT in it. To what concentration, I don't know but it would be an abundant source if you could house the Bufo Alvarius toad. I have thought about putting some in substrate but have wondered about the heat in sterilization destroying the goodies.
|
muaddib
Stranger
Registered: 06/29/04
Posts: 2
Last seen: 19 years, 2 months
|
Re: Lets start fresh...DMT substrate [Re: shymanta]
#4718498 - 09/27/05 02:10 AM (19 years, 2 months ago) |
|
|
OK, since someone else dredged up this post, may I seek that those that participated in this circle of speakers in the (now) ancient past, convey any knowledge that they learned in this endeavor, or did you just sit on the piles of shrooms you grew
|
Ascension
Stranger
Registered: 01/13/05
Posts: 156
Loc: Still trying to work it o...
Last seen: 18 years, 5 months
|
Re: Lets start fresh...DMT substrate [Re: muaddib]
#4718705 - 09/27/05 05:42 AM (19 years, 2 months ago) |
|
|
Okai, even if the shrooms will take the dmt and convert to psilocybin, why bother at all the effort, sure your skipping ahead a few steps from nitrogen by why when adding nitrogen is much easier and simpler, and it will do exactly the same thing, give the shrooms more precursors for the psycolbin. (eg using horse poo or blood and bones fertilizer etc)
Besides bombarding the shrooms with the precursor it needs for psilocybin IS NOT going to make it suddenly produce a whole lot of extra psilocybin. The gentic make up of the shrooms is only going to let it produce X amount of psilocybin content even with a more then optimal level of nutrients.
In other words, if your already going with horse poo or adding the nutrients manually you are getting the most potent shrooms you can possibly get with that genetic make up and the only way to get stronger shrooms is change strains or breed the strongest ones.
If your getting DMT I would eat it with MAOIs and not waste it on a shrooms.
Its a waste of time, if you want a super strong shroom, either genetically modify the shrooms (yeah right) or just keep breading the most potent shrooms, and maybe one day we'll end up with the equivalent of skunk.
Sorry to burst anyones bubble but thats what my years of microbiology and chemistry classes at uni have come to make me believe, but if anyone can prove me wrong, I would love it!
|
MagicalMystery
turn off yourmind
Registered: 07/27/05
Posts: 1,740
Loc: Here, there and everywher...
Last seen: 19 years, 22 days
|
Re: Lets start fresh...DMT substrate [Re: Dirtmaster]
#4718818 - 09/27/05 07:22 AM (19 years, 2 months ago) |
|
|
Quote:
Dirtmaster said: this is all bullshit. just because tryptamine might raise potency, that doesn't mean dmt or tryptophan or lsd will raise potency. groundless speculation...<br><br>
Are you really this dumb? Dr Shulgin thinks it will. J Gartz demonstrated that it does. but YOU don't?
--------------------
"Men trained in arms from their infancy, and animated by the love of liberty, will afford neither a cheap or easy conquest."
From the Declaration of the Continental Congress
"We can have peace and security only as long as we band together to preserve that most priceless possession, our inheritance of European blood."
Charles A. Lindbergh,"Aviation, Geography, and Race", Reader's Digest, Nov. 1939
"We must secure the existance of our people and a future for White children."
David Lane
|
mycofile
Pooh-Bah
Registered: 01/18/99
Posts: 2,336
Loc: Uranus
|
Re: Lets start fresh...DMT substrate [Re: Ascension]
#4720633 - 09/27/05 03:21 PM (19 years, 2 months ago) |
|
|
Quote:
In other words, if your already going with horse poo or adding the nutrients manually you are getting the most potent shrooms you can possibly get with that genetic make up and the only way to get stronger shrooms is change strains or breed the strongest ones.
Now I'm no advocate of dmt substrates, but this is a mighty bold statement. "THE ONLY WAY", you sure about that? Poo absolutely maximizes the genetic potential? You got any reference whatsoever? You ever tried any other methods of increasing potency? I doubt it. Because this statement is just not true.
Quote:
Besides bombarding the shrooms with the precursor it needs for psilocybin IS NOT going to make it suddenly produce a whole lot of extra psilocybin. The gentic make up of the shrooms is only going to let it produce X amount of psilocybin content even with a more then optimal level of nutrients.
How can you state this so matter of factly? If it works for psilocin, why are you so insistant that it can't be worked out for psilocybin?
Quote:
Sorry to burst anyones bubble but thats what my years of microbiology and chemistry classes at uni have come to make me believe,
What exactly about your years of microbiology and chemistry have lead you to believe this? I can cetainly think of many things I learned in bio and chem classes that can be applied to increasing potency beyond just using poo as a substrate.
You can say what you do, but it goes against the findings and thinkings of some of the best minds in the field.
-------------------- "From a certain point of view"
-Jedi Master Obi Wan Kenobi
PM me with any cultivation questions.
I just looked at my profile and realized I had a website at one point in time on geocities, it's not there anymore and I have no idea what I had on it. Anybody remember my website from several years aga? PM if so please.
|
The14thWarrior
The Shootist
Registered: 09/28/05
Posts: 491
Last seen: 19 years, 1 month
|
Re: Lets start fresh...DMT substrate [Re: synaptic]
#4723930 - 09/28/05 02:42 AM (19 years, 2 months ago) |
|
|
Are you suggesting using psilocybe cubensis and other psychoactive mushrooms as a source of DMT? I guess you could add something that would prevent the final indolic hydroxylation, but if you want a fast-growing easily replenishable source of DMT, try canary reed grass.
--------------------
|
Ascension
Stranger
Registered: 01/13/05
Posts: 156
Loc: Still trying to work it o...
Last seen: 18 years, 5 months
|
Re: Lets start fresh...DMT substrate [Re: The14thWarrior]
#4724722 - 09/28/05 10:19 AM (19 years, 2 months ago) |
|
|
Okai, the amount of psilocybe that a mushie produces can pretty much be classed as a phenotype. Just as the size of the mushie, the colour of the mushie are all phenotypes. The phenotypes of whatever are of course based on its genotypes. Different genotypes gives different phenotypes. (basic microbio stuff)
Now lets just say a certain genotype encodes a mushie to have a phenotype tall. Say 5 cms on average.
By giving this mushie the right environment (nutrients etc) you may be able to make the height of this mushie grow to 6, 7 cms on average instead of the average 5 cms.
Just like this good environment will make the content of psilocybe extra then normal, as we see in horse poo.
But what ever you are going to do to that environment you are not going to be able to make all the mushies 20cms on tall on average are you???
Just the same way you cannot make all the mushies "SUPER POTENT" just by giving it a whole lot of DMT or whatever.
Im sorry if I came across rude but im not here to fight with people. And if I came across sounding like I know it all im sorry again, because I know I dont know it all, but thats just my personal opinion. I would rather have a convo here thats civilized then some stupid net fight.
"You can say what you do, but it goes against the findings and thinkings of some of the best minds in the field."
Are you saying people have come across substrates that gave super potency in shrooms? If so i would really like to see the info/article on it.
Edited by Ascension (09/28/05 10:22 AM)
|
The14thWarrior
The Shootist
Registered: 09/28/05
Posts: 491
Last seen: 19 years, 1 month
|
Re: Lets start fresh...DMT substrate [Re: Ascension]
#4725856 - 09/28/05 02:42 PM (19 years, 2 months ago) |
|
|
I disagree.
Dr. Shulgin and J. Gartz both demonstrated and theorized that p. cubensis mycelia likes to do what chemists refer to as "indolic 4-hydroxylation. Shulgin said that it does this to almost any compound that it comes across that has the availablity on the 4th position to be hydroxylated (the addition of a -OH functional group). He gives examples of adding DIPT to a substrate and ending up with 4-HO-DIPT.
Your theory about mushroom genetics also is somewhat flawed. If a mushroom can grow to 10", then it isn't genetically limited or predisposed to grow 2". I don't know, nor does anyone that I've read, what the genome of a mushroom looks like or what controls what. I think that their is an up-limit to the amount of psilocybin that can be in a mushroom. Mushrooms that were grown on BRF cakes never seemed that potent to me, especially once I started using a compost/manure/straw/worm casting mixture. Maybe adding DMT would produce more potent mushrooms, I tend to think that it would. The mycelia would almost certainly 4-hydroxyl it and make psilocybin/psilocin.
You really don't seem to have that much knowledge of microbiology or chemistry here, not to be rude. What do you think WOULD happen if you added DMT to a brf/verm substrate? would it be as potent as horse manure / compost grown shrooms?
And yes, Gartz said that adding tryptamine (Which would be processed, eventually, into DMT and then psilocybin) produced more potent fruits.
--------------------
|
Psiloman
member
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 11 years, 3 months
|
Re: Lets start fresh...DMT substrate [Re: The14thWarrior]
#4726609 - 09/28/05 05:49 PM (19 years, 2 months ago) |
|
|
Yes,more potent fruits.
But there is a maximum to every quality which is limited by genetics.For example ,the mushroom can be tiny or non potent if the substrate is not optimal.Also the mushroom can be huge and very potent in optimal conditions. Still though you can expect a psilocybe to reach 5 metres tall (!) or to acquire a 6% concentration of psilocybin/psilocin.Simply,all traits are an outcome of enviromental conditions + genetics within some limits.Maybe after a certain percentage of psilocybin accumulated its production starts getting down regulated.
I guess thats what the poster meant.
|
The14thWarrior
The Shootist
Registered: 09/28/05
Posts: 491
Last seen: 19 years, 1 month
|
Re: Lets start fresh...DMT substrate [Re: Psiloman]
#4727130 - 09/28/05 07:29 PM (19 years, 2 months ago) |
|
|
I agree that their is a "maximum potential" for mushrooms in each category, I just don't see how someone could claim to know what that is and that changine a variable wouldn't push it closer towards that potential.
--------------------
|
Ascension
Stranger
Registered: 01/13/05
Posts: 156
Loc: Still trying to work it o...
Last seen: 18 years, 5 months
|
Re: Lets start fresh...DMT substrate [Re: The14thWarrior]
#4727699 - 09/28/05 09:24 PM (19 years, 2 months ago) |
|
|
Im not claiming I know what the maximum potential is, but i just think we are very close to it. And ive stated my reasons why.
Wouldnt a measure on the nutrients in the substrate before and after the shrooms are grown tell us what we want to know? If all the nutrients have been depleted after the shrooms are grown then chances are theirs still room for improvement. But if the shrooms are not using up all the nutrients that are available to it, then maybe it has reached its maximum genetic potential?
If its not using all the nutrients in the soil then whats the point of adding DMT to the substrate?
Theres been heaps of talk about adding DMT/TRYP etc to the substrate for god knows how long, im sure people have done it too, but how many reports have their been about super potent shrooms.
The environment can only do so much, the genetics gives the range of these things to happen in. Its like saying you want to grow a strawberry fruit thats weighs a kilo just by changing the environment it grows in. Its not going to happen.
I never said changing a variable wont push it close to its limits, obviously it will.
Are you trying to say that the shrooms will add a phosphate group to the all the DMT that we add to give us psilocybin?
Edited by Ascension (09/28/05 09:26 PM)
|
The14thWarrior
The Shootist
Registered: 09/28/05
Posts: 491
Last seen: 19 years, 1 month
|
Re: Lets start fresh...DMT substrate [Re: Ascension]
#4727789 - 09/28/05 09:36 PM (19 years, 2 months ago) |
|
|
No, I said that it will add a HYDROXYL functional group at the 4 position. 4-HO-DMT, the phospate ester being 4-HO-DMT as well. Not sure if it would phosphate.
--------------------
|
Ascension
Stranger
Registered: 01/13/05
Posts: 156
Loc: Still trying to work it o...
Last seen: 18 years, 5 months
|
Re: Lets start fresh...DMT substrate [Re: The14thWarrior]
#4728248 - 09/28/05 10:35 PM (19 years, 2 months ago) |
|
|
But the whole point of this discussion is if the shrooms will turn the DMT into psilocybin?
For that to happen a phosphate group needs to be added someway or another to the DMT correct?
Like I said before, im still new to all this shroomery stuff, so I dont want to sound like im coming across acting like I know all about this.
Unless the shrooms uses the 4-HO-DMT as an intermediate precursor between the DMT and psilocybin? Which im taking a stab in the dark and saying this process resembles the natural process the shrooms take to prodcued the psilocybin?
Either way, their has to be a limit according to the gentic makeup of the shrooms which dictates how much psilocybin can be produced, and ive always believed mother nature to be a master when it comes to this stuff. Thats why I believe we cant be far of the limit, and any advances that are made in making a more potent shroom is not going to be anywhere near as much of a leap as brf/verm to horse poo was.
Edited by Ascension (09/28/05 10:42 PM)
|
The14thWarrior
The Shootist
Registered: 09/28/05
Posts: 491
Last seen: 19 years, 1 month
|
Re: Lets start fresh...DMT substrate [Re: Ascension]
#4728315 - 09/28/05 10:44 PM (19 years, 2 months ago) |
|
|
4-HO-DMT is psilocin, with a phosphate ester is it psilocybin. I am unsure of the metabolic pathway from this psilocin to the +P psilocybin.
--------------------
|
mycofile
Pooh-Bah
Registered: 01/18/99
Posts: 2,336
Loc: Uranus
|
Re: Lets start fresh...DMT substrate [Re: Ascension]
#4728424 - 09/28/05 10:58 PM (19 years, 2 months ago) |
|
|
Ascension, I would like to politely state that I thinik you are over your head and not contributing much to this discussion.
You don't think that better results can be had than growing mushrooms on horse poo. So just grow your mushrooms on horse poo.
And ignore that mushrooms have been grown that are far more potent (as measured by total psilly production) than anything you'll grow off of horse poo alone.
Look, it's really simple. There is well documented proof that adding tryptamine increases psilocin production DRAMATICALLY. Now, you can say it doesn't happen all you want, but you can take it up with Dr. Jochen Gartz, I'll give you his email address if you like. Although with your baseless statements and misguided analogies you'll be lucky if he even refers you to his paper on the subject.
Given that DMT is further along in the metabolic pathway than tryptamine, there is a chance that it too will have a similar effect. There are lots of good reasons why it might not work, but none of them are the ones you are posting.
If you have some specific detailed reason why the fungus won't process dmt into psilos like it does tryptamine, then I'm all ears. Otherwise let's just wait for somebody to actually do the experiment.
-------------------- "From a certain point of view"
-Jedi Master Obi Wan Kenobi
PM me with any cultivation questions.
I just looked at my profile and realized I had a website at one point in time on geocities, it's not there anymore and I have no idea what I had on it. Anybody remember my website from several years aga? PM if so please.
|
Ascension
Stranger
Registered: 01/13/05
Posts: 156
Loc: Still trying to work it o...
Last seen: 18 years, 5 months
|
Re: Lets start fresh...DMT substrate [Re: mycofile]
#4728768 - 09/28/05 11:44 PM (19 years, 2 months ago) |
|
|
okai, great. Like I said a million times before, im still all new to this mushroom stuff. And just for the record I never said that it would not process the DMT or Tryptamine into psi, I just said there must be some kind of limit, eg you cant pump it full with DMT and hope to get shrooms with 50% psi content. And that this limit is dictated by the genetics, but if their is proof that added tryptamine increases potency dramatically, then we are obviously no where near the potential we could be at with horse poo.
Im not doubting you one bit, but can you please post the papers of the added tryptamine, because i would love to read up on it. Do you have info on the metabolic pathway to psi? Because im sure their are heaps of OTC products, especially body builder suppliments that will contain the intermediate along that pathway.
How about addind Melatonin (5-methoxy-tryptamine), its as easy to get as milk and bread from any chemists. Infact ive got a bottle upstairs somewhere. Id love to test it out mixed in with the next batch.
|
BaldCuban
scruffy-looking
Registered: 03/29/00
Posts: 337
Loc: here, there, everywhere
|
Re: Lets start fresh...DMT substrate [Re: Ascension]
#4729980 - 09/29/05 04:41 AM (19 years, 2 months ago) |
|
|
Quote:
Ascension said: okai, great. Like I said a million times before, im still all new to this mushroom stuff.
The most brilliant statement you have made in this thread. You have much to learn about mycology. Sometimes that requires looking stuff up and reading.
http://www.shroomery.org/index/par/24373
http://www.shroomery.org/index/par/7953
There is even more information available out there than what is contained in this site. Look up Jochen Gartz on google for starters. No one is claiming to increase psilocybin production beyond the genetic capability of the fungus. Of course there are limits. Discredit Gartz's work when you have a better grasp of the higher fungi. Maybe it can be your master's thesis. Until then your opinion isn't worth horse shit and brown rice.
|
mycofile
Pooh-Bah
Registered: 01/18/99
Posts: 2,336
Loc: Uranus
|
Re: Lets start fresh...DMT substrate [Re: Ascension]
#4732499 - 09/29/05 03:50 PM (19 years, 2 months ago) |
|
|
Quote:
Do you have info on the metabolic pathway to psi?
Well, humidity posted this earlier in this very thread:
Quote:
L-tryptophan --> tryptamine tryptamine --> N-methyltryptamine N-methyltryptamine --> N,N-dimethyltryptamine N,N-dimethyltryptamine (DMT) --> psilocin & psilocybin
I didn't fact check it, but I'm sure you can if you want.
Quote:
How about addind Melatonin (5-methoxy-tryptamine),
Well, here's a thread I read less than 24 hours ago: http://www.shroomery.org/forums/showflat...rue#Post4534263 There are other posts on the subject which you could find if you search. In the mushroom areas of this site alone, there are 5 threads with the word melatonin in the title over the last 5 years, 11 threads with the word in the title or body of the main post, and 88 occurances of melatonin within main posts and responses. You should have no trouble finding them.
Here's a little tip on the advanced forum though. If you read a post about something you don't understand, it's best for you to search for related posts which might spell it out for you. It's a little frustrating to have to provide people with the basic information about a subject rather than discussing the subject itself. It's especially frustrating when this comes up because somebody is refuting the basics involved without even knowing about them....It's ok to be new, it's ok to not know everything, and it's ok to even disagree with people. But in the advanced forum all of this goes over better if you have done your research first.
-------------------- "From a certain point of view"
-Jedi Master Obi Wan Kenobi
PM me with any cultivation questions.
I just looked at my profile and realized I had a website at one point in time on geocities, it's not there anymore and I have no idea what I had on it. Anybody remember my website from several years aga? PM if so please.
|
radio943dmt
Stranger
Registered: 11/18/05
Posts: 16
Last seen: 18 years, 3 months
|
Re: Lets start fresh...DMT substrate [Re: mycofile]
#5026032 - 12/06/05 09:44 PM (19 years, 1 day ago) |
|
|
There are two Gartz studies, i copied and pasted my reply to another DMT thread to this one so when people do a search they'll see my post,
It looks to me from this study:
Addition of DET Gartz study (Oct. 1988) http://www.geocities.com/radio879z/psilocybebio.pdf
And this study already on the shroomery,
Addition of Tryptamine Gartz study (March 1988): http://www.shroomery.org/index.php/par/7953
That addition of DMT to the substrate may provide just as much potentiation / increase in psilocin as adding Tryptamine HCl.
Both studies show 5 flushes and up to 3.3% 4-hydroxy-DET/DMT out at the end.
Here's another image,
http://www.geocities.com/radio879z/psilocybes_enzymesteps.gif
A friend of mine in another country recently got ahold of a couple grams of Tryptamine freebase, and he does have mimosa bark and DMT, also his friend has access to analysis equipment..
So hopefully sometime soon he'll be able to inoculate several jars, some with tryptamine added, some with ground up mimosa bark added, a jar or two with nothing added..
Now, its easy to make the HCl salt of tryptamine, but just as easy to make the phosphate salt (he has some phosphoric acid), and the point of making a salt of Tryptamine (or DMT) is to make it water soluble right? so..
Quote: The results in Table 1 show that the enzyme systems in Psilocybe cubensis have a high hydroxylation and methalation capacity to convert added Tryptamine to psilocin. It is possible that a reduced amount of phosphate in the culture media decreased the bio-synthesis of psilocybin from psilocin in the media.
For psilocybin, for the phosphoryloxy group, where does it get that from? I would think possibly using phosphoric acid instead might result in more psilocybin production, he has IMed DMT phosphate solution before, adding 1/3 molar phosphoric acid (1 molecule of phosphoric acid can attach to 3 DMT molecules, enough to make it water soluble), but each psilocybin molecule has its own so I could add an equal molar amount of phosphoric acid per tryptamine or DMT molecule, i'm wondering what is the best ph, or a range for the ph that the substrate should or could be for proper growth?
I haven't read up on it but some of you might know, what effect does ph have on mushroom growth in general? How much phosphoric acid could he add to the substrate mix, to add more phosphoric acid but not let the ph drop too low?
It'll be a while til he could get some results, but from everything i've read it seems like adding either tryptamine or DMT to the substrate would probably produce super incredibly potent mushrooms, probably equally, but since Tryptamine is hard to obtain - mimosa root bark IS NOT hard to get and INCREDIBLY cheap!
In that study i linked to above (Oct. Gartz study) they added DET (also talks about adding NMT resulting in more baeocystin), got mushrooms with as much as around 3.3% of the dry weight of 4-HO-DET out (same percent as adding Tryptamine HCl), both studies show a chart with 5 flushes and similar % numbers.
Now i'm not sure why this hasn't 'caught on' yet, because people HAVE added DMT to the substrate and gotten super potent mushrooms out, and if its as easy as simply adding a little ground up mimosa hostilis root bark to your substrate i'd think once enough people started doing it, ...well who wouldn't want to do it?
Typically mimosa bark has 0.57% DMT by weight (average maybe.. often more), thats around 50mg per 10g bark, I got some info from someone who's added different amounts of DMT per jar and found that for a "pf style" jar, 30mg - 40mg produced more potent mushrooms and 50mg seemed to be the max in his experiments they would take, and adding 60mg+ didn't hurt anything but didn't add any more potency than 50mg - but the 50mg or more jars produced some mega godly potent shrooms!
So looking at those numbers lets say typical dried mushrooms contain 0.6% combined psilocin & psilocybin, so a 5 gram cubensis trip would be around 30mg psilocin/psilocybin (correct me if my numbers are off).
Now if you have dried cubensis with average 3.0% psilocin then 5 grams would be more like 150mg's.. 5x as potent, or lets say even 2.0% would be over 3x potency, which seems to be what people have been reporting from just adding DMT (at least 2x, up to around 5x potency, depending on flush and other things).
The price of 1kg mimosa root bark can be had for as low as $100, enough for 100 "pf style" jars, costing $1 per jar to add 10g bark for such a huge potency increase..
Ok even if you didn't get 5x potency by just tossing in 10g bark, a dollar for 2x potency at the lowest, ain't too bad..
--- I don't know if its ok (against the rules or what) but I have bags of mimosa bark just 'laying around' with nothing to do which i'd happily give away to anyone (the bark is legal to have) wanting to hang up for ordamental purposes or anything not illegal of course.
I'd love someday to see a Mega thread on the shroomery sorta like that coffee thread, just about people's experiences with adding Mimosa root bark to their substrate, I think its one of those things that just hasn't 'caught on' yet but would if people actually started trying it (did i mention how CHEAP the bark is?? )
|
70skid
Stranger
Registered: 10/19/05
Posts: 38
Last seen: 15 years, 9 months
|
Re: Lets start fresh...DMT substrate [Re: radio943dmt] 1
#5026121 - 12/06/05 09:58 PM (19 years, 1 day ago) |
|
|
how do you extract the DMT? and if you can extract it, why not just trip off it? supposed to be THE best hallucinogen around.
|
scattass
thatsMr.scattass toyou
Registered: 10/25/04
Posts: 421
Last seen: 5 years, 8 months
|
Re: Lets start fresh...DMT substrate [Re: 70skid]
#5026820 - 12/07/05 12:28 AM (19 years, 1 day ago) |
|
|
-------------------- George Bush has all the symptoms of schizophrenia, dellusions, (WMD + Iraq's nuclear weapons program) vauge-impoverished speech, hearing voices (god told him to invade Iraq) paranoia and delusion of grandure. -some guy
|
70skid
Stranger
Registered: 10/19/05
Posts: 38
Last seen: 15 years, 9 months
|
Re: Lets start fresh...DMT substrate [Re: scattass]
#5031576 - 12/07/05 10:47 PM (19 years, 14 hours ago) |
|
|
read that once before... seems like way too much work to then add to substrate
|
radio943dmt
Stranger
Registered: 11/18/05
Posts: 16
Last seen: 18 years, 3 months
|
Re: Lets start fresh...DMT substrate [Re: 70skid]
#5031898 - 12/07/05 11:32 PM (19 years, 13 hours ago) |
|
|
noooooo.... guess I didnt say it but what I mean was,
The point being is, you dont have to extract anything!
All you would need to do is directly add in a small amount of ground up mimosa root bark, mix it right in with the substrate... i'd guess 10g bark for a 'pf style' jar but who knows. You don't have to do anything but take a tiny bit of bark, put it in a blender or coffee grinder, blend it up, mix it in with some substrate and there ya go.
Thats the easiest way, i'd probably add a little bit of hcl or phosphoric acid just to make it all more water soluble, -- if i do this test with all these jars i'll do a couple this simple way, others add a little phosphoric acid etc.
So basically, what work? a dollar or two worth of mimosa bark, 5 minutes of blending it in a blender and yer all done. Sounds like a good plan to me! hehe.
|
MisterMyco
Myco-fanatic
Registered: 12/08/05
Posts: 636
Last seen: 18 years, 9 months
|
Re: Lets start fresh...DMT substrate [Re: Bleuboxo]
#5034559 - 12/08/05 03:39 PM (18 years, 11 months ago) |
|
|
I just got my e-mail from cognitive liberty that a new "Ask Dr. Shulgin" was available that deals with this somewhat. Dr Shulgin was sick for a little bit and in the hospital with pneumonia and has just gotten back on his feet enough to deal with some of the back issues. I believe that his book dealing exclusively with psychedelic chemicals in a Merck Index format is due for release soon and I think hes still dealing with that.
http://www.cognitiveliberty.org/shulgin/blg/
This deals with the compound 4,5-HO-MeO-DMT primarily but he discusses a study and a patent by Gartz that led Shulgin to the conclusion that Psilocybe mycelia has a natural tendancy to add a hydroxy funtional group on the four position of almost any compound that it came upon. Using this logic, I could see how n,n,-DMT could be so modified to produce 4-HO-DMT(psilocin) by the mycelia. One thing that I'd like to point out from the article that struck me as being possibly important;
Quote:
He has taken things like DPT or DIPT and put them in the growth media and the fruiting bodies that came out contain 4-hydroxy-DPT or 4-hydroxy-DIPT instead of psilocin.
and later in that same paragraph, discussing adding 5-Meo-DMT to a substrate used for mushroom cultivation;
Quote:
This way you avoid a 10 step synthesis by growing a psychoactive mushroom that contains no illegal drug.
These two comments seem to indicate that the compound psilocin was NOT produced, that the mycelia were instead hydroxylating the 5-MeO-DMT to produce 4,5,HO-Meo-DMT. I'm wondering if their is some heirarchy of compounds that the mycelia deals with in a specific order. It would also be possible that the amount of enzymes required to catalyze this reaction would be limited. Thus, you'd end up with the same amount of 4,5-HO-MeO-DMT, as you would psilocin, because the power for the conversion would have just run out.
Now, how do I think that this relates to increasing the amount of psilocin by adding a tryptamine?
I think that the logic behind the theory of hydroxylation of the n,n,-DMT amine to form psilocin is sound. Shulgin and Gartz both sincerely believe that it works and I'm going to credit them as being valuable sources who's work I trust, at least until I could observe any evidence to the contrary myself. The big question would be, would the mycelia be able to perform it's normal function of psilocin production and the added function of hydroxylation of the added amine so that their would be more psilocin in the substrate.
I've tried using plants that are rich in DMT in my substrates before, but I think that a good blend of cow manure, straw, dehydrated seaweed and earthworm compost makes for about the most damn potent fungi possible and I didn't really notice a difference. Maybe their wasn't enough DMT in the subtrate to alter the content to a degree that a human would notice it.
I realize that I typed a lot and didn't really give an answer, sorry abotu that. I hope that someone tries some of the more unique tryptamines out and experiments with their 4-hydroxylated analogue.
-------------------- "I have never, in all my life, not for one moment, been tempted toward religion of any kind. The fact is that I feel no spiritual void. I have my philosophy of life, which does not include any aspect of the supernatural."
Isaac Asimov
|
70skid
Stranger
Registered: 10/19/05
Posts: 38
Last seen: 15 years, 9 months
|
Re: Lets start fresh...DMT substrate [Re: MisterMyco]
#5038130 - 12/09/05 08:04 AM (18 years, 11 months ago) |
|
|
If you're simply looking for a way to trip harder of less shrooms, this thread might be of interest
http://www.shroomery.org/forums/showflat.php/Cat/0/Number/4714757/page/0/fpart/1/vc/1/nt/49
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: Lets start fresh...DMT substrate [Re: 70skid]
#5041268 - 12/09/05 08:39 PM (18 years, 11 months ago) |
|
|
If it was simply about tripping harder on mushrooms, more mushrooms would be eaten. It's not like they're costly if you grow them, hehe. It's the science that's interesting.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
radio943dmt
Stranger
Registered: 11/18/05
Posts: 16
Last seen: 18 years, 3 months
|
Re: Lets start fresh...DMT substrate [Re: Koala Koolio]
#5047209 - 12/11/05 07:38 AM (18 years, 11 months ago) |
|
|
Quote:
These two comments seem to indicate that the compound psilocin was NOT produced, that the mycelia were instead hydroxylating the 5-MeO-DMT to produce 4,5,HO-Meo-DMT. I'm wondering if their is some heirarchy of compounds that the mycelia deals with in a specific order. It would also be possible that the amount of enzymes required to catalyze this reaction would be limited. Thus, you'd end up with the same amount of 4,5-HO-MeO-DMT, as you would psilocin, because the power for the conversion would have just run out.
Well there's this,
Seems in both of the studies they got 'around' 3.3% 4-ho-whatever out, adding tryptamine or DET, thats pretty good.. if its near 100% efficient, i'd guess over 90%.
Normally without adding DMT or tryptamine etc the number (psilocin/cybin combined) its closer to 0.5% (maybe less?) for typical mushrooms. Well my friends friend around the world somewhere plans to try this *sometime* soon, it would be nice to get some numbers figured out - example being just adding ground up mimosa bark, how many grams of bark for x grams substrate? etc. Sort of like a super shroom TEK I guess.
A previous msg from someone who's experimented with adding various amounts of DMT to substrate to 'pf style' jars, found that as long as it was at least 50mg, it'd be fully saturated and adding more won't get you even more potent shrooms - but it wouldn't hurt if there was extra DMT either.
There's at least 50mg's of DMT in only ~6g mimosa bark..
---- Oh yeah, I had a thought about how the couple times I had these REALLY potent cyanescens, I noticed the trip kicked in super fast, recently found this,
http://www.tacethno.com/info/psilocybe/gartz1.txt
It looks like for the most part cyanescens produce a fuckload more psilocin, and cubensis its mostly psilocybin, so a mostly psilocin filled cubensis mushroom grown from some mimosa bark (most of the potentiation will be from 4-ho-dmt) might produce a trip thats just like eating some real super potent cyanescens.
|
Psiloman
member
Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 11 years, 3 months
|
Re: Lets start fresh...DMT substrate [Re: radio943dmt]
#5047412 - 12/11/05 09:14 AM (18 years, 11 months ago) |
|
|
I have a side thought as well : Isnt psilocin less stable than psilocybin? I mean if one aims at long term storage of his fruits maybe a huge amount of psilocin and not too much psilocybin wouldnt be a good idea!
Unless of course one could find a way of forcing mycelium to turn psilocin to psilocybin!
|
radio943dmt
Stranger
Registered: 11/18/05
Posts: 16
Last seen: 18 years, 3 months
|
Re: Lets start fresh...DMT substrate [Re: radio943dmt]
#5047453 - 12/11/05 09:28 AM (18 years, 11 months ago) |
|
|
Found this one trip report he ate some mushrooms with DiPT added,
Quote:
Okay i am not a big writer and am writing this a year after growing and a week after tripping but i will try to give you some information witch might or might not interest the myco- or tripto-files reading this. The idea behind this experiment came after reading the statement of A. Shulgin in his book Tihkal under 4-oh-det that maybe the mushroom was a "x in, 4-oh-x out"-machine, and the papers by J.Garz. I had grown some cubensis using rye. I took one of my jars of completely collonated rye and added 100mg dipt to a small amount of soil and vermucellite. I had done this because in the earlyer stage of rye colonization i would normally loose some jars to infection. After a certain amount of time cubensis mushrooms started to appear. Unluckily i could harvest just a small amount of mushrooms before the rest of the culture got infected. It is with these mushrooms i did my experiment. I had given some to a friend who had reported eating just a little amount. But since the effects did not develop within 15 minutes (and he had taken a small dose) he concluded that he had not had an 4-oh-dipt effect.
Setting: a cottage in sweden Substances: half a B-100 pill, half a C-1000 pill, about 2mg of deprenyl (held under the tung), half a 40mg inderal pill, four OO capsules of mushroom powder with about 3,1 grams of mushroom powder total, half a 50mg tofisopam tablet.
Chronology:
11:00 or 12:00 : had eaten breakfast of pasta from the dinner the day before
13:50 : Decide to take the mushrooms today. And take some b-vit, c-vit (both time release), inderal, and deprenyl. I take the first two almost every day. The deprenyl i take two or three times per week. I should probably have left the deprenyl out. But after an earlyer experience where i had purposefully abstained from deprenyl for 10 days, so as to not mess with my first taste of Methylone, and then found the effect of Methylone (180mg) to be almost completely absent i decided that i should make a point of taking my "medicine"that day (someone else taking 1 mg every day had had no problems with Methylone, and i had read a comment of one guy who had much less effect from mdma when taking 5mg deprenyl three days prior, but not when taking directly prior to mdma). Of course Methylone and mdma are no triptamines, but hey, i did what i did anyway. The inderal was to combat the panic wich sometimes comes over me when taking a psychedelic these days. I did not want the panic to spiral out of control, and thought of it as a possibility to overcome that panic just as stage fright can be overcome by taking inderal once or a few times before an event, and then by positive learning making the use of the substance unneccesary. The inderal impacted my trip but i think it also did do what i intended.
14:00 : I drop the first of four capsules. pack a bag with some provisions and cd's. Put on "bitches brew" by Miles Davis and leave the cottage to have a walk. Short panic, what have i done? Is this what i want? But i go my way and think no more of it. After about ten or more minutes of walking i have an alert that something is happening, but it does not develop.
14:15 : I took another capsule of mushroom powder. Since 4-oh-dipt seems to be a fast and hard hitter i had planned to space the four capsules 15 minutes apart. If the mushrooms tuned out to be more potent than normal mushrooms (wich would mean there would at least be some 4-oh-dipt along with psilocybin, i had read of up to 3% strength with triptamine/DET fed mushrooms) i would have some time to find out before taking a full dose. The swedish scenery was beautiful with little fields with cows forrest, and a little stream running threw. I decide to lay down on a natural stone wall and enjoy the view. No more than the alert before.
14:35 : Take another capsule. I am surprised not to feel any more than i do. Normally i would feel something within half an hour of taking mushrooms. Maybe a year of storage might have decreased potency quite a bit.
14:40 : What the fuck, i drop the last capsule and head back to the cabin. The scenery makes me think this would be a good place to take acid. Probably because it reminds me of switzerland where i had taken my first day time acid.
Ok now the chronology gets lost. I can just estimate. When coming back to the cabin (probably about ten or fifteen minutes after taking the last capsule) i sit down in the garden and look at the lake and the trees surrounding me. I start to feel the trip. It feels different than a mushroom trip. I come to the conclusion that this is : more purple than mushrooms... and think the description is quite funny. Hi hi.. When looking at my surroundings the purpleness reminds me of 2-ct-7 (probably because the package(blue mystic) was blue/purple) and also reminds me of it and other substances because it feels "chemical" (not dirty just not organic). I do not feel a connection with the trees, nature seems uninteresting ( in contrast to mushrooms, lsd, or san pedro). I decide to close my eyes and check it out. A swirling..*snip*
from - http://www.bluelight.ru/vb/showthread.php?s=&threadid=215910&r=4
|
radio943dmt
Stranger
Registered: 11/18/05
Posts: 16
Last seen: 18 years, 3 months
|
Re: Lets start fresh...DMT substrate [Re: radio943dmt]
#5047491 - 12/11/05 09:37 AM (18 years, 11 months ago) |
|
|
Quote:
I have a side thought as well : Isnt psilocin less stable than psilocybin? I mean if one aims at long term storage of his fruits maybe a huge amount of psilocin and not too much psilocybin wouldnt be a good idea!
Unless of course one could find a way of forcing mycelium to turn psilocin to psilocybin!
Yeah probably have to be real careful when drying shrooms with a lot of psilocin (no heat even do it in a refrigerator).
Yeah I am curious about adding phosphoric acid, I just thought about this today too, I think adding the bark itself will lower the ph a little, well - can always add phosphoric acid but then adjust the ph to 7-8 (or whatever is optimal) with some kind of base, NaOH, KOH, NaCHO3/baking soda, calcium, maybe end up adding 100mg's of something-phosphate, whatever works sodium phosphate or something to see if the mushrooms would come out with more psilocybin (or just more 4-phosphoryloxy-whatever's - its gotta get that phosphoric acid from somewhere right?)
|
888
Stranger
Registered: 11/22/05
Posts: 149
Last seen: 18 years, 3 months
|
Re: Lets start fresh...DMT substrate [Re: radio943dmt]
#5056531 - 12/13/05 10:00 AM (18 years, 11 months ago) |
|
|
The most potent mushrooms I've ever had were grown on wild grasses collected near rivers. I always figured dmt just absorbs into the mushroom because its shown as sometimes present in wild mushrooms. I don't know why exactly but I do know wild grasses make more potency.
I would suspect wild grasses have a better overall nutrient complex. I honestly felt the mushrooms really liked the grass. It smelled sweet and they would eat it up quick. Plus they just felt happy.
Would these grasses have anything besides dmt in them that would cause potency increase?
Eating mushrooms freshly picked I think makes for a stronger trip. They taste better than store bought mushrooms.
*Quick tip* after you pasturise your grass dump the grass water where you want to kill weeds. It works. (and cut the grass into small peices 1/2" - 1" , spawn grows faster and its easier at harvest time)
|
neoboom
Stranger
Registered: 08/02/05
Posts: 26
Last seen: 18 years, 9 months
|
Re: Lets start fresh...DMT substrate [Re: 888]
#5120902 - 12/29/05 11:24 PM (18 years, 11 months ago) |
|
|
Ehm, guys..
Use what you have readily available in the world.
Bananas and Tomatoes have tryptamine... easy to get, and not on a watch list.
the metabolic path will take care of the rest.
|
Aloysius
Stranger
Registered: 03/26/06
Posts: 11
Last seen: 18 years, 1 month
|
Re: Lets start fresh...DMT substrate [Re: neoboom]
#5450063 - 03/28/06 06:24 AM (18 years, 8 months ago) |
|
|
Excuse my ignorance, I'm too lazy to read everything, but what are you trying to do here? Create shrooms with DMT in 'em? You'd have to take a MAO inhibitor for it to make use..
neoboom has a point, mixing in some tryptophan rich foods might already do the trick
as for adding phosphor to increase psilocybin production, normal garden fertilizer contains P2O5 amongst other nutrients, could be beneficial to add this to your substrate too.
|
shirley knott
not my real name
Registered: 11/11/02
Posts: 9,105
Loc: London
Last seen: 7 years, 10 months
|
Re: Lets start fresh...DMT substrate [Re: Aloysius]
#5450814 - 03/28/06 10:54 AM (18 years, 8 months ago) |
|
|
this thread is five years old, even the last post is three months ago. c'mon dude, please!
'Advanced Mycology' forum is chock full of threads (approx one in every five, i reckon) concerning adding tryptamines to substrate to increase mushroom potency. every time it's someone who thinks this is a groundbreaking new concept, but has no alternative forum to post this in. since they're usually fairly new themselves, they don't search or even scan the first page for ideas. it'd be a major enhancement to this forum if someone who knows this topic thoroughly could collect and compile a nice stock answer, preferably with the occasional pic to break up the text, that recognises all the major points.
then at least these threads could all be closed and referred to one source. it'll still mean there's at least two threads on the first page dealing with this subject, but at least it won't be eight threads.
anyone wanna take this on?
-------------------- buh
|
Pashasan
eater of smut
Registered: 03/26/06
Posts: 130
Last seen: 17 years, 8 months
|
Re: Lets start fresh...DMT substrate [Re: shirley knott]
#5451419 - 03/28/06 02:00 PM (18 years, 8 months ago) |
|
|
Ummm yeah. Look im not a profetional pharmacologist but i have to point out here DMT is not active in oral dosages without an MAOI like Syrian RUe... soooo i would go ahead and not wasit a substantial amount of DMT on this idea. Post ingestion aplication is prolly the best idea..
(with 350 mg, orally) "Completely without effect either physiological or psychological." *TIHKAL A.Shuglin*
-------------------- blah blah bligity blah i eat reserch chemicals and watch land of the lost
|
Akira
CosmicConsciousness
Registered: 12/30/05
Posts: 2,283
Loc: Hay Un Mundo Mas Alla
Last seen: 11 years, 10 months
|
Re: Lets start fresh...DMT substrate [Re: shirley knott]
#5451805 - 03/28/06 03:55 PM (18 years, 8 months ago) |
|
|
Quote:
shirley knott said: this thread is five years old, even the last post is three months ago. c'mon dude, please!
'Advanced Mycology' forum is chock full of threads (approx one in every five, i reckon) concerning adding tryptamines to substrate to increase mushroom potency. every time it's someone who thinks this is a groundbreaking new concept, but has no alternative forum to post this in. since they're usually fairly new themselves, they don't search or even scan the first page for ideas. it'd be a major enhancement to this forum if someone who knows this topic thoroughly could collect and compile a nice stock answer, preferably with the occasional pic to break up the text, that recognises all the major points.
then at least these threads could all be closed and referred to one source. it'll still mean there's at least two threads on the first page dealing with this subject, but at least it won't be eight threads.
anyone wanna take this on?
Amen to that. Nearly 50% of the threads in this forum are about adding tryptamine to increase potency. Funny thing about it is that most of them are too full of crap to read and come to an intelligent conclusion. Ive read a bunch of of these threads, and still don't know what the final; conclusion. I do think it leans more to the positive side, their is just no scientific proof as no one here really has a chemist lab or the tools necessary to measure the amount of psilocin in the mushrooms.
I say compile a good thread with info on adding tryptamine to add potency and sicky it.
--------------------
Orissa India Bulk Grow (Tub Tek)
Bulk Steamer Pasteurizer Tek
"Our intention is our eternal fingerprint in the universe."
We know that God is good, and so are hamburgers and hot dogs. We know that hamburgers and hot dogs definitely do exist, so then by deduction of logic God too must also exist. Hamburgers + Hot dogs = God.... Duh
|
Ettin
Stranger
Registered: 03/28/06
Posts: 33
Last seen: 18 years, 7 months
|
Re: Lets start fresh...DMT substrate [Re: Akira]
#5451970 - 03/28/06 04:42 PM (18 years, 8 months ago) |
|
|
Ok, now that this has been ranted on for the Nth time, can anyone who has had experience give us a rough estimate of how much of whatever DMT plant you use per 1lb [dry] of poo? Or any scientific documentation thereof?
|
ShroomInduced
I read too manymycology books
Registered: 04/19/05
Posts: 309
Loc: A giant mushroom in my he...
Last seen: 13 years, 3 months
|
Re: Lets start fresh...DMT substrate [Re: Ettin]
#5465274 - 03/31/06 07:35 PM (18 years, 8 months ago) |
|
|
Ill just put some DMT contaning bark in some cakes, and give them to my freinds and see what they think. seems easy enough.
-------------------- That's a deep kiss too, like the Europeans. You know, the French, they have to unhinge their jaw to show love.
Computer Fan Tek
Vote for you favorite strain of cubes 97 choices!
|
Hypercube
80 SRM
Registered: 12/18/05
Posts: 814
Last seen: 11 years, 10 months
|
Re: Lets start fresh...DMT substrate [Re: ShroomInduced]
#5465335 - 03/31/06 08:00 PM (18 years, 8 months ago) |
|
|
Quote:
There is a very interesting study that took place in Leipzig about 15 years ago. Jochen Gartz, a mushroom explorer whom I know quite well, has done some fascinating studies with Psilocybe species by raising them on solid media containing strange tryptamines that are alien to the mushroom. Apparently the enzymes that are responsible for the 4-hydroxy group of psilocin are indifferent to what it is they choose to 4-hydroxylate. He has taken things like DPT or DIPT and put them in the growth media and the fruiting bodies that came out contain 4-hydroxy-DPT or 4-hydroxy-DIPT instead of psilocin. In fact, he has a patent on the process. These active compounds are made by the mushroom so they really are natural and yet they never have been observed in nature. I'll give you even odds that if you put spores of a psilocybe species on cow droppings loaded with 5-MeO-DMT you would come out with mushrooms containing 4,5-HO-MeO-DMT. This way you avoid a 10 step synthesis by growing a psychoactive mushroom that contains no illegal drug.
This is from http://www.cognitiveliberty.org/shulgin/blg/index.html , written by Dr. Shulgin. Just thought it was interesting.
--------------------
|
shirley knott
not my real name
Registered: 11/11/02
Posts: 9,105
Loc: London
Last seen: 7 years, 10 months
|
summary FAQ answer... tryptamine-enhanced substrates? [Re: shirley knott]
#5633144 - 05/15/06 03:19 PM (18 years, 6 months ago) |
|
|
Quote:
shirley knott said: 'Advanced Mycology' forum is chock full of threads (approx one in every five, i reckon) concerning adding tryptamines to substrate to increase mushroom potency. it'd be a major enhancement to this forum if someone who knows this topic thoroughly could collect and compile a nice stock answer, preferably with the occasional pic to break up the text, that recognises all the major points.
anyone wanna take this on?
anyone?
-------------------- buh
|
nimmen
Lycaon
Registered: 05/18/06
Posts: 1
Last seen: 18 years, 6 months
|
Re: Lets start fresh...DMT substrate [Re: shirley knott]
#5645326 - 05/18/06 06:48 AM (18 years, 6 months ago) |
|
|
would you mind putting links to your posts of dmt extraction? =]
-------------------- :: seeking acts of lycanthropy ::
|
|