Home | Community | Message Board

MRCA Tyroler Gluckspilze
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   Mushroom-Hut Liquid Cultures   MagicBag.co Certified Organic All-In-One Grow Bags   Left Coast Kratom Buy Kratom Extract   OlympusMyco.com No Unicorns Here—Just Quality Bags That Work   PhytoExtractum Maeng Da Thai Kratom Leaf Powder   Original Sensible Seeds High THC Strains   Myyco.com Isolated Cubensis Liquid Culture For Sale   North Spore Bulk Substrate

Jump to first unread post Pages: 1
OfflineDreadzDeD
Native Winds
 User Gallery


Registered: 05/24/22
Posts: 13
Loc: Ohio River Valley
Last seen: 4 months, 19 days
A collection lost. The search for psilocybe samuiensis
    #27853553 - 07/07/22 12:32 PM (2 years, 6 months ago)

Does anyone know where (if even possible) where to get samuiensis spores? A print or anything really. Sporeworks is out of stock and does not plan to restock at all. I have some syringes and prints I can trade for a print of ps. Samuiensis. Im highly fascinated by this sp.i had a print that was lost in storage nearly 6 years ago. Any help or direction is highly appreciated.

ETA: i have been scammed by someone claiming to have these spores this year so a trade is preferred


--------------------
~ice is nice, and cocaine is dandy. But my drug of choice is temporary insanity~

Edited by DreadzDeD (07/10/22 03:28 PM)

Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
Trusted Cultivator
OG Cultivator
Re: A collection lost. The search for psilocybe samuiensis [Re: DreadzDeD] * 3
    #28428877 - 08/10/23 06:14 PM (1 year, 5 months ago)

I recently revived an old Samuiensis print and it just started fruiting. So not all hope is lost. It hasn't been genetically confirmed yet, but that is planned as well. I'll post a picture tomorrow.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:

Extras: Filter Print Post Top
Offlinecrabs
Strange


Registered: 12/15/19
Posts: 350
Last seen: 8 days, 12 hours
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman]
    #28429122 - 08/10/23 09:11 PM (1 year, 5 months ago)

Quote:

Workman said:
I recently revived an old Samuiensis print and it just started fruiting. So not all hope is lost. It hasn't been genetically confirmed yet, but that is planned as well. I'll post a picture tomorrow.



Interesting! Has it produced sclerotia for you?

Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
Trusted Cultivator
OG Cultivator
Re: A collection lost. The search for psilocybe samuiensis [Re: crabs] * 1
    #28429232 - 08/10/23 11:34 PM (1 year, 5 months ago)

No, but I didn't really give it a chance either. I'll check the casing once fruiting is done.

I just noticed that this thread is a bit old.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:

Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
Trusted Cultivator
OG Cultivator
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman] * 7
    #28429810 - 08/11/23 01:12 PM (1 year, 5 months ago)



--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:

Extras: Filter Print Post Top
Invisibleseldom seen
April Fool
Male User Gallery


Registered: 11/03/07
Posts: 1,103
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman] * 5
    #28429815 - 08/11/23 01:15 PM (1 year, 5 months ago)

I love when Workman materializes.  Beautiful fruits man.


--------------------

Extras: Filter Print Post Top
InvisibleNichrome
Participle Phrase
I'm a teapot User Gallery

Registered: 12/17/18
Posts: 7,669
Loc: Zone 5
Trusted Cultivator
Re: A collection lost. The search for psilocybe samuiensis [Re: seldom seen]
    #28434092 - 08/14/23 05:14 PM (1 year, 5 months ago)

I like when Workman flushes too.


--------------------
discussions are a healthy alternative to arguments

There is only one electron, and it's you.

Extras: Filter Print Post Top
OfflineShroomNugget
Mycologist Wannabe
I'm a teapot User Gallery


Registered: 02/10/23
Posts: 355
Last seen: 6 months, 15 days
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman]
    #28434257 - 08/14/23 07:40 PM (1 year, 5 months ago)

Quote:

Workman said:






Does this mean it'll be available on the site sometime soon?!


--------------------

Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
Trusted Cultivator
OG Cultivator
Re: A collection lost. The search for psilocybe samuiensis [Re: ShroomNugget] * 4
    #28434680 - 08/15/23 07:58 AM (1 year, 5 months ago)

Yes. And thanks everyone, it is nice to be back at it.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:

Edited by Workman (08/15/23 08:00 AM)

Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
Trusted Cultivator
OG Cultivator
Re: A collection lost. The search for psilocybe samuiensis [Re: ShroomNugget]
    #28497801 - 10/09/23 03:36 PM (1 year, 3 months ago)

Quote:

ShroomNugget said:

Does this mean it'll be available on the site sometime soon?!




Available now.

Unfortunately, no sclerotia found in spent substrate or casing. Genetic results still pending.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:

Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,615
Loc: Oregon, USA
Last seen: 5 hours, 13 minutes
Trusted Cultivator
OG Cultivator
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman] * 4
    #28682903 - 03/01/24 05:40 PM (10 months, 11 days ago)

ITS sequence

TGGTTGTAGCTGGTTCTCTCGAGGACATGTGCTCACCTTGTCATCTTTATCTATCCACCTGTGAACTTTTTGTAGACTTGGAACTAGTGAATGGGAAAGCTTGCTTTCCTTGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGCTTCATTTTGCTGGCTTAGGTCGGCTCCCCTCAAATGCATTAGCTGGTACCCCGCGTGGAACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACATCTACATAAATGGGCTTGTACTGCTTCTAACCGTCCATTCACTGGACAATACAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:

Extras: Filter Print Post Top
InvisibleBlimeyGrimey
Collector of Spores
Male


Folding@home Statistics
Registered: 08/24/05
Posts: 3,887
Loc: Puget Sound
Trusted Cultivator
OG Cultivator
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman] * 3
    #28683014 - 03/01/24 07:08 PM (10 months, 11 days ago)

Closest on NCBI Blast is Psilocybe ruiliensis at 95.24% match with 98% query coverage.

Anything under 99% isn't a match, if I'm not mistaken.

This might be the first ITS for Psilocybe samuiensis.

Edit :

This is 100% Psilocybe samuiensis!

MycoMap Blast Search

10 matches at 99.5%+ with 98%+ query coverage.


--------------------
Message me for free microscopy services on Psilocybe, Panaeolus, and Gymnopilus species.

Looking for wild Panaeolus species prints. Msg me for trades.

Edited by BlimeyGrimey (03/01/24 07:21 PM)

Extras: Filter Print Post Top
InvisibleFlashBang
Stranger
Registered: 02/16/24
Posts: 45
Re: A collection lost. The search for psilocybe samuiensis [Re: Workman]
    #28683045 - 03/01/24 07:36 PM (10 months, 11 days ago)

Quote:

Workman said:
It hasn't been genetically confirmed yet, but that is planned as well.




How does one genetically confirm a strain? Forgive my ignorance, but I've never heard of that mentioned. Is there a service that actually runs an analysis, or are we talking about comparing characteristics?


--------------------
"If you want to experiment do so at your own peril or joy but please do not assume that you are going to discover a new ground-breaking way of doing things." -Hitchhikers guide.

"Don't mind if I do." -FlashBang

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Kraken Kratom Red Vein Kratom   Mushroom-Hut Liquid Cultures   MagicBag.co Certified Organic All-In-One Grow Bags   Left Coast Kratom Buy Kratom Extract   OlympusMyco.com No Unicorns Here—Just Quality Bags That Work   PhytoExtractum Maeng Da Thai Kratom Leaf Powder   Original Sensible Seeds High THC Strains   Myyco.com Isolated Cubensis Liquid Culture For Sale   North Spore Bulk Substrate


Similar ThreadsPosterViewsRepliesLast post
* Post deleted by users_request Uv1 1,428 18 02/21/02 11:16 AM
by Workman
* Genesis of the PF Redspore Psilocybe motamanM 7,348 16 12/05/03 08:59 AM
by Anonymous
* Re: Psilocybe stuntzii - Stuntz's Blue Legs camel 3,369 6 12/31/99 02:51 AM
by Anonymous
* Post deleted by users_request Uv1 1,076 3 10/07/01 10:55 AM
by Workman
* Official Psilocybe zapotecorum thread
( 1 2 3 4 ... 48 49 )
Hindsight 40,674 978 01/16/25 09:11 PM
by LewDoja
* Psilocybe Cubensis Species (READ for GOOD info)
( 1 2 all )
DannyBoy 59,501 29 11/24/09 02:17 PM
by Roadkill
* Re: Newbies: use the SEARCH function
( 1 2 all )
PanTrop 8,168 32 04/27/00 12:53 PM
by LuciferX
* Re: NEW - Psilocybe cyanescens Homepage Psychonaut 1,568 4 02/10/00 02:43 PM
by Condi1

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Shroomism, george castanza, RogerRabbit, veggie, mushboy, fahtster, LogicaL Chaos, 13shrooms, hamloaf, cronicr, Stipe-n Cap, Pastywhyte, bodhisatta, Tormato, Land Trout, A.k.a
655 topic views. 28 members, 123 guests and 83 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2025 Mind Media. Some rights reserved.

Generated in 0.022 seconds spending 0.007 seconds on 12 queries.