Home | Community | Message Board

MRCA Tyroler Gluckspilze
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Mushroom-Hut Substrate Bags   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Kratom Powder for Sale   Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Extract   North Spore Bulk Substrate

Jump to first unread post Pages: < Back | 1 | 2 | 3 | 4 | 5 | 6 | Next >  [ show all ]
Offlinesmalltalk_canceled
Babnik
 User Gallery

Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
Re: Psilocybe hispanica [Re: Baba Yaga]
    #27783867 - 05/19/22 06:05 AM (1 year, 8 months ago)

Joining this thread too, because of all the good info and the recent development.

Its going to be super exciting to follow hispanica/semilanceata/fimetaria complex.

Got a lot of small individual subs going outside, inside, etc

Im sure we'll have more answers by end of 2022

-

Quote:

funkymonk22 said:
i grew p hispanica in monotubs in a cold room this winter..temps were about 50-60F.  one of the easiest and most prolific species i have grown..


not sure about potency yet, havent had the time to try em





Also to me, the tub here is very alike to my sequenced p fimetaria


--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (05/24/22 03:14 AM)


Extras: Filter Print Post Top
OfflineKing0fthajuice
Colors
Male

Registered: 06/28/17
Posts: 325
Loc: Wild Like Volusia in the 80s
Last seen: 1 year, 29 days
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27786235 - 05/20/22 09:35 PM (1 year, 8 months ago)

Quote:

Alan Rockefeller said:
Quote:

Baba Yaga said:
Hey just popping by to post some photos of a few fruits from this years semilanceata grow.
I will send these away for sequencing soon and will post the result.




Very cool!  When you get data PM me if you want to do a quick zoom call - I can share my screen show you how I analyze sequence data using free tools and put it into Genbank.





So I'm going to tell VL that he should send you another sample, I told him how my tamp sample was misplaced as well.  I want you to do that for me man, I've been dying to know for over a year now~!  I know your in GA right now and have been busy doing conventions!

I'll private message you but I'm putting this part here so you have a responsibility :wink:


--------------------
I like rain

Whether you think you can or you think you can’t, you’re right!


Extras: Filter Print Post Top
OfflineMycoCakes
Stranger


Registered: 11/25/20
Posts: 20
Last seen: 2 months, 18 days
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27786393 - 05/21/22 01:43 AM (1 year, 8 months ago)

Hey Alan. Did you ever find out what they were?


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery

Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
Re: Psilocybe hispanica [Re: MycoCakes] * 4
    #27812106 - 06/09/22 11:27 AM (1 year, 7 months ago)










--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (06/09/22 04:55 PM)


Extras: Filter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 5
    #27883715 - 07/31/22 04:52 AM (1 year, 5 months ago)

Ok, so I got the sequence results back and the mushrooms I grew are semilanceata from what I can see.

A few examples from the first Semilanceata Grow 2020:




and some fruits from second grow 2022 started with spores from above. Samples for sequencing were taken from this grow:

 


Because I banned myself for a few weeks I couldn’t get in touch with Alan but instead I watched his videos on youtube about how to work the
data and this is what I got out from alingning the sequence with BLAST and creating a phylogenetic tree with Geneious Prime.

Alan, I can send you the .ab1 file if you want to have a look at that.


Sequence:

ACCTGATTTGAGGNCAAATTGTCATTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTTGCAAGGAGAGCTTGTGAAAGCAATCCTCTTGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGAAACCAAGGAAA


Alignment with the top match in Blast showing only one difference between the two and a phylogenetic tree made with Snap-Gene:




This should be right, right? Since I am not a pro in this regard I would appreciate if you could confirm my findings Alan so I can re-post these
results in a few other places like the Hunting&ID Forum, the Misc Exotic Thread  and include it in the introduction of the Official Sem Thread as well.


Edited by Baba Yaga (08/02/22 04:38 PM)


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,271
Last seen: 9 hours, 58 minutes
Re: Psilocybe hispanica [Re: Baba Yaga]
    #27886287 - 08/02/22 12:25 AM (1 year, 5 months ago)

Yes definitely semilanceata.  I replied to your PM.

It would be cool to put these photos on Mushroom Observer, upload the sequence data to Genbank and link the Genbank record to the Mushroom Observer record so there's a permanent record of this, it'd be good to be able to refer to it when looking at possible semilanceata photos.

A good way to share .ab1 files is to put it on a public Google drive link.

You can also contact me on gmail, Facebook messenger and IG, I use the same name on all 3.


Extras: Filter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27886306 - 08/02/22 01:09 AM (1 year, 5 months ago)

Thanks Alan, there is no reply in my inbox though. I have your gmail address and will get in touch soon.


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
Re: Psilocybe hispanica [Re: Baba Yaga] * 1
    #27889702 - 08/04/22 12:07 PM (1 year, 5 months ago)



--------------------
Willpower is the one true virtue



Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
Re: Psilocybe hispanica [Re: smalltalk_canceled]
    #27903560 - 08/14/22 07:07 PM (1 year, 5 months ago)



Does this mycelium look like agaricus blazeii or like hispanica


--------------------
Willpower is the one true virtue



Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 2 days, 4 hours
Re: Psilocybe hispanica [Re: Baba Yaga]
    #27909455 - 08/19/22 11:11 AM (1 year, 5 months ago)

Nice One Baba Yaga :thumbup:


--------------------
Have a look at the subreddit r/fimetaria!


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,271
Last seen: 9 hours, 58 minutes
Re: Psilocybe hispanica [Re: smalltalk_canceled]
    #27923995 - 08/29/22 12:09 PM (1 year, 4 months ago)

Quote:

smalltalk_canceled said:

Does this mycelium look like agaricus blazeii or like hispanica





It is hard to see what is going on here, but I would guess a mold.


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 53 minutes, 44 seconds
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27924010 - 08/29/22 12:23 PM (1 year, 4 months ago)

Alan did you received/sequenced the sample I sent you?


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,271
Last seen: 9 hours, 58 minutes
Re: Psilocybe hispanica [Re: V.L]
    #27924013 - 08/29/22 12:24 PM (1 year, 4 months ago)

Quote:

V.L said:
Alan did you received/sequenced the sample I sent you?




What is the iNaturalist or Mushroom Observer observation number?


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 53 minutes, 44 seconds
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 1
    #27924020 - 08/29/22 12:31 PM (1 year, 4 months ago)

It was from this grow:

Sent from France few months ago


Extras: Filter Print Post Top
OfflineKevinEm
Stranger
Registered: 09/15/22
Posts: 1
Last seen: 1 year, 4 months
Re: Psilocybe hispanica [Re: V.L]
    #27951596 - 09/15/22 03:40 PM (1 year, 4 months ago)

I was on a hunt may/june in Pyrenees but no luck. Spoke to a locals and heard I can find them if I got luck. Gotta do a 2nd attempt. Where do you guys find yours ??


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 53 minutes, 44 seconds
Trusted Cultivator
Re: Psilocybe hispanica [Re: KevinEm]
    #27954082 - 09/17/22 07:14 AM (1 year, 4 months ago)

Got the prints from CaptainFuture


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 53 minutes, 44 seconds
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 1
    #28011128 - 10/22/22 06:20 PM (1 year, 3 months ago)


Right now doing a little comparative experience inoculated both cakes same day one with semilanceata (from Netherlands) the other with hispanica, both also put in fruiting condition same day, hispanica already started pinning but not the semilanceata yet, still keep hope for it when temperatures will be fresher..


Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 14 hours, 29 minutes
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 1
    #28495629 - 10/07/23 04:25 PM (3 months, 19 days ago)

Finally got back to this species after 19 years (WTF!). Still grows easy outdoors.



Quote:

saralove said:

I hope this puts a smile on your face workman wherever you are  =)

P. hispanica as a fun little cake



your teachings live on:mushroom2:

always your student,

sara

ps.

hi everyone:sun:




Yes, made me smile. Thank you saralove if you are still around.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Edited by Workman (10/07/23 04:33 PM)


Extras: Filter Print Post Top
Invisiblethe_chosen_one
On the Darkslide
Male User Gallery

Registered: 09/11/06
Posts: 2,882
Loc: 1984
Trusted Cultivator
Re: Psilocybe hispanica [Re: Workman]
    #28495640 - 10/07/23 04:42 PM (3 months, 19 days ago)

She pops in from time to time when the kids give her a break. :lol:

I think I have a print from that grow. Need to get back to them myself.


--------------------
"Luck favors the observant." - Workman



Extras: Filter Print Post Top
Invisiblecovertjoy

Registered: 07/09/23
Posts: 272
Re: Psilocybe hispanica [Re: Workman]
    #28495700 - 10/07/23 05:46 PM (3 months, 19 days ago)

I have a couple of prints of Ps. Hispanica from FSE which I'm struggling to get any germination from.

Hope to join you all in growing this species soon.



--------------------


Edited by covertjoy (10/07/23 08:26 PM)


Extras: Filter Print Post Top
Jump to top Pages: < Back | 1 | 2 | 3 | 4 | 5 | 6 | Next >  [ show all ]

Shop: Mushroom-Hut Substrate Bags   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Kratom Powder for Sale   Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Extract   North Spore Bulk Substrate


Similar ThreadsPosterViewsRepliesLast post
* Psilocybe hispanica - Pins on agar (Updated 5-25-06)
( 1 2 all )
WorkmanV 8,645 26 12/05/06 04:51 AM
by myCo_psyCo
* Psilocybe Hispanica.. anybody grown it? Know how? Dogomush 1,444 4 11/15/02 11:21 AM
by mycofile
* P. hispanica grow TEK
( 1 2 all )
Zanti 6,732 21 06/13/03 04:31 AM
by Ryche Hawk
* Where's a Hispanica tek? Dogomush 1,064 3 05/27/03 02:09 PM
by comario2
* Psilocybe semilanceata spores Zanti 13,494 10 08/08/07 10:19 AM
by Workman
* NEW WORLD PSILOCYBE SPECIES nachoo 1,986 8 08/28/01 01:39 PM
by dioze1
* Re: Psilocybe natalensis and Psilocybe zapatecorum info please Anonymous 1,739 5 04/20/00 08:25 PM
by phree_1
* salvia hispanica L grain in substrate???? es_f1 1,371 6 02/16/08 07:54 PM
by Subbedhunter420

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, Pastywhyte, bodhisatta
23,549 topic views. 2 members, 12 guests and 3 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.021 seconds spending 0.005 seconds on 14 queries.