|
DreadzDeD
Native Winds



Registered: 05/24/22
Posts: 13
Loc: Ohio River Valley
Last seen: 4 months, 19 days
|
A collection lost. The search for psilocybe samuiensis
#27853553 - 07/07/22 12:32 PM (2 years, 6 months ago) |
|
|
Does anyone know where (if even possible) where to get samuiensis spores? A print or anything really. Sporeworks is out of stock and does not plan to restock at all. I have some syringes and prints I can trade for a print of ps. Samuiensis. Im highly fascinated by this sp.i had a print that was lost in storage nearly 6 years ago. Any help or direction is highly appreciated.
ETA: i have been scammed by someone claiming to have these spores this year so a trade is preferred
-------------------- ~ice is nice, and cocaine is dandy. But my drug of choice is temporary insanity~
Edited by DreadzDeD (07/10/22 03:28 PM)
|
Workman
1999 Spore War Veteran



Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
|
Re: A collection lost. The search for psilocybe samuiensis [Re: DreadzDeD] 3
#28428877 - 08/10/23 06:14 PM (1 year, 5 months ago) |
|
|
I recently revived an old Samuiensis print and it just started fruiting. So not all hope is lost. It hasn't been genetically confirmed yet, but that is planned as well. I'll post a picture tomorrow.
-------------------- Research funded by the patrons of
The Spore Works
Exotic Spore Supply
My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification 
|
crabs
Strange


Registered: 12/15/19
Posts: 350
Last seen: 8 days, 12 hours
|
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman]
#28429122 - 08/10/23 09:11 PM (1 year, 5 months ago) |
|
|
Quote:
Workman said: I recently revived an old Samuiensis print and it just started fruiting. So not all hope is lost. It hasn't been genetically confirmed yet, but that is planned as well. I'll post a picture tomorrow.
Interesting! Has it produced sclerotia for you?
|
Workman
1999 Spore War Veteran



Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
|
Re: A collection lost. The search for psilocybe samuiensis [Re: crabs] 1
#28429232 - 08/10/23 11:34 PM (1 year, 5 months ago) |
|
|
No, but I didn't really give it a chance either. I'll check the casing once fruiting is done.
I just noticed that this thread is a bit old.
-------------------- Research funded by the patrons of
The Spore Works
Exotic Spore Supply
My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification 
|
Workman
1999 Spore War Veteran



Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
|
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman] 7
#28429810 - 08/11/23 01:12 PM (1 year, 5 months ago) |
|
|
-------------------- Research funded by the patrons of
The Spore Works
Exotic Spore Supply
My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification 
|
seldom seen
April Fool



Registered: 11/03/07
Posts: 1,103
|
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman] 5
#28429815 - 08/11/23 01:15 PM (1 year, 5 months ago) |
|
|
I love when Workman materializes. Beautiful fruits man.
|
Nichrome
Participle Phrase


Registered: 12/17/18
Posts: 7,669
Loc: Zone 5
|
Re: A collection lost. The search for psilocybe samuiensis [Re: seldom seen]
#28434092 - 08/14/23 05:14 PM (1 year, 5 months ago) |
|
|
I like when Workman flushes too.
-------------------- discussions are a healthy alternative to arguments
There is only one electron, and it's you.
|
ShroomNugget
Mycologist Wannabe



Registered: 02/10/23
Posts: 355
Last seen: 6 months, 15 days
|
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman]
#28434257 - 08/14/23 07:40 PM (1 year, 5 months ago) |
|
|
Quote:
Workman said:

Does this mean it'll be available on the site sometime soon?!
|
Workman
1999 Spore War Veteran



Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
|
Re: A collection lost. The search for psilocybe samuiensis [Re: ShroomNugget] 4
#28434680 - 08/15/23 07:58 AM (1 year, 5 months ago) |
|
|
Yes. And thanks everyone, it is nice to be back at it.
-------------------- Research funded by the patrons of
The Spore Works
Exotic Spore Supply
My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification 
Edited by Workman (08/15/23 08:00 AM)
|
Workman
1999 Spore War Veteran



Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
|
Re: A collection lost. The search for psilocybe samuiensis [Re: ShroomNugget]
#28497801 - 10/09/23 03:36 PM (1 year, 3 months ago) |
|
|
Quote:
ShroomNugget said:
Does this mean it'll be available on the site sometime soon?!
Available now.
Unfortunately, no sclerotia found in spent substrate or casing. Genetic results still pending.
-------------------- Research funded by the patrons of
The Spore Works
Exotic Spore Supply
My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification 
|
Workman
1999 Spore War Veteran



Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
|
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman] 4
#28682903 - 03/01/24 05:40 PM (10 months, 11 days ago) |
|
|
ITS sequence
TGGTTGTAGCTGGTTCTCTCGAGGACATGTGCTCACCTTGTCATCTTTATCTATCCACCTGTGAACTTTTTGTAGACTTGGAACTAGTGAATGGGAAAGCTTGCTTTCCTTGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGCTTCATTTTGCTGGCTTAGGTCGGCTCCCCTCAAATGCATTAGCTGGTACCCCGCGTGGAACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACATCTACATAAATGGGCTTGTACTGCTTCTAACCGTCCATTCACTGGACAATACAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
-------------------- Research funded by the patrons of
The Spore Works
Exotic Spore Supply
My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification 
|
BlimeyGrimey
Collector of Spores




Registered: 08/24/05
Posts: 3,887
Loc: Puget Sound
|
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman] 3
#28683014 - 03/01/24 07:08 PM (10 months, 11 days ago) |
|
|
Closest on NCBI Blast is Psilocybe ruiliensis at 95.24% match with 98% query coverage.
Anything under 99% isn't a match, if I'm not mistaken.
This might be the first ITS for Psilocybe samuiensis.
Edit :
This is 100% Psilocybe samuiensis!
MycoMap Blast Search
10 matches at 99.5%+ with 98%+ query coverage.
-------------------- Message me for free microscopy services on Psilocybe, Panaeolus, and Gymnopilus species.
Looking for wild Panaeolus species prints. Msg me for trades.
Edited by BlimeyGrimey (03/01/24 07:21 PM)
|
FlashBang
Stranger
Registered: 02/16/24
Posts: 45
|
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman]
#28683045 - 03/01/24 07:36 PM (10 months, 11 days ago) |
|
|
Quote:
Workman said: It hasn't been genetically confirmed yet, but that is planned as well.
How does one genetically confirm a strain? Forgive my ignorance, but I've never heard of that mentioned. Is there a service that actually runs an analysis, or are we talking about comparing characteristics?
-------------------- "If you want to experiment do so at your own peril or joy but please do not assume that you are going to discover a new ground-breaking way of doing things." -Hitchhikers guide.
"Don't mind if I do." -FlashBang
|
|