|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
|
Re: Psilocybe hispanica [Re: Baba Yaga]
#27783867 - 05/19/22 06:05 AM (1 year, 8 months ago) |
|
|
Joining this thread too, because of all the good info and the recent development.
Its going to be super exciting to follow hispanica/semilanceata/fimetaria complex.
Got a lot of small individual subs going outside, inside, etc
Im sure we'll have more answers by end of 2022
-
Quote:
funkymonk22 said: i grew p hispanica in monotubs in a cold room this winter..temps were about 50-60F. one of the easiest and most prolific species i have grown..

not sure about potency yet, havent had the time to try em
Also to me, the tub here is very alike to my sequenced p fimetaria
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (05/24/22 03:14 AM)
|
King0fthajuice
Colors


Registered: 06/28/17
Posts: 325
Loc: Wild Like Volusia in the 80s
Last seen: 1 year, 29 days
|
|
Quote:
Alan Rockefeller said:
Quote:
Baba Yaga said: Hey just popping by to post some photos of a few fruits from this years semilanceata grow. I will send these away for sequencing soon and will post the result.
Very cool! When you get data PM me if you want to do a quick zoom call - I can share my screen show you how I analyze sequence data using free tools and put it into Genbank.
So I'm going to tell VL that he should send you another sample, I told him how my tamp sample was misplaced as well. I want you to do that for me man, I've been dying to know for over a year now~! I know your in GA right now and have been busy doing conventions!
I'll private message you but I'm putting this part here so you have a responsibility
-------------------- I like rain Whether you think you can or you think you can’t, you’re right!
|
MycoCakes
Stranger


Registered: 11/25/20
Posts: 20
Last seen: 2 months, 18 days
|
|
Hey Alan. Did you ever find out what they were?
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
|
Re: Psilocybe hispanica [Re: MycoCakes] 4
#27812106 - 06/09/22 11:27 AM (1 year, 7 months ago) |
|
|
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (06/09/22 04:55 PM)
|
Baba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
|
|
Ok, so I got the sequence results back and the mushrooms I grew are semilanceata from what I can see.
A few examples from the first Semilanceata Grow 2020:

and some fruits from second grow 2022 started with spores from above. Samples for sequencing were taken from this grow:

Because I banned myself for a few weeks I couldn’t get in touch with Alan but instead I watched his videos on youtube about how to work the data and this is what I got out from alingning the sequence with BLAST and creating a phylogenetic tree with Geneious Prime.
Alan, I can send you the .ab1 file if you want to have a look at that.
Sequence:
ACCTGATTTGAGGNCAAATTGTCATTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTTGCAAGGAGAGCTTGTGAAAGCAATCCTCTTGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGAAACCAAGGAAA
Alignment with the top match in Blast showing only one difference between the two and a phylogenetic tree made with Snap-Gene:

This should be right, right? Since I am not a pro in this regard I would appreciate if you could confirm my findings Alan so I can re-post these results in a few other places like the Hunting&ID Forum, the Misc Exotic Thread and include it in the introduction of the Official Sem Thread as well.
Edited by Baba Yaga (08/02/22 04:38 PM)
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,271
Last seen: 9 hours, 58 minutes
|
Re: Psilocybe hispanica [Re: Baba Yaga]
#27886287 - 08/02/22 12:25 AM (1 year, 5 months ago) |
|
|
Yes definitely semilanceata. I replied to your PM.
It would be cool to put these photos on Mushroom Observer, upload the sequence data to Genbank and link the Genbank record to the Mushroom Observer record so there's a permanent record of this, it'd be good to be able to refer to it when looking at possible semilanceata photos.
A good way to share .ab1 files is to put it on a public Google drive link.
You can also contact me on gmail, Facebook messenger and IG, I use the same name on all 3.
|
Baba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
|
|
Thanks Alan, there is no reply in my inbox though. I have your gmail address and will get in touch soon.
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
|
Re: Psilocybe hispanica [Re: Baba Yaga] 1
#27889702 - 08/04/22 12:07 PM (1 year, 5 months ago) |
|
|
-------------------- Willpower is the one true virtue
  
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
|
|

Does this mycelium look like agaricus blazeii or like hispanica
-------------------- Willpower is the one true virtue
  
|
DH42
Local to somewhere



Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 2 days, 4 hours
|
Re: Psilocybe hispanica [Re: Baba Yaga]
#27909455 - 08/19/22 11:11 AM (1 year, 5 months ago) |
|
|
Nice One Baba Yaga
-------------------- Have a look at the subreddit r/fimetaria!
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,271
Last seen: 9 hours, 58 minutes
|
|
Quote:
smalltalk_canceled said:
Does this mycelium look like agaricus blazeii or like hispanica
It is hard to see what is going on here, but I would guess a mold.
|
V.L


Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 53 minutes, 58 seconds
|
|
Alan did you received/sequenced the sample I sent you?
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,271
Last seen: 9 hours, 58 minutes
|
Re: Psilocybe hispanica [Re: V.L]
#27924013 - 08/29/22 12:24 PM (1 year, 4 months ago) |
|
|
Quote:
V.L said: Alan did you received/sequenced the sample I sent you?
What is the iNaturalist or Mushroom Observer observation number?
|
V.L


Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 53 minutes, 58 seconds
|
|
It was from this grow:
 Sent from France few months ago
|
KevinEm
Stranger
Registered: 09/15/22
Posts: 1
Last seen: 1 year, 4 months
|
Re: Psilocybe hispanica [Re: V.L]
#27951596 - 09/15/22 03:40 PM (1 year, 4 months ago) |
|
|
I was on a hunt may/june in Pyrenees but no luck. Spoke to a locals and heard I can find them if I got luck. Gotta do a 2nd attempt. Where do you guys find yours ??
|
V.L


Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 53 minutes, 58 seconds
|
Re: Psilocybe hispanica [Re: KevinEm]
#27954082 - 09/17/22 07:14 AM (1 year, 4 months ago) |
|
|
Got the prints from CaptainFuture
|
V.L


Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 53 minutes, 58 seconds
|
Re: Psilocybe hispanica [Re: V.L] 1
#28011128 - 10/22/22 06:20 PM (1 year, 3 months ago) |
|
|
 Right now doing a little comparative experience inoculated both cakes same day one with semilanceata (from Netherlands) the other with hispanica, both also put in fruiting condition same day, hispanica already started pinning but not the semilanceata yet, still keep hope for it when temperatures will be fresher..
|
Workman
1999 Spore War Veteran



Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 14 hours, 29 minutes
|
Re: Psilocybe hispanica [Re: V.L] 1
#28495629 - 10/07/23 04:25 PM (3 months, 19 days ago) |
|
|
Finally got back to this species after 19 years (WTF!). Still grows easy outdoors.

Quote:
saralove said:
I hope this puts a smile on your face workman wherever you are =)
P. hispanica as a fun little cake
your teachings live on
always your student,
sara
ps.
hi everyone
Yes, made me smile. Thank you saralove if you are still around.
-------------------- Research funded by the patrons of The Spore Works Exotic Spore Supply My Instagram Reinvesting 25% of Sales Towards Basic Research and Species Identification 
Edited by Workman (10/07/23 04:33 PM)
|
the_chosen_one
On the Darkslide


Registered: 09/11/06
Posts: 2,882
Loc: 1984
|
Re: Psilocybe hispanica [Re: Workman]
#28495640 - 10/07/23 04:42 PM (3 months, 19 days ago) |
|
|
She pops in from time to time when the kids give her a break.
I think I have a print from that grow. Need to get back to them myself.
-------------------- "Luck favors the observant." - Workman
|
covertjoy

Registered: 07/09/23
Posts: 272
|
Re: Psilocybe hispanica [Re: Workman]
#28495700 - 10/07/23 05:46 PM (3 months, 19 days ago) |
|
|
I have a couple of prints of Ps. Hispanica from FSE which I'm struggling to get any germination from.
Hope to join you all in growing this species soon.
--------------------
Edited by covertjoy (10/07/23 08:26 PM)
|
|