|
theocean06
Yeah, I've donefour already...
Registered: 07/10/04
Posts: 1,458
Last seen: 12 years, 8 months
|
iamshaman.com anyone???
#3062615 - 08/28/04 04:34 PM (19 years, 6 months ago) |
|
|
What happened to this site? It's not on the shoomery vendor page anymore? I thought it was offered some pretty good plants and good deals...anyone care to help me out?
|
THE KRAT BARON
one-eyed willie
Registered: 07/08/03
Posts: 42,409
|
Re: iamshaman.com anyone??? [Re: theocean06]
#3062858 - 08/28/04 05:39 PM (19 years, 6 months ago) |
|
|
I don't know man. Iamshaman.com is a great company though, that's for sure.
|
deff
just love everyone
Registered: 05/01/04
Posts: 9,425
Loc: clarity
Last seen: 13 minutes, 58 seconds
|
Re: iamshaman.com anyone??? [Re: theocean06]
#3065368 - 08/29/04 01:52 PM (19 years, 6 months ago) |
|
|
Great vendor. I recommend them
--------------------
|
theocean06
Yeah, I've donefour already...
Registered: 07/10/04
Posts: 1,458
Last seen: 12 years, 8 months
|
Re: iamshaman.com anyone??? [Re: theocean06]
#3083762 - 09/02/04 04:36 PM (19 years, 6 months ago) |
|
|
Still no answer???
-------------------- The story of life is quicker then the blink of an eye, the story of love is hello, goodbye. - Hendrix
|
KingOftheThing
the cool fool
Registered: 11/17/02
Posts: 27,397
Loc: USA
|
Re: iamshaman.com anyone??? [Re: theocean06]
#3083779 - 09/02/04 04:42 PM (19 years, 6 months ago) |
|
|
the shroomery sponsers page is fucked up...has all the sponsors nicks but no links to their sites....i dont even see ads sometimes
|
geokills
∙∙∙∙☼ º¿° ☼∙∙∙∙
Registered: 05/08/01
Posts: 23,563
Loc: city of angels
Last seen: 1 day, 6 hours
|
|
Edit: This post and the opinions within, are from September 2004 and may no longer be valid!
Quote:
KingOftheThing said: the shroomery sponsers page is fucked up...has all the sponsors nicks but no links to their sites....i dont even see ads sometimes
I've never missed an AD on my machine. Though I've used machines which implement a Norton Firewall which blocks banner ads on all sites, perhaps you're running something of that nature?
With respect to IAmShaman.com - they are indeed a fantastic company with excellent products and unsurpassed customer service. Unfortunately, their lawyer has advised them that they should play it safe and refrain from advertising on websites which discuss the human consumption of the products they offer. Thus, they had to pull their contract here upon legal advice
Believe me, we'd love to have 'em back on our boards
-------------------- -------------------- ┼ ··∙ long live the shroomery ∙·· ┼ ...╬π╥ ╥π╬...
Edited by geokills (01/15/07 10:20 AM)
|
theocean06
Yeah, I've donefour already...
Registered: 07/10/04
Posts: 1,458
Last seen: 12 years, 8 months
|
Re: iamshaman.com anyone??? [Re: geokills]
#3084135 - 09/02/04 06:18 PM (19 years, 6 months ago) |
|
|
I bet this site brought them a lot of business. I mean, the only reason I even know about that site was because it was a sponsor here, and that's probably the same for many other people too...darn lawyers
-------------------- The story of life is quicker then the blink of an eye, the story of love is hello, goodbye. - Hendrix
|
Locus
Registered: 03/11/04
Posts: 6,112
Last seen: 3 years, 2 days
|
Re: iamshaman.com anyone??? [Re: theocean06]
#3084177 - 09/02/04 06:28 PM (19 years, 6 months ago) |
|
|
Yeah ..sucks they've left as a sponser, but hey at least they're watching their backs. I can tell you a few things I've come across that I didn't like though. On one occasion I found little pieces of sharp plastic in my powdered kratom. And many times now they have delayed my shipment and had me call them back because I change the name on the shipping ...even though I've been through this and explained to them 4 or 5 times now each time I've bought from them. Other than those things, I've had a good experience with them. And I still like them. Can't beat that shipping either.
-------------------- The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein "Fear is the great barrier to human growth." ~ Dr. Robert Monroe ~~~*Dosis sola facit venenum*~~~ *Check my profile to listen to my music*
|
ChiefThunderbong
Inhale to theChief
Registered: 10/18/02
Posts: 3,647
Last seen: 10 years, 9 months
|
Re: iamshaman.com anyone??? [Re: theocean06]
#3091554 - 09/04/04 01:57 PM (19 years, 6 months ago) |
|
|
Those lawyers are smart.
-------------------- Yeah spinnin' around again yea caught in a tailspin
|
theocean06
Yeah, I've donefour already...
Registered: 07/10/04
Posts: 1,458
Last seen: 12 years, 8 months
|
|
Well, I think the Shroomery was a good thing for them, got their name out there. I mean, I would have never ordered anything form them because I had never heard of them. Thanks to this the vendor page, I was able to find the site. I think through the Shroomery that got business. But yeah, It probably isn't a good thing for people to discuss there probably and how to use them in an illegal way.
-------------------- The story of life is quicker then the blink of an eye, the story of love is hello, goodbye. - Hendrix
|
Oscar2007
Stranger
Registered: 01/10/07
Posts: 9
Last seen: 17 years, 2 months
|
Re: iamshaman.com anyone??? [Re: theocean06]
#6444008 - 01/10/07 01:17 AM (17 years, 2 months ago) |
|
|
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: iamshaman.com anyone??? [Re: Oscar2007]
#6445094 - 01/10/07 12:03 PM (17 years, 2 months ago) |
|
|
Heh, shamanspalace told me that iamshaman attempted to sue them for the usage of 'shaman' in a website name in conjunction with offering many of the same products and stuff, perhaps also claiming that item descriptions were copied. That was about a year ago, though.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
elsig
Knowledgespeaks, wisdom listens
Registered: 09/14/06
Posts: 533
Loc: the beach
|
Re: iamshaman.com anyone??? [Re: Koala Koolio]
#6445617 - 01/10/07 02:56 PM (17 years, 2 months ago) |
|
|
i used to shop from ias all the time, however in the last years there has been some changes with them which is not all goodm this has nothing to do with their products, they still sell good products, its other stuff. and from what i know i dont doubt for a second what koala koolio says about suing shamanspalace, thats sounds just about how they work things there.,
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: iamshaman.com anyone??? [Re: elsig]
#6458684 - 01/14/07 01:11 PM (17 years, 2 months ago) |
|
|
http://www.entheogen.com/forum/showthread.php?t=10327
After reading that thread, I'm thrilled that they're not sponsors here anymore.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
Edited by Koala Koolio (01/14/07 01:26 PM)
|
elsig
Knowledgespeaks, wisdom listens
Registered: 09/14/06
Posts: 533
Loc: the beach
|
Re: iamshaman.com anyone??? [Re: Koala Koolio]
#6458707 - 01/14/07 01:22 PM (17 years, 2 months ago) |
|
|
another mistake they are doing is trying to enter the "legal bud" marked, which is competly diffrent than the ethnobotanical marked. im not so concerned about affiliate webpages as long as they mention they are affiliates clearly, i have a weekly income on affiliate programs myself. i used to be affiliate for IAS myself, they do have a good deal, but changed to bouncing bear botanicals instead for reasons im not going into here in this forum
|
|