|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
The Official Semilanceata Thread 33
#27613283 - 01/09/22 06:22 PM (2 years, 4 months ago) |
|
|
Official Semilanceata Cultivation Thread
I think it's time to pay some more attention to this species and giving it it's own place here in Mush Cult.
Psilocybe semilanceata, aka Liberty Cap, is one of the most wide spread psilocybe which means it is suitable to grow in a big portion of this planet. The truth is though that there is hardly anyone trying to grow these and I ask myself why? Reading through the threads I found that lots of people are under the impression that Libs are a very difficult to cultivate species and this might be true for indoor cultivation, but outdoors they are not that complicated to grow. The key here is to keep it simple. Don't get hung up on old information that says they need rye grass seed or decaying grass roots to thrive. Cronicr for example said that they will grow just fine from grain spawned to coir and buried in a shady spot in the garden after full colonization. And like with anything else clean spawn is the main ingredient to succeed.
So my point is, if you are already doing outdoor grows with wood lovers then I would highly recommend to switch it up a bit and giving some liberty caps a chance when you are planning your next fall outdoor project but what ever you do, whether it's outdoors or indoors, please pop by and let us know how it's going.
The photos below are from a grow in 2020 posted in the Mushroom Grow Logs and Pictures Forum plus a few from a grow in 2022. Almost all the phenotypes you can see there are quite different from semilanceata fruits found in the wild. These fruits were so different that I had substantial doubt that what I was growing was indeed Ps. semilanceata and not a similar psilocybe like fimetaria. To make sure that I wasn't growing anything else I took a sample to get a gene sequence analysis done and the result came back positive for Ps. semilanceata.
Fist image is an alignment of my sample sequence with another semilanceata sequence in GeneBank which is showing only one difference between the two. Second image is a phylogenetic tree showing the sample highlighted in green:

Ok, here are some photos to set the mood:
   
    
   

 


   
  
  

Edited by Baba Yaga (02/14/24 09:50 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 7
#27613285 - 01/09/22 06:23 PM (2 years, 4 months ago) |
|
|
I'm glad I got this one finally on the road after members smalltalk-canceled and Land Trout have decided to get on the train to Libs Ville as well.
Most excited to see more grows of this species as the cultivated phenotypes are nothing like the wild specimens you can usually find which makes some members skeptical that what has been grown so far is actually semilanceata genetics. Smalltalk has already send samples to Alan Rockefeller for analysis and I will send samples to Alva Lab in Spain to get species confirmation, so fingers crossed that I will get fruits this fall.
This years spawn and cakes are already on their way. I inoculated 20 oat jars last week with LC and I have good growth. Don't mind the PF-substrate on top of the grain, I inoculated the jars with 2 month old LC and just wanted to make sure it recovers alright, if you are interested in what I did then have a look here.

Almost 3 month ago I inoculated 16 cakes, I can't remember what the substrate is exactly as I made it a year ago and it was sitting in the freezer since then but it does contain some h-manure and coir and I mixed in some old grass clippings and put wheat bran in.

Also made 10 jars with straw, h-manure, coir and whole meal flour. They are colonizing and consolidating for almost 4 month now.

A few have what appears to be knots or sclerotia but nothing else happened so far.

I cased a couple with coir and took them in and out of the fridge a few times but also nothing happening, I hope putting them outside once it gets cold will kick off fruiting.

My fruiting strategy for my outdoor beds is the same as the last two years which is finding some good quality compost in bags and spawn to that but after the fail last time I want to make sure that I will get fruits this year so I will pasteurize some of the compost to get rid of competing organisms and use that to spawn to some flower pots cause the compost I used last year was too soggy and smelled bad, probably not well composted and nothing grew. This year I will make sure to get some nice earthy smelling product.
I'm also prepping a patch by laying down grass clippings for the last couple of month. They are composting and I want to spawn some grain to this and was also thinking of having some of this pasteurized for a few flower pots.

Got heaps of material for this season so I hope this will all colonize alright and give me some results.
Won't be long now before it's getting colder here, a couple more month and it will be time to spawn some libs.
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 5
#27613314 - 01/09/22 06:39 PM (2 years, 4 months ago) |
|
|
Let’s do this
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Land Trout] 1
#27613345 - 01/09/22 06:55 PM (2 years, 4 months ago) |
|
|
Sweet! This will probably be a slow start as we are between seasons globally speaking but I hope some more folks will chime in over time and blow this thread up.
|
MysticMycologist
Dirt Sherpa



Registered: 10/14/21
Posts: 1,755
Loc: seeking samadhi
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27613442 - 01/09/22 08:25 PM (2 years, 4 months ago) |
|
|
I wonder if they could be grown outdoors in the Midwest, USDA zone 6a? Never tried liberty caps.‘I would love to try them as I hear they are unique.
-------------------- Two eyes to look, One eye to see. Prying open my third eye 
|
Hindsight
Mad Scientist


Registered: 01/24/21
Posts: 2,706
Last seen: 1 year, 29 days
|
|
|
Mycoplex
Sporocarp



Registered: 10/09/21
Posts: 898
Last seen: 21 hours, 52 minutes
|
Re: The Official Semilanceata Thread [Re: Hindsight] 1
#27613487 - 01/09/22 09:21 PM (2 years, 4 months ago) |
|
|
Useful thread Baba, will stick around here and check out how the thread evolves.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
Quote:
MysticMycologist said: I wonder if they could be grown outdoors in the Midwest, USDA zone 6a? Never tried liberty caps.‘I would love to try them as I hear they are unique.
I would say yes if you time it right. Worth a try.
|
Anglerfish
hearing things



Registered: 09/08/10
Posts: 18,817
Loc: Norvegr
Last seen: 6 hours, 30 minutes
|
|
Quote:
MysticMycologist said: I wonder if they could be grown outdoors in the Midwest, USDA zone 6a? Never tried liberty caps.‘I would love to try them as I hear they are unique.
I assume that if you get some healthy mycelium going, they can be fruited outdoors given that the conditions are favourable for the time it takes for them to get into fruiting mode and develop pins. I think high RH is the key here, temperatures too, but not as much, although they seem to need a burst of cold to get going.
--------------------
★★★★★
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Anglerfish] 1
#27614207 - 01/10/22 02:43 PM (2 years, 4 months ago) |
|
|
Yes! An official Semilanceata thread. I'm in. Managed to finally clean up my wild clone on agar. Still plenty time to think up some different spots and strategies.
|
fungusul
Fungus Kingdom


Registered: 07/16/20
Posts: 1,065
|
Re: The Official Semilanceata Thread [Re: Tweeq] 1
#27614539 - 01/10/22 09:47 PM (2 years, 4 months ago) |
|
|
Great idea Baba.
|
Libhunter2021
Stranger


Registered: 09/27/21
Posts: 19
Last seen: 2 years, 4 days
|
Re: The Official Semilanceata Thread [Re: fungusul] 1
#27614771 - 01/11/22 06:49 AM (2 years, 4 months ago) |
|
|
Awesome thread!
There's a great grow on mycotopia I'll try to find if yous like, the guy grows them in a wine cellar nd has success managing his temps.
Amazing to see if the other grow on the hunting sub gets confirmation from AR.
I have prints of strong samples of libs but maybe not the cleanest I only took them as a momento of strong finds, maybe be good for agar work. I've a print of a specimen that was 0.25g dry it was one the biggest I found hunting this year I was gonna try and run it on agar. When I read workman's work on this he used an albino, I was curious how it would work with a print of a "strong" specimen as I assumed albinos would be weaker genetic?
Cook thread, great to see and maybe take part in. I've only learnt cubes but I can agar/grain/spawn/set it outside no problem. My nearest hunting spots are less than 10min walks.
|
Waldfried



Registered: 10/17/11
Posts: 229
Loc:
Last seen: 15 days, 15 hours
|
Re: The Official Semilanceata Thread [Re: Libhunter2021] 1
#27614816 - 01/11/22 07:46 AM (2 years, 4 months ago) |
|
|
Very strange phenotype indeed. Might give it a try if I come across some spores. Hadn't had any luck with finding some for the last years though.
--------------------
|
wxorx
elsewhere


Registered: 10/18/19
Posts: 90
Last seen: 3 months, 9 days
|
Re: The Official Semilanceata Thread [Re: Waldfried] 1
#27614947 - 01/11/22 10:02 AM (2 years, 4 months ago) |
|
|
Subscribing
-------------------- void **
|
Libhunter2021
Stranger


Registered: 09/27/21
Posts: 19
Last seen: 2 years, 4 days
|
Re: The Official Semilanceata Thread [Re: wxorx] 1
#27615118 - 01/11/22 12:35 PM (2 years, 4 months ago) |
|
|
[i[/image]
Can't find the pic of the actual fruit but these are prints from a few a found at reasonable altitude mid to late August when it was still in the low 20s high teens temp wise. They were big, strong and early for that spot so I thought they'd be perfect and to me at that stage just a momento of first picks of last season. Hadn't rained much when I got those but clouds lie on the hillside so humidity micro climate.
|
holofractal
Woodlover experimentalist



Registered: 10/14/18
Posts: 479
Loc: Pacific Northwest
Last seen: 4 months, 10 days
|
Re: The Official Semilanceata Thread [Re: Libhunter2021] 5
#27615147 - 01/11/22 01:20 PM (2 years, 4 months ago) |
|
|
Hell yeah man!!!!!
I just got my shoebox started, birthed my 1qt grain spawn to 3qt of compost. Very rich and dark, smells wonderful, not wet or stinky. Cased it with some rye, although I should get something that grows a little shorter lol, as I've learned. It was the only organic non-coated with bullshit grass seed I could find on amazon, but perhaps i need to go to a garden center.

That's one of the favorite liberty cultures I ended up with. Quite a slow grower for sure, and that is both the fastest and also "nicest" mycelium I managed to culture.

Here is T0. Bonus bacteria from the NL, poor thing would get engulfed by mycelium haha.

The grain jar I did. Very wispy and thin, took some thinking to agree to when it was "done" as it did not wholly engulf the grains as other species do, so I gave it an extra 2 weeks before I used. The smell was wonderful, and I didn't note any other particular smell, just smelled like any other grain spawn.
So as of yesterday, just waiting for my shoebox grass to sprout. I do plan on doing some more outdoor patches, but I got plenty of time before then, and even though in the pnw its not that cold, there is still risk of freeze and neither I nor the fungi want to freeze their ass off, so I'll wait another month or two. I got a very thick liberty cap LC waiting to be used, so pretty much all ready for the seasons work.
I should also note that stuntzii and baeocystis mycelium looked quite similar to semilanceata mycelium, which I found interesting.
-------------------- Woodlover lover! I am open to questions about wood lovers, I don't know everything, but if you like my posts and have a question, feel free to ask in a PM I do a lot of indoor experiments. I, one day, WILL figure out a surefire method for indoor woodlovers. Nothing is impossible. Indoor Woodlover experimentation Journal Indoor woodlover information - condensed Indoor azurescens
 
|
Martain
Stranger



Registered: 09/13/14
Posts: 47
Loc: UK
Last seen: 2 years, 4 months
|
Re: The Official Semilanceata Thread [Re: holofractal] 3
#27615231 - 01/11/22 02:25 PM (2 years, 4 months ago) |
|
|
It might be of interest to consider the mychorrhizal associations with certain grassland species where these are found.
Isolating cultures from the natural soils where these grow and incorporating the resident biota could prove fruitful. It may be that there are other fungi or bacteria in association as well, noone has ever studied it conclusively.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: holofractal] 2
#27615245 - 01/11/22 02:34 PM (2 years, 4 months ago) |
|
|
Quote:
holofractal said:

That's one of the favorite liberty cultures I ended up with. Quite a slow grower for sure, and that is both the fastest and also "nicest" mycelium I managed to culture.
That is a really nice plate!
Great to see this is sparking some interest 
Just re-posting some culture images for reference:
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 3
#27615303 - 01/11/22 03:33 PM (2 years, 4 months ago) |
|
|
Finally there's an official Semi thread!
Today I've buried some spawn into a flowerpot with a nice patch of Festuca glauca. The grass is not only beautiful, it should provide great conditions for mushrooms.
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Adas] 2
#27615337 - 01/11/22 04:04 PM (2 years, 4 months ago) |
|
|
I think complexity is a trap here, go for simple subs.
Allow me to say why.
Here are some of my *thoughts* on the subject.
My idea of this species is that both grass and manure is unnecessary to accomplish fruiting. If my attempt is verified, a very simple sub will be documented, without either.
Later we may still find that either helps or promote something relevant, so adding either may still be preferable.
But on the way?
Makin our steps too advanced slows down the process as a whole. Perhaps slowing down the most important repetition, and adding attempts that are less meaningful.
Doing so steals from the agar work, diversity of genetics, adds pasteurization and contam vectors because of added complexity
I believe with this species, we are looking for genetics that respond to the what we normally do. And we need to fish industrially, not with a single line
We don't have a indoor method from A to finish, but we are not reliant on that.
We can: - run alot of different germination/cultures, looking for outliers, agar pins, mature agar fruits - run numerous but small subs - we can dig them down outside in time for season - we can colonize then indoors, and then take them to colder temperatures, this seems to have triggered pinning with the unverified semi in my thread
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (01/11/22 04:08 PM)
|
holofractal
Woodlover experimentalist



Registered: 10/14/18
Posts: 479
Loc: Pacific Northwest
Last seen: 4 months, 10 days
|
|
BTW, I have extra liberty cap prints, if you are a somewhat active Shroomery participant, and/or have experience with exotics, and/or at least have displayed some interest in exotics, I'll spare a print
One condition, you must post your work here
I have global stamps, and a small handful of prints, so send me a PM if interested. Let's get this thread bumpin'
-------------------- Woodlover lover! I am open to questions about wood lovers, I don't know everything, but if you like my posts and have a question, feel free to ask in a PM I do a lot of indoor experiments. I, one day, WILL figure out a surefire method for indoor woodlovers. Nothing is impossible. Indoor Woodlover experimentation Journal Indoor woodlover information - condensed Indoor azurescens
 
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: holofractal] 1
#27615359 - 01/11/22 04:23 PM (2 years, 4 months ago) |
|
|
Quote:
holofractal said: BTW, I have extra liberty cap prints, if you are a somewhat active Shroomery participant, and/or have experience with exotics, and/or at least have displayed some interest in exotics, I'll spare a print
One condition, you must post your work here
I have global stamps, and a small handful of prints, so send me a PM if interested. Let's get this thread bumpin' 

That's the spirit! I got some spare prints as well, but they are ~2 years old now. Will test a couple on agar and see if viability is still OK.
In my give away I had send out 17 prints, I hope some of those folks will turn up.
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27615363 - 01/11/22 04:25 PM (2 years, 4 months ago) |
|
|
I'll pick them myself this time hehe - 2022 edit: guy was never wrong
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (02/10/22 05:01 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27615369 - 01/11/22 04:30 PM (2 years, 4 months ago) |
|
|
Quote:
smalltalk_canceled said: I think complexity is a trap here, go for simple subs.
Allow me to say why.
Here are some of my *thoughts* on the subject.
My idea of this species is that both grass and manure is unnecessary to accomplish fruiting. If my attempt is verified, a very simple sub will be documented, without either.
Later we may still find that either helps or promote something relevant, so adding either may still be preferable.
But on the way?
Makin our steps too advanced slows down the process as a whole. Perhaps slowing down the most important repetition, and adding attempts that are less meaningful.
Doing so steals from the agar work, diversity of genetics, adds pasteurization and contam vectors because of added complexity
I believe with this species, we are looking for genetics that respond to the what we normally do. And we need to fish industrially, not with a single line
We don't have a indoor method from A to finish, but we are not reliant on that.
We can: - run alot of different germination/cultures, looking for outliers, agar pins, mature agar fruits - run numerous but small subs - we can dig them down outside in time for season - we can colonize then indoors, and then take them to colder temperatures, this seems to have triggered pinning with the unverified semi in my thread
Well said smalltalk, as mentioned in OP I think keeping it simple is key right now and I usually start on the low end of things in terms of complexity and work my way up.
This means I will try 100% coir as well.
Also good point using small but numerous subs, I will go with one outdoor patch this year and have got 10 1.5 liter containers and 8 5 liter that will be used to spawn to various simple substrates with and without grass on top, left in container or buried outside.
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27615390 - 01/11/22 04:55 PM (2 years, 4 months ago) |
|
|
Makes sense to compensate for what's difficult with it.
Adjust for speed through sub size, adjust for fruiting problems with huge range of genetics.
I'd also like for you to add more and better description of the sclerotia and how this works, most people don't even know that they can make stones, or at the least, myth surrounds semi sclerotia.
I'm very interested in being able to produce sclerotia from this species. I had a jar that produced a small amount of visible stones in the unverified grow
-------------------- Willpower is the one true virtue
  
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
Don't know about sclerotia either, if those denser spots of growth are sclerotia then they are very small. I tend to think those are knots, when I grew them they developed lots of knots early on and would do nothing more but started to grow once temps went below 10C.
|
Libhunter2021
Stranger


Registered: 09/27/21
Posts: 19
Last seen: 2 years, 4 days
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27617406 - 01/13/22 12:56 PM (2 years, 4 months ago) |
|
|
Would the prints I mentioned early in the thread be worth throwing to some agar 🤷 thinking swab em and cut the swab in the dish, transfer anything viable I get and work from there. I'm a long term hunter who's new to growing but I'm not bad with agar.
|
soppos



Registered: 10/24/21
Posts: 591
Loc: 🍄
Last seen: 6 months, 1 day
|
Re: The Official Semilanceata Thread [Re: Libhunter2021]
#27618319 - 01/14/22 09:43 AM (2 years, 4 months ago) |
|
|
this is a great . Libs rule 
and regarding sclerotia it feels like it must be something to it. ive know spots that produce Ridiculous amounts of fruits every 3-4 years, and i know spots where they produce yearly in abundance. the mayor differances is how dry those areas are in general over the summer, both has enough rain in autumn but summers and soil-types differ
it seems resonable that they would form sclerotia on dryer years and just chill until the moisturelevels is about right for fruiting.
what if one would stress some colonized cakes / agarplates and see what it does. Temperature, RH, Time? And it would be interesting to see how viable it is to make a bucket/transportable mega cake big enough to support it self and see if that could survive for several seasons. And then see if it produces sclerotia by default.
the myth of the original cube-sclerotia is an agarplate of a cloned wild cube that got forgotten amongst others..
Edited by soppos (01/14/22 10:07 AM)
|
soppos



Registered: 10/24/21
Posts: 591
Loc: 🍄
Last seen: 6 months, 1 day
|
Re: The Official Semilanceata Thread [Re: soppos]
#27618387 - 01/14/22 10:38 AM (2 years, 4 months ago) |
|
|
--------------------
Edited by soppos (01/14/22 11:41 AM)
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: soppos]
#27618399 - 01/14/22 10:57 AM (2 years, 4 months ago) |
|
|
It's not difficult at all to make the medium acidic, unless you're planting cakes into native alkaline soils. In fact, all you need to do is plant some suitable grasses into a flowerpot with any soil, and over time this soil will naturally become acidic due to how organic material gets decomposed in the soil.
Besides, I don't think acidic soil is an absolute requirement for Libs. After all, they grow on substrates soaked with alkaline tapwater that we cultivate them on, don't they?
|
soppos



Registered: 10/24/21
Posts: 591
Loc: 🍄
Last seen: 6 months, 1 day
|
Re: The Official Semilanceata Thread [Re: Adas]
#27618451 - 01/14/22 11:36 AM (2 years, 4 months ago) |
|
|
i was more thinking in the direction of dialing the correct ph (if there is one) not getting hanged up on acidity. (i changed the post from acidity to ph balance)
we can grow cubes out of a steralized bible, it doesnt mean that they prefer it in the wild. Im interested to see if / what the prefered vectors of wild-growth are. But its tricky when we dont have enough data at one place.
Anyone got more research data please provide 
--------------------
Edited by soppos (01/14/22 11:48 AM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: soppos] 1
#27618497 - 01/14/22 12:24 PM (2 years, 4 months ago) |
|
|
A couple of spawn jars 12 days after inoculation and 5 days after 1st shake.

Good grow speed on agar and grain, cakes/supplemented substrate is a bit slow though.
Anyone is going to try outdoors for early spring?
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: soppos] 1
#27618498 - 01/14/22 12:25 PM (2 years, 4 months ago) |
|
|
Acidity and pH balance are basically the same thing (if not, please enlighten me).
The experiments for this are actually very simple and straightforward. You can make agars of various pH and test how the Semi culture grows on each. For decreasing the pH you can use something like NaHSO4, among other things. If someone has the time and willingness to perform such experiment, this thread might benefit from that.
Baba, I'll be spawning some outdoors in Spring. I have already spawned some into a grass flowerpot outside, but I plan burying even some colonized bulk substrate, not just spawn. At the cottage they might do pretty well - nice meadows.
Edited by Adas (01/14/22 12:27 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Adas] 1
#27618519 - 01/14/22 12:38 PM (2 years, 4 months ago) |
|
|
Nice, I hope they will fruit. My logic tells me there is a good chance as they haven't exhausted themself yet and if temperatures and amount of rain is right they should pop. Fingers crossed.
|
soppos



Registered: 10/24/21
Posts: 591
Loc: 🍄
Last seen: 6 months, 1 day
|
Re: The Official Semilanceata Thread [Re: Adas]
#27618548 - 01/14/22 01:02 PM (2 years, 4 months ago) |
|
|
Quote:
Adas said: Acidity and pH balance are basically the same thing (if not, please enlighten me).
yeah we are kind of on the same page.
"pH measures the total [H+] in a solution and it is a quantitative measurement of acidity. Acidity gives a qualitative indication of the degree of acids present in a solution. As pH value increases, acidity decreases, and vice versa. pH also measures the basicity, not only acidity, pHs of less than 7 indicate acidity, whereas a pH of greater than 7 indicates a base."
pH expresses the degree of acidity and alkalinity as a value.
https://www.atago.net/en/databook-acidity_difference.php
Edited by soppos (01/14/22 01:05 PM)
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27618557 - 01/14/22 01:04 PM (2 years, 4 months ago) |
|
|
First they must survive the summer. At the cottage it's not so dramatic but down here we regularly have 35+ days. It might fry them.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Adas]
#27618580 - 01/14/22 01:21 PM (2 years, 4 months ago) |
|
|
I would check on them during spring though, who knows, might get lucky.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 4
#27629592 - 01/23/22 12:45 PM (2 years, 3 months ago) |
|
|
Bloody hell, just had a look and half of my 20 jars are finishing up early after 17 days 22days......I'm not ready yet

Edit:
Ok I had other plans for today but it's time to get my ducks in a row.
I have made bucket-teked coir and got into the grass clipping pile, The composted grass is looking great and seems to be a possible substrate for pans as well. You can adjust texture by using more or less composted grass, this varies from soil like over horse manure consistency to dry grass. It's really nice and could be the on shop stop for my substrate needs if is does perform well.

Next will be to sieve some bagged compost and I'm thinking a bag of top soil might come in handy.
Lots of mixes to try. It's just a bit early really, was planning on spawning beginning of March.
Edited by Baba Yaga (02/11/22 03:42 PM)
|
PsiloPsychIn
PsiloPsychIn



Registered: 06/17/14
Posts: 8,182
Loc: up north
Last seen: 3 days, 19 hours
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27631741 - 01/25/22 03:50 AM (2 years, 3 months ago) |
|
|
I have an old Liberty Cap print around, I think it’s time to see if they will still germinate…
Thank you for this thread Baba Yaga! 😊
-------------------- What are they saying? Listen carefully, it might be something you need to hear...
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: PsiloPsychIn] 5
#27641072 - 02/01/22 02:54 PM (2 years, 3 months ago) |
|
|

I have spawned the first 10 jars to various shoe boxes and monos.
The subs are:
Coir 100% Compost 100% Coir/Compost 50/50 Coir/H-Manure 50/50 Coir/Partially Composted Lawn Clippings 50/50
The other 10 jars are going into planters and an outdoor patch.
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27641095 - 02/01/22 03:08 PM (2 years, 3 months ago) |
|
|
 Thank you for this legwork, thank you a lot!
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Land Trout] 1
#27641137 - 02/01/22 03:51 PM (2 years, 3 months ago) |
|
|
Yeah no worries, I love doing this stuff.
Having the feeling that they will do alright on most if not all of these substrates since they are being already on steroids from all the nutes in the grain spawn. 100% coir compared to the rest is what I'm mostly interested in cause it has no decomposed plant matter in it.
|
Melliferous
🌵🍄🌵🍄🌵


Registered: 10/01/20
Posts: 1,053
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27641370 - 02/01/22 06:27 PM (2 years, 3 months ago) |
|
|
I've got an old semi print from Spain - going to follow along and see if I get inspired enough to see if they'll germ. 
Thanks for all the trailblazing sir!
--------------------
      "No, I don't worry. I tell you, I am a man who believed that I died 20 years ago, and I live like a man who is dead already. I have no fear, whatsoever, of anybody or anything."
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,392
Last seen: 2 days, 19 hours
|
Re: The Official Semilanceata Thread [Re: Melliferous] 10
#27651744 - 02/09/22 02:10 AM (2 years, 3 months ago) |
|
|
I did some microscopy on fruits cultivated by smalltalk_canceled, here are my findings:
Spores measure (11.5) 12.2 – 13.7 (16.5) × (6.9) 7 – 7.6 (8.6) µm Q = (1.6) 1.7 – 1.89 (1.9) ; N = 30 Me = 13 × 7.3 µm ; Qe = 1.8
Spores 1000x

Cheilocystidia 1000x

Behind the scenes:

Today a few people visited my lab including Peter Werner, who is a professional microscopist and a coauthor on the paper that described Psilocybe allenii. We decided to study this sample, and found that microscopically it's a perfect match for Psilocybe semilanceata. Peter made the cheilocystidia mounts and I was able to get some really nice photos of them. The cheilocystidia in this species is very distinctive, and we don't think there's any chance that it's something else.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
Awesome news Alan, thank you very much!
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 10
#27651968 - 02/09/22 08:15 AM (2 years, 3 months ago) |
|
|
Haha , it's official.
Take lunch, disbelievers
-------------------- Willpower is the one true virtue
  
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
|
We are happy for you, Smalltalk! It's great success for sure.
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
|
How simple can it be, or how complicated can we make it? Wish I had some from you collection on agar smalltalk, but was waiting for that confirmation. It will be neat to compare it with my other cultures. One really low effort experement I was running might be interesting. I had one plate the had some bacteria show up, so it went on the discard shelf. I had a hay bale that was pretty shitty, sometimes my sheep are either spoiled or they bale is just too stemmy for them, so I just left this bale outside all winter. It’s sprouted, moldy, and colonized with inky caps. I cut a big handful from the bale put it in a unicorn bag pasteurized it and put the semi plate with the bacteria on it inside the bag. And the fungi jumped from the plate to the spoiled hay. It was slow going but was going about as fast as I’m observing on grain. I also added a little bit of dry coir to the bag to balance the moisture content. I know it’s not a huge breakthrough, but gets the wheels turning for possible future experiments. I’ll try this with some more control shortly. Oh, almost forgot the important part. I put it outside by a big clump of grass and it looks like it died.😿
Edited by Land Trout (02/09/22 09:50 AM)
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Land Trout] 4
#27652209 - 02/09/22 11:42 AM (2 years, 3 months ago) |
|
|
I have prints for any shroomery member interested, first come, first served.
Looking for Bohemica and Baeocystis, but no requirement
-------------------- Willpower is the one true virtue
  
|
mind.at.large
Myconerd


Registered: 12/13/16
Posts: 1,230
Loc: Floating in liquid gardens
|
|
Smalltalk that is dope news!! Way to go dude super awesome!
-------------------- Mind's Easy Bag 2 Bag Grain Transfers Endless Sub Tek ...the doll's trying to kill me and the toaster's been laughing at me...
|
MysticMycologist
Dirt Sherpa



Registered: 10/14/21
Posts: 1,755
Loc: seeking samadhi
|
Re: The Official Semilanceata Thread [Re: mind.at.large]
#27652363 - 02/09/22 01:35 PM (2 years, 3 months ago) |
|
|
And so it begins.
-------------------- Two eyes to look, One eye to see. Prying open my third eye 
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
Almost done with spawning.
I've done 3 different, smaller outdoor patches instead of one big patch. From left to right the substrates are bagged compost, partially composted grass clippings and the last one is just soil that was in there since last year.

Also a few planter pots, three with compost coir, one with potting soil right out of the bag and the shoebox is compost coir as well which I had colonizing inside but started to show a bit of the mean green.

In total 2 shoeboxes and 1 minimono have shown either green or pin mold. I hope this is not culture related, have used 4 different LCs to noc up 20 jars so I doubt that all of them will turn sour, could have gotten in during noc-up as well.
All outdoor substrates will get some grass on top, not that I think it will help because of some symbiotic relationship, it's simply because it's so windy and dry here at times that I need something growing on top to keep things from drying out when I'm out of town.
The cakes are almost all done, will let those consolidate for another 3-4 weeks before putting in the ground. Lost 5 out of 21 early on.

And the jars that were inoculated over 4 month ago. Lost 4 out of 11 early on.

One spawn jar left gonna use this one to replace the mono tub I lost.
Edited by Baba Yaga (02/10/22 12:29 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27653819 - 02/10/22 01:41 PM (2 years, 3 months ago) |
|
|
Just checked on the two jars I cased and left with the lids on loose. Was putting them in the fridge every now and then at the beginning but this didn't do anything so I just kept them in the cupboard and misted every now and then.
Now we had quite high temps for a week in the mid to high 80's and I went to mist the jars since I haven't looked at them for 3 weeks or so. Found one of the jars with what seems to be lots of knots. Gave this one a good mist and will be putting it in the fridge for a couple of days or more.
I hope this is what I think it is.
Edited by Baba Yaga (02/10/22 01:58 PM)
|
Melliferous
🌵🍄🌵🍄🌵


Registered: 10/01/20
Posts: 1,053
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27653832 - 02/10/22 01:47 PM (2 years, 3 months ago) |
|
|
--------------------
      "No, I don't worry. I tell you, I am a man who believed that I died 20 years ago, and I live like a man who is dead already. I have no fear, whatsoever, of anybody or anything."
|
Tormato  
The Goddess Kali Meh 😛




Registered: 07/01/17
Posts: 6,067
|
Re: The Official Semilanceata Thread [Re: Melliferous] 1
#27654103 - 02/10/22 05:34 PM (2 years, 3 months ago) |
|
|
Well....you got my attention for sure.

Just happen to have 2 lib prints
-------------------- Helpful Threads The Shroomery Store Tormato's Q&A Thread Post Questions Here or PM me! "Lately it occurs to me what a long, strange trip it's been." ~ Grateful Dead Before you start...Do you have a Pressure Cooker and a Dehydrator? I highly recommend getting both!
|
Yeetusdeetus



Registered: 11/23/19
Posts: 1,242
Last seen: 12 hours, 25 minutes
|
Re: The Official Semilanceata Thread [Re: Tormato]
#27654254 - 02/10/22 07:15 PM (2 years, 3 months ago) |
|
|
--------------------

|
rhizoRider
Mycorrhizally expanding



Registered: 12/24/13
Posts: 2,483
|
Re: The Official Semilanceata Thread [Re: Yeetusdeetus]
#27654328 - 02/10/22 07:58 PM (2 years, 3 months ago) |
|
|

I wish wxom ( spelling) would post back also with agar plate looking like enigma cubes! Does anybody remember that agar plate cluster pic?📝
--------------------
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: rhizoRider] 1
#27654699 - 02/11/22 03:28 AM (2 years, 3 months ago) |
|
|
Yep I saw. But primordia on agar plates is commonplace for me, the fruits won't mature though so far.
-------------------- Willpower is the one true virtue
  
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
|
How long have your grains taken to colonize. I got two quarts that were knocked on the 10th of January. They’re looking good, but god damn, still were only about 75% the other day.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Land Trout] 1
#27655377 - 02/11/22 04:12 PM (2 years, 3 months ago) |
|
|
The jars took 4-5 weeks to fully colonize with temps being around ~75F (~25C). I noced up with LC and had PF-Tek substrate on top of the grain to make sure the LC recovers fast. This might have made a difference. Shook them twice.

So far the my cultures have mostly been OK on agar and grain in terms of grow speed but I read a few times that they can be slow.
Edited by Baba Yaga (02/11/22 04:18 PM)
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27656194 - 02/12/22 10:08 AM (2 years, 3 months ago) |
|
|
They aren't super slow, esp. on agar, but on grain they stall for me after some time so I have to shake again for them to finish colonizing.
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Adas]
#27656323 - 02/12/22 11:58 AM (2 years, 3 months ago) |
|
|
Sounds like contam, they behave normally once you have a good/clean culture.
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (02/12/22 11:59 AM)
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
|
It's definitely not contam. Probably just bad culture.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
I wouldn't pin this on contam, mycelium can do lots of crazy things like being slow or stalling without reason while being fine after a shake. Doesn't mean it's a dirty culture. Pans did that a lot for me and I'm sure Semis are capable of this kind of mischief as well.
Anyone got some more photos of cultures and jars?
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27656535 - 02/12/22 03:19 PM (2 years, 3 months ago) |
|
|
Will do once our guest room turns back into my lab.😬
|
ChildOfTheMoon
Stranger

Registered: 01/07/22
Posts: 143
Last seen: 1 year, 2 months
|
Re: The Official Semilanceata Thread [Re: Land Trout]
#27657059 - 02/13/22 05:26 AM (2 years, 3 months ago) |
|
|
Sorry if this is already answered somewhere, but is there any grow log or info around indoors P. Semilanceata grows? I don't have a garden to do outdoor grows in, but have some going on agar (and have dried caps left to experiment more with) and considering giving it a try, mainly just for the fun of researching it.
If I used a substrate similar to what you'd find outdoors and tried to mimic the temperature/moisture/FAE it would get in the wild, could that work or is there more to pay attention to?
Also when ending up with some fruit indoors, could you keep cloning to end up with genetics that grow much better in indoor conditions?
If I do the experiment I'll definitely keep a log and post updates.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
All the info I could find on the shroomery is linked at the bottom of the first post.
The grows that I would consider real indoor grows and documented the best are from captain future. Workman and cronicr did some as well but the info is a bit sparse or scattered over an entire thread. Just be aware that in some posts people are talking about all sorts of things to use in their substrates and how soil from outdoors is needed because of beneficial bacteria but I wouldn't pay too much attention to this and keep it simple. Cronicr has fruited from cased grain and 100% coir substrates apparently.
I would start with a few cakes/bottles with just coir and some with coir and horse manure or straw and horse manure. You can use BRF, whole meal flour or wheat bran for nutrients. Make as much cakes as you can and not just a couple so you have enough to play around with. Treat some different to the others and be patient, they can take a while before things are happening.
Good luck and yes, please let us know how things are progressing, doesn't matter if successful or not.
Edit:
It should be possible to selectively breed most species to improve results under certain conditions but this might take a long time and I'm not sure how far you will be able to push it. Would be of advantage to have more than one source of genetic material from different parts of the world I guess.
Edited by Baba Yaga (02/13/22 11:58 AM)
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27657560 - 02/13/22 01:41 PM (2 years, 3 months ago) |
|
|
Hey two of my boxes was under roof the whole time
-------------------- Willpower is the one true virtue
  
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
Yes sorry, but ChildOfTheMoon asked for a grow log and the thread about your semis doesn't contain much information about how you did it so that's why I haven't mentioned it in my reply. It's linked in the OP though.
Not saying that you haven't done a great job at growing yours. Would be good if you could get out a few details about your grow in one spot though and by the way, if you feel like linking your grow then go ahead and do it, this is not my thread, it's anyone's thread, I just started it.
The only really successful indoor grow on here I've seen is by captain future and he said that this was because of a specific culture he grew out and some of his cultures didn't fruit with his setup. I wouldn't consider a box in an unheated garage or shed a real indoor grow as some of the condition as still provided by the outdoor climate. Even fruiting in an unheated room in a house with the window open is not really an indoor grow IMO. So cronicrs grow isn't really indoor either in this respect cause this is what he did IIRC.
I have had a flower pot that fruited outside and after the first flush I took it indoors and put it into an SGFC in an unheated room and it grew 2 more flushes which I wouldn't call an indoor grow either.
IMO a real indoor grow would be a grow that is not influenced by outdoor climate at all at any point so it's done independent from the seasons.
But that's just an opinion and open for discussion.
Edited by Baba Yaga (02/13/22 08:24 PM)
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 3
#27658252 - 02/14/22 05:15 AM (2 years, 3 months ago) |
|
|
These are going to grains today. It's a culture from a cloned fruit
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27660143 - 02/15/22 03:52 PM (2 years, 3 months ago) |
|
|
Why is under roof outdoor grow?
Am i supposed to stay in the same room as the mycelia while it's fruiting? You can only place it in a initial room indoors to qualify for indoors grow?
I'm telling you, last two shoeboxes, under roof. No outside FAE.
Indoor conditions are affected by outdoor conditions - heard about winter? It's why we heat our houses.
What I did was no no different from moving them to a poorly isolated, low temperature room.
Flowerpot outside. Shoeboxes inside.
Garages are homes. Just ask Americans at this forum.
Shoeboxes intentional, i had beds that failed at the same time, so no need to move those shoeboxes to a porch etc- other cultures in ground, and temperature freezing outside when shoeboxes pin and mature inside roofed garage 0-10C
Garages are homes
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (02/15/22 04:02 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
As I said before you did a great job and I'm not actively dragging your grow through the mud here buddy. It just doesn't fit my definition of an indoor grow is all I'm saying. Just my opinion...everyone has one. No big deal.
|
ChildOfTheMoon
Stranger

Registered: 01/07/22
Posts: 143
Last seen: 1 year, 2 months
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27660819 - 02/16/22 02:46 AM (2 years, 2 months ago) |
|
|
Thanks for the answers!
I guess it doesn’t really matter to me if it’s “real” indoor or not (or if it works out or not, mainly just want to have fun experimenting), just can’t do it in a garden cause I live in an apartment. I could always try a flowerpot out of the window or something though.
I think I’ll try to make slants out of some of the agar just for the sake of preserving some of it, and use the rest for some experimentation. I don’t think I want to eat the caps I have left now that I have homegrown cubes (homegrown > stuff I bought from someone who got them from someone else who got it from another person), sounds more fun to try to grow from them.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
Experimenting is fun
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27663209 - 02/17/22 08:51 PM (2 years, 2 months ago) |
|
|
|
rhizoRider
Mycorrhizally expanding



Registered: 12/24/13
Posts: 2,483
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27664188 - 02/18/22 04:24 PM (2 years, 2 months ago) |
|
|
Did you just hurry that or in- burry it? Damn baba that looks SOLID  NICE WORK
--------------------
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: rhizoRider]
#27664207 - 02/18/22 04:39 PM (2 years, 2 months ago) |
|
|
Thanks. Raked the composted clippings away and dug a hole so it sits level with the ground, covered with composted and dry grass clipping mix. This substrate looks solid but was fragile as, you can see how it broke in the middle in the second photo. Might put the next one on top of the ground and cover with grass clippings. Lost 2 tubs and 3 shoeboxed to some green mold, still got 7 going and looking good so far.
Just checked the spawned patches and there are a myriad of critters in the soil. I wanted to spawn later in march when it's a bit colder and bugs are starting to turn dormant so I hope they are not munching it all up before prime time.
|
rhizoRider
Mycorrhizally expanding



Registered: 12/24/13
Posts: 2,483
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27664326 - 02/18/22 06:29 PM (2 years, 2 months ago) |
|
|
Anything eating it will poop it out spreading it for you  My azures first time outside had mice ravage my grain spawn, but their poops then lined mouse tunnels with mycelium! Looks 👍 great Captain future has semi in lawn after tossing old crap bags out for yrs. you will be rewarded also
--------------------
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: rhizoRider]
#27664964 - 02/19/22 10:15 AM (2 years, 2 months ago) |
|
|
Quote:
rhizoRider said: ... but their poops then lined mouse tunnels with mycelium!
Are you being serious right now? I find it hard to believe they wouldn't digest it.
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: rhizoRider] 1
#27665041 - 02/19/22 11:07 AM (2 years, 2 months ago) |
|
|
I’ve got a rat living under a shed I just spawned ovoids near and he comes out and digs to get at the grain, and I tell him to keep up the good work little guy! Pretty sure there figured a pretty tight relationship with Psilocybe mescaleroensis and rodents. Spawned a couple multi spore jars of semis to coir today.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Land Trout] 1
#27668245 - 02/21/22 07:00 PM (2 years, 2 months ago) |
|
|
Looking good Land Trout, are you going to bury those?
My tubs and shoeboxes are continuing to contaminate. I'm burying them as soon as I seen a spec of green. This might be due to the new coir that I use, sloppy pasteurization as I have reduced the time in the sous vide cooker down to 6 hrs or inoculation related. 
The subs do still smell nice so I think this will still work out in the end. Now I'm down to 2 mini monos with h-manure/coir and 3 shoeboxes with coir compost. The monos are nicely colonized and I have put one into fruitng conditions although it's still 25C during the day.
The monos have a top layer of h-manure/coir

The shoeboxes have a top layer of just coir and do not look as nice.

The outdoor patch with potting soil right out of the bag and the one with partially composted grass clippings have started to colonize which makes me very happy.
Edited by Baba Yaga (02/21/22 07:17 PM)
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27668313 - 02/21/22 07:43 PM (2 years, 2 months ago) |
|
|
Bury or I was thinking of mixing it in with some compost and loose hay in a spot that has some pretty tough grasses near my vegetable garden. My big hope is to just get these living in the soil with the greases right here. The myc already poked through the surface. I spawned these shoe boxes just like cubes.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Land Trout]
#27668328 - 02/21/22 07:55 PM (2 years, 2 months ago) |
|
|
Getting them established would be great. I had cakes buried in my lawn which did great but weren't producing anything the following year, also tried racking some cakes into the lawn. Maybe I should have dropped some manure in those spots to feed them. I hope you'll be successful with this.
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27668689 - 02/22/22 03:53 AM (2 years, 2 months ago) |
|
|

Sort of off topic(?) But this hispanica culture work is starting to play off, consider how close they are in appearance to the cultivated libs?
-------------------- Willpower is the one true virtue
  
|
Haywire
Wetspot Wizard



Registered: 12/29/13
Posts: 1,620
Last seen: 1 day, 20 hours
|
|
yo,
you guys planning indoor cultivation?
-------------------- Ciao mamma, guarda come mi diverto My grows Outdoor patches
|
BSUUF2
derails threads



Registered: 10/15/20
Posts: 666
Loc: not that important
Last seen: 2 years, 2 months
|
Re: The Official Semilanceata Thread [Re: Haywire] 1
#27668809 - 02/22/22 07:59 AM (2 years, 2 months ago) |
|
|
Trying to get my semi prints going today, this is really interesting.
Quote:
Haywire said: yo,
you guys planning indoor cultivation?
Maybe outdoor, a bit like that idea?
-------------------- LAGM2022
|
BSUUF2
derails threads



Registered: 10/15/20
Posts: 666
Loc: not that important
Last seen: 2 years, 2 months
|
|
Quote:
smalltalk_canceled said: I have prints for any shroomery member interested, first come, first served.
Looking for Bohemica and Baeocystis, but no requirement
Bohemica is native in Germany (where I live), might get some, if there's time to get there. (It's a >600km drive).
-------------------- LAGM2022
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: BSUUF2]
#27668879 - 02/22/22 08:51 AM (2 years, 2 months ago) |
|
|
It's covered but I'm in the market for edible, gourmet, medicinal
-------------------- Willpower is the one true virtue
  
|
BSUUF2
derails threads



Registered: 10/15/20
Posts: 666
Loc: not that important
Last seen: 2 years, 2 months
|
|
Quote:
smalltalk_canceled said: It's covered but I'm in the market for edible, gourmet, medicinal
Really large King Oysters? I've cloned some recently from a grocery store...
edit: misunderstanding
-------------------- LAGM2022
Edited by BSUUF2 (02/22/22 11:10 AM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Haywire]
#27669225 - 02/22/22 01:05 PM (2 years, 2 months ago) |
|
|
Quote:
smalltalk_canceled said:

Sort of off topic(?) But this hispanica culture work is starting to play off, consider how close they are in appearance to the cultivated libs?
Never ran hispanica but this culture looks like a winner.
Quote:
Haywire said: yo,
you guys planning indoor cultivation?
I wished bobwastaken would give semis a go in his fridge FC, I know that he managed to grow alutacea in the middle of summer but can't recall if he had a go at libs.
Here is a photo of his FC taken from his journal post.
|
jihad650
Stranger

Registered: 10/27/14
Posts: 17
Last seen: 1 day, 32 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27669425 - 02/22/22 03:12 PM (2 years, 2 months ago) |
|
|
Ive been experimenting over the last year with Semilanceata with some outdoor success. My wife and I bought 5 acres two years ago with 4 acres of old pasture in the PNW. lucky for me, the liberty caps were already there, even though the pasture hadn't had livestock on it for 5 years or so. I got 7grams dried that first October, November, so not a lot, but something. I took a sporeprint and cleaned it up on agar and transferred it to sterilized rye. It was a slow grower, and took 6 weeks or so to colonize after a few shakes. I then transferred that to pasteurized chopped straw and let it sit for another month or so. I then took that inoculated straw and put it under sod that lifted with a shovel in mid June. much later that i wanted but went for it anyway. I tried to mark with flagging some of the locations to know for sure if i was fruitful. At the end of September, i got my first flush in an area where I had never seen them before, so I know it works. unfortunately, i was only able to have about a 10% success rate though, and am still trying to figure out why. We put sheep pigs goats chickens, ducks and turkeys on pasture rotation when we first bought the place, so manure is being added every year. I ended up with 17grams last season form that field, so it is an improvement. But i still don't know why some areas fruited and others didn't. I think shade helps some, and we have a very wet clay soil, but I'm still at a loss as to what makes these guys tick. I've read that some fields are pure "Magic" and they flourish in the thousands. What is making them so special? Ive been thinking of taking soil samples at where they fruit and see if I can learn anything from that. But I am interested in any of your thoughts, or of any experiments you guys think would be good to run Etc. I just transferred to 14 qt. oat jars a couple of days ago, and am going to continue trying. lets figure this out collectively. Thanks for starting the thread!

|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: jihad650] 1
#27669663 - 02/22/22 06:29 PM (2 years, 2 months ago) |
|
|
Thanks for posting, always good to hear what others try to make it work.
What was your spawn/straw ratio and did you bury a whole block of straw or have you pulled it all apart? Also does it get dry in June / during summer in your corner of the planet?
I would try burying some denser subs like H-manure,coir,straw cakes/substrate with a decent nutrient content put some nicer soil around it like potting soil so it has something to expand into and plant a big cluster of grass on top or directly into it. Don't dig the substrate in too deep though.
Looking if there is any difference in soil between where they grow and where they won't might give you some useful insight. I don't think that clay is the best type of soil for them but that is just a guess.
Edit: Sounds like you have lots of space and could try growing them in some planters as well.
Edited by Baba Yaga (02/22/22 08:23 PM)
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27670449 - 02/23/22 02:22 PM (2 years, 2 months ago) |
|
|
Dude, this is not my idea, but now I'm a supporter of it:
hispanica and semilanceata is the same
My original hispanica print came from captainfuture, I seriously doubt he mislabeled it
Something is going on here because the fruits and myceliua is super similar, but semis don't throw pins on agar that mature afaik, never have I seen this on a agar plate labeled semilanceata, but I've now experienced 2-3 hispanica agar pins that matured
-------------------- Willpower is the one true virtue
  
|
CocaineBuffet
Stranger



Registered: 08/29/19
Posts: 3,762
Last seen: 1 hour, 51 minutes
|
|
Anyone got an extra print they are willing to trade? The print I have I have done 2 rounds of 4 plates and nothing germinates. Let me know
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: CocaineBuffet] 1
#27671026 - 02/23/22 11:21 PM (2 years, 2 months ago) |
|
|
Quote:
smalltalk_canceled said: Dude, this is not my idea, but now I'm a supporter of it:
hispanica and semilanceata is the same
My original hispanica print came from captainfuture, I seriously doubt he mislabeled it
Something is going on here because the fruits and myceliua is super similar, but semis don't throw pins on agar that mature afaik, never have I seen this on a agar plate labeled semilanceata, but I've now experienced 2-3 hispanica agar pins that matured
I hope you are sending a hispanica sample to Alan to get some testing done. Saw Alan saying that the sequence is almost the same but that post was from 2017, not sure if there was any development in the meantime. Maybe hispanica are semilanceata growing on a more nutritious substrate since they are looking closer to the once that are cultivated.
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: jihad650]
#27671134 - 02/24/22 02:40 AM (2 years, 2 months ago) |
|
|
Quote:
jihad650 said: Ive been experimenting over the last year with Semilanceata with some outdoor success. My wife and I bought 5 acres two years ago with 4 acres of old pasture in the PNW. lucky for me, the liberty caps were already there, even though the pasture hadn't had livestock on it for 5 years or so. I got 7grams dried that first October, November, so not a lot, but something. I took a sporeprint and cleaned it up on agar and transferred it to sterilized rye. It was a slow grower, and took 6 weeks or so to colonize after a few shakes. I then transferred that to pasteurized chopped straw and let it sit for another month or so. I then took that inoculated straw and put it under sod that lifted with a shovel in mid June. much later that i wanted but went for it anyway. I tried to mark with flagging some of the locations to know for sure if i was fruitful. At the end of September, i got my first flush in an area where I had never seen them before, so I know it works. unfortunately, i was only able to have about a 10% success rate though, and am still trying to figure out why. We put sheep pigs goats chickens, ducks and turkeys on pasture rotation when we first bought the place, so manure is being added every year. I ended up with 17grams last season form that field, so it is an improvement. But i still don't know why some areas fruited and others didn't. I think shade helps some, and we have a very wet clay soil, but I'm still at a loss as to what makes these guys tick. I've read that some fields are pure "Magic" and they flourish in the thousands. What is making them so special? Ive been thinking of taking soil samples at where they fruit and see if I can learn anything from that. But I am interested in any of your thoughts, or of any experiments you guys think would be good to run Etc. I just transferred to 14 qt. oat jars a couple of days ago, and am going to continue trying. lets figure this out collectively. Thanks for starting the thread!


I agre with Baba, clay is terrible soil for Libs, it's surprising they even grow there at all. And make your sub a bit more dense next time.
|
wxorx
elsewhere


Registered: 10/18/19
Posts: 90
Last seen: 3 months, 9 days
|
Re: The Official Semilanceata Thread [Re: Adas]
#27671386 - 02/24/22 09:04 AM (2 years, 2 months ago) |
|
|
Guys, I have a forgotten petri (with supposedly semilanceata culture) in the fridge which stays there for like a year maybe or something. Some time ago Smalltalk's thread reminded me about it and when I checked it had some kind of funky looking primordia, almost pins. It still stays there and the agar is a bit dried already. Just wondered if its possible for it to be still viable if I transfer it to a fresh dish? What do you think?
-------------------- void **
|
MysticMycologist
Dirt Sherpa



Registered: 10/14/21
Posts: 1,755
Loc: seeking samadhi
|
Re: The Official Semilanceata Thread [Re: wxorx]
#27671407 - 02/24/22 09:18 AM (2 years, 2 months ago) |
|
|
Give it a go. I’m not familiar with semis on agar, but my PE cubensis culture does this regularly on old, dryish plates. It’s seems to bounce back just fine when going to soft agar or grains though.
-------------------- Two eyes to look, One eye to see. Prying open my third eye 
|
wxorx
elsewhere


Registered: 10/18/19
Posts: 90
Last seen: 3 months, 9 days
|
|
Thanks, that is what I wanted to hear, there is still hope I guess I would still give it a try, but the demotivating "libs cannot be cultivated (indoor)", lack of time and procrastination would keep me indefinitely from starting it
-------------------- void **
|
jihad650
Stranger

Registered: 10/27/14
Posts: 17
Last seen: 1 day, 32 minutes
|
Re: The Official Semilanceata Thread [Re: wxorx] 2
#27671447 - 02/24/22 09:59 AM (2 years, 2 months ago) |
|
|




I don’t know if clay type soil is ideal or not, but they don’t seem to mind it. What type of soil are you guys finding them in?
I will try a more nutritious substrate my second go around, thanks for shareing.
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: jihad650]
#27671452 - 02/24/22 10:02 AM (2 years, 2 months ago) |
|
|
They love airy acidic soils. In my country they only grow in mountain meadows. 1000m+
|
wxorx
elsewhere


Registered: 10/18/19
Posts: 90
Last seen: 3 months, 9 days
|
Re: The Official Semilanceata Thread [Re: Adas]
#27671468 - 02/24/22 10:10 AM (2 years, 2 months ago) |
|
|
Even higher elevation here, at least 1500m. The closest to me place where you can find them is 200+ kms driving and few hours mountain hike. As for the soil - I've read somewhere that they prefer specific soil types, I believe the guy who mentioned that was from some of the Baltic countries, and they had very verbose soil map. I've found soil map of my country made in the 50s of XX, but it was hard to translate and correlate to the english type names he mentioned
-------------------- void **
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: Adas]
#27671478 - 02/24/22 10:18 AM (2 years, 2 months ago) |
|
|
How important is the relation to livestock? There is a lot of open meadow that only gets mowed once a year but isn’t grazed near me. Is it just that they keep the grasses growing and keep shrubs out and that’s good habitat? Or does the manure help? Do you all find them thriving in meadows that arnt grazed?
|
Bobbins
Stranger
Registered: 02/02/22
Posts: 445
Last seen: 1 year, 7 months
|
Re: The Official Semilanceata Thread [Re: Land Trout] 1
#27671483 - 02/24/22 10:22 AM (2 years, 2 months ago) |
|
|
Quote:
Land Trout said: How important is the relation to livestock? There is a lot of open meadow that only gets mowed once a year but isn’t grazed near me. Is it just that they keep the grasses growing and keep shrubs out and that’s good habitat? Or does the manure help? Do you all find them thriving in meadows that arnt grazed?
In my experience they grow where there is sheep/cow poop around and rarely anywhere else. Sheep poop is particularly a good sign for them being around.
-------------------- DeALeRsHrOoMs
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: Land Trout] 1
#27671486 - 02/24/22 10:24 AM (2 years, 2 months ago) |
|
|
Quote:
Land Trout said: How important is the relation to livestock? There is a lot of open meadow that only gets mowed once a year but isn’t grazed near me. Is it just that they keep the grasses growing and keep shrubs out and that’s good habitat? Or does the manure help? Do you all find them thriving in meadows that arnt grazed?
It is probably beneficial but it's absolutely not necessary. Their primary food is dying roots or grass blades. I have seen them in habitats with zero grazing activity.
|
wxorx
elsewhere


Registered: 10/18/19
Posts: 90
Last seen: 3 months, 9 days
|
Re: The Official Semilanceata Thread [Re: Land Trout] 2
#27671488 - 02/24/22 10:25 AM (2 years, 2 months ago) |
|
|
Manure helps for sure, but it is not the main thing for sure. Up there some free horses graze. At lower altitudes there are more cows and horses and pastures that look the same, but you can't find any libs there. I believe its overall too hot and dry at lower altitudes
-------------------- void **
|
jihad650
Stranger

Registered: 10/27/14
Posts: 17
Last seen: 1 day, 32 minutes
|
Re: The Official Semilanceata Thread [Re: Bobbins]
#27671502 - 02/24/22 10:39 AM (2 years, 2 months ago) |
|
|
Adas, can you expand a little on the idea of “airy” soil? Meaning loamy or…
|
jihad650
Stranger

Registered: 10/27/14
Posts: 17
Last seen: 1 day, 32 minutes
|
Re: The Official Semilanceata Thread [Re: jihad650]
#27671505 - 02/24/22 10:42 AM (2 years, 2 months ago) |
|
|
They grow at my place at only 57 meters
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: jihad650]
#27671540 - 02/24/22 11:10 AM (2 years, 2 months ago) |
|
|
Quote:
wxorx said: Manure helps for sure, but it is not the main thing for sure. Up there some free horses graze. At lower altitudes there are more cows and horses and pastures that look the same, but you can't find any libs there. I believe its overall too hot and dry at lower altitudes
I believe this also, too hot and dry generally.
Quote:
jihad650 said: Adas, can you expand a little on the idea of “airy” soil? Meaning loamy or…
The soil you find in the mountains. Rich in organic material and not compact.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Adas] 1
#27671906 - 02/24/22 03:44 PM (2 years, 2 months ago) |
|
|
Buried the rest of the tubs today, they didn't show any contam but I needed to get rid of the tubs. The cakes are going in the ground in a couple of weeks and then I won't have any more new stuff in the pipeline. Focusing on autumn forest walks when it's all done.
Fingers crossed it's going to work out this season, had a dream last night in which my flower pots had grown some nice flushes but upon closer inspection all the mushrooms I thought were semilanceata had pores instead of gills. Needless to say that I got really bummed out in that dream .
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27674029 - 02/26/22 09:54 AM (2 years, 2 months ago) |
|
|
 I noticed little knots on these plates. I have three plates of this culture and two other cultures from the same print. 2 out of the three plates of this culture show a couple knots. Pins? Pseudo sclerotia? I’ll put this one to liquid culture. My shoe boxes are looking really good. The grain really didn’t impress me that much, but it’s looking a lot like tomentose cubes the way it’s going through coir.
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Land Trout] 2
#27674259 - 02/26/22 01:08 PM (2 years, 2 months ago) |
|
|
Pics update:
Semilanceata on rye berries from agar plate:

Semilanceata (clone) plates:
|
Gnomenclature
Always learning

Registered: 12/07/21
Posts: 99
|
Re: The Official Semilanceata Thread [Re: jihad650]
#27674550 - 02/26/22 05:11 PM (2 years, 2 months ago) |
|
|
Maybe some of your patch failures produced sclerotia this year and will fruit next year? Just a thought.
|
jihad650
Stranger

Registered: 10/27/14
Posts: 17
Last seen: 1 day, 32 minutes
|
Re: The Official Semilanceata Thread [Re: Gnomenclature]
#27675446 - 02/27/22 12:21 PM (2 years, 2 months ago) |
|
|
Yeah, I thought of this as well. I sure hope this is the case! We’ll have to wait and see.
On another note, I think your right Adas about the airy soil hypothesis. A fair amount of mushrooms fruited right out of the side of a trench we dug in the pasture last summer and haven’t filled in yet. It could be because of the air exchange going on. I’m going to try and aerate the soil this spring/summer and see if it triggers more fruiting. Here’s an example
|
Philly269
Stranger

Registered: 10/28/21
Posts: 6
Last seen: 2 years, 2 months
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27675580 - 02/27/22 01:46 PM (2 years, 2 months ago) |
|
|
I'm lucky enough to have these growing wild locally and I can honestly say these are my favourite mushrooms to trip with
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Philly269] 3
#27676185 - 02/27/22 09:03 PM (2 years, 2 months ago) |
|
|
Cakes going into planter pots, 2 with potting soil and 2 with compost, both right out of the bag.

|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27678454 - 03/01/22 03:47 PM (2 years, 2 months ago) |
|
|
Those look great imo ☺️
Id like to see pictures of the mycelium bruising please.
And any pictures of fruits bruising
Blue obviously
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (03/01/22 04:04 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
Thanks, and I hope the are going to do great as well.
Haven't come across mycelium bruising yet but I can try to provoke it when birthing the last lot of cakes. Fruits were also not bruising much, this photo is from 2 years ago.
If I'm growing more this year then I will try to get some more photos.
Have you got any of bruising mycelium?
|
rhizoRider
Mycorrhizally expanding



Registered: 12/24/13
Posts: 2,483
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27678574 - 03/01/22 05:14 PM (2 years, 2 months ago) |
|
|
Neat bruising pic yaga
--------------------
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: rhizoRider] 1
#27700138 - 03/18/22 12:39 PM (2 years, 2 months ago) |
|
|
 Have had these shoe boxes for awhile now. Moved them out in the patio hoping to trigger some fruiting, but nothing yet. It looks dry, was misting it but not sure if it was helping. Might case with some old damp hay or something. Any suggestions?
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Land Trout]
#27700224 - 03/18/22 01:46 PM (2 years, 2 months ago) |
|
|
Nice LT, this is 100% coir right? I do prefer keeping substrates in planters (something with drainage holes) or in the ground. Simply because it is easier to water the sub. Are you going to expand or feed this more till next cold season?
Things are not looking so good here, basically everything I mixed up with coir got moldy, even when kept outside. The 100% potting mix and other coir free patches are still fine, the cakes seem to be OK as well so there is still hope.
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 3
#27700239 - 03/18/22 02:02 PM (2 years, 2 months ago) |
|
|
Tried this!
 Was weeding the garden and found some grasses I thought looked right. I just put them in top of the sub and buried the roots in potting soil. I’ll drill some holes in the bottom so I can water. My theoretical plan could also be I grow out clumpy grasses in the substrate and then broadcast the clumps in places that look like good habitat. Probably would work better if I just sit on my hands and do nothing, but I can’t help myself and turn my brain off. Still got one shoe box I can set and forget. Made some good looking LC and have a bag of grain colonizing. Plus new plates from small talks print, it’ll be neat to compare.
Edited by Land Trout (03/18/22 02:05 PM)
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Land Trout] 1
#27700346 - 03/18/22 03:26 PM (2 years, 2 months ago) |
|
|
2022 season starting now, blessings to all semilanceata growers
This will be the best year yet, I think
Goals this autumn:
- Fruit semis from spots in the lawn/garden - Make more complex cakes: straw/manure/etc - Find a bruising specimen - Receive Alans information on the sequencing
Feels good to be in good time this season, my first jars of semi cultures finishing already in march. Got around 20 more jars on the way, divided into original cultures from last year, and cultures that have been sorted after showing stone-like behaviour in jars, and those that have not.
Today I spawned two new spots in garden, dug down cornspawn of okay quallity a few inches down with a spade, and then cowered it with a thin layer of coir, and then toppe with normal garden soil w/attached grass.
Marked the spots with some tall spiky objects.
Looking forward to the ground unfreezing so I can take a look at last years spots. They are still trapped by ice.
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (03/18/22 03:31 PM)
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
|
Sorry to double post, but this is such a separate question that I wanted to put it alone.
"What do we know about semilancata DEPTH"
Like, how far down in the soil does semilancata "live"?
The grass root theory suggests that it lives pretty close to the surface
-------------------- Willpower is the one true virtue
  
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
|
I would assume it could live pretty deep. Grass roots penetrate very deep, and when they die the fungus could colonize them. Since they prefer well-draining soils, there could be plenty of oxygen to cover their needs.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Adas] 1
#27700377 - 03/18/22 03:51 PM (2 years, 2 months ago) |
|
|
Nice, you guys are right up there doing the do, that is all that counts and I'm looking forward to the the results. Also cool that Alan is going to sequence your specimens smalltalk.
I am actually thinking about whipping out a few Semi prints and do some agar work over the winter cause I'm going to bin all the cultures I've got in storage. Should work alright even with the occasional very low temperatures.
Quote:
smalltalk_canceled said: Sorry to double post, but this is such a separate question that I wanted to put it alone.
"What do we know about semilancata DEPTH"
Like, how far down in the soil does semilancata "live"?
The grass root theory suggests that it lives pretty close to the surface
Quote:
Adas said: I would assume it could live pretty deep. Grass roots penetrate very deep, and when they die the fungus could colonize them. Since they prefer well-draining soils, there could be plenty of oxygen to cover their needs.
My guess is the top 3-4 inches is where the most action is happening and then it would depend on the quality of the soil which would also determine how far down the grass root are getting. The roots will definitely help to aerate soils.
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27700945 - 03/19/22 01:18 AM (2 years, 1 month ago) |
|
|
First failure. I put three colonized plates to (rye) grains, just over a month ago. Growth is hardly visible. These jars will dry out before anything else at this pace.
So, I'm guessing you guys use lc to colonize the grains?
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: Tweeq]
#27701038 - 03/19/22 05:56 AM (2 years, 1 month ago) |
|
|
No LC, I just shake them several times during colonization.
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Tweeq]
#27701039 - 03/19/22 06:02 AM (2 years, 1 month ago) |
|
|
no lcs here either, thats a fast track but for this vulnerable culture work i usually only do agar wedges tweeq
-------------------- Willpower is the one true virtue
  
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
|
Hmm ok thanks guys. I've never had something quite this slow before so Idk what my next step will be at this point. Got some more colonized plates but I feel that going to grains with them is not going to work out if the other three are an indication.
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Tweeq]
#27701100 - 03/19/22 08:00 AM (2 years, 1 month ago) |
|
|
Its culture, even if the species is weeks slower than cubes in terms of colonization. Germinate more ms
-------------------- Willpower is the one true virtue
  
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
|
Yeah I guess I will. Should still be in time.
|
Bobbins
Stranger
Registered: 02/02/22
Posts: 445
Last seen: 1 year, 7 months
|
Re: The Official Semilanceata Thread [Re: Tweeq]
#27721747 - 04/05/22 05:36 AM (2 years, 1 month ago) |
|
|
There is an area near me where there are a lot of sheep farms. Libs grow throughout those fields in abundance every year. I don't pick from the farmers fields as they are too hard to spot as the grass isn't maintained, but in the middle of the farms is a huge football (or 'soccer') pitch for the local kids, it is enormous with 3 football pitches on it and the grass is mowed every week and the farmers donate their sheep poo to the club to use as fertiliser. These fields have produced for over 30 years consistently that I know of and I am positive the sheep poo is the reason why.
There is no shade on these fields and the whole area is open to the elements being on top of a hill... Lots of wind and rain during picking season.
-------------------- DeALeRsHrOoMs
|
trippleblack
Stranger

Registered: 12/01/19
Posts: 373
Last seen: 2 months, 6 days
|
Re: The Official Semilanceata Thread [Re: Bobbins] 2
#27747537 - 04/23/22 12:15 AM (2 years, 26 days ago) |
|
|
These have been fruiting for about 3 weeks.
in a tent indoors 60 degrees.. cased with 50/50 and wheat grass seed. appears as if i'm getting pins. certainly not cubes, as they would have pinned way earlier and matured by now. i did spore isolations with sporeprints from either jake or another trusted shroomery vendor. substrate is hpoo/straw and a bit of sand.



I also have a few planters growing outside.. one of the isolates actually had pins inside the spawn bag i sterlized h/poo in.. they died off once placed outside.
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: trippleblack]
#27749121 - 04/24/22 04:19 AM (2 years, 25 days ago) |
|
|
They may not be Cubes but they are certainly not Semi. Those pins are fat and huge too. No way.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Adas] 1
#27749850 - 04/24/22 06:09 PM (2 years, 25 days ago) |
|
|
Yeah, mighty fat pins you got there. Have to agree that these are not looking anything like semilanceata or related species. Keep us updated, I like to know where this is going to end up.
Update on my outdoor project which seemed to be nothing but a big trich-fest until this morning. Smalltalk PMed me asking how my stuff was doing and I said nothing is happening cause it is still too warm and dry here, but we had a little bit of rain over the last 3 days and dew is becoming heavy lately so I thought I have a look and found this little fella.

This is the only one so far and it grew from trichy subs I had buried in partially composted grass clippings. Man I am so happy that I got at least this one for now, I hope it's enough to get DNA sequencing done. I doubt it will drop any spores as it is not quite mature enough but had to pick it before the slugs devoured it.


It does bruise blue and has a separable pellicle and it looks like the other presumed semilanceata mushrooms I grew a while ago. Now having said this, Smalltalks mystery grow turned out to be femitaria and I had send him a print of mine so there is a chance that these will turn out the same but it is not sure that what he grew was actually from my print and although fruits from his and my grow are similar, I never encountered veil remnants on the caps like he did and I had more pronounced nipples (see photos in signature) and as far as I remember his fruits didn't bruise so there might be a chance that mine here are different....will have to wait and see.
However, exciting news as I thought all was lost.....now hoping for more fruits and getting sequencing done to find out what we got here.
Edited by Baba Yaga (04/26/22 03:26 AM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27750875 - 04/25/22 03:57 PM (2 years, 24 days ago) |
|
|
Found some pins growing from spawn to potting mix substrate. That pot was growing green mold as well which is why I had it sitting behind the compost pile. Things are certainly on the move now.
|
rhizoRider
Mycorrhizally expanding



Registered: 12/24/13
Posts: 2,483
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27755810 - 04/28/22 10:02 PM (2 years, 21 days ago) |
|
|
 Plz post more pics Excellent work baba
--------------------
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: rhizoRider]
#27755971 - 04/29/22 12:55 AM (2 years, 20 days ago) |
|
|
Thanks, you can be assured that I will def. post more photos but the weather is still dry as atm. Wished we had a week of rain.
I just hope that these are semis, will make arrangements to send a sample to a lab on the weekend.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27764832 - 05/05/22 05:31 PM (2 years, 14 days ago) |
|
|
Still not much happening but one pot does produce a few pins all in all I harvested a second mushroom LOL. I will send away samples once I have 4 mushrooms. No candidate to print yet.
|
Bobbins
Stranger
Registered: 02/02/22
Posts: 445
Last seen: 1 year, 7 months
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27765393 - 05/06/22 02:08 AM (2 years, 13 days ago) |
|
|
Quote:
Baba Yaga said: Still not much happening but one pot does produce a few pins all in all I harvested a second mushroom LOL. I will send away samples once I have 4 mushrooms. No candidate to print yet.

Aren't the gills on libs always dark? This doesn't look like one to me. I pick them wild and the gill colour here would make it a definite non-lib based on picking many thousands in my time.
-------------------- DeALeRsHrOoMs
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Bobbins] 2
#27766290 - 05/06/22 05:13 PM (2 years, 13 days ago) |
|
|
Thanks for your input Bobbins, it gave me a kick to write this post which I wanted to do for a while now.
The gills on the mushroom in question are white because it's sterile or hasn't produced any spores yet, I hope some will though. The spores I used for this grow were coming from prints taken from my last successful grow two years ago. Back then the fruits were showing purple gills like you would expect from a psilocybe.

Now having said this, while the fruit in question is undoubtedly a psilocybe it's not 100% sure that this is an actual semilanceata. I had a look through some old shroom photos which I don't have a lot of and I only have one image of a collection which might be the collection I got the original spores from but at least is an example of what I was used to find where I lived before.

I managed to get 3 or 4 prints and maybe one of these fruits was indeed something different like Ps. fimetaria. I will have to have a look if I still got those prints but it must have been 5 years ago or so and they might be lost. Unfortunately I do not live near the collection site anymore and I haven't found any semilanceata around my new home so far.
I know that my cultivated fruits are not looking like libs but most of any cultivated semilanceata do actually look very different to wild specimens so far. Here are a few images of cultivated semilanceata examples. (Please note: member names are links to their grow posts.)
Workman's grow #1 & #2:

Cronicr's grow:
 
CaptianFuture's grow:

Baba Yaga's grow:
There is also smalltalk_cancled's grow which turned out to be fimetaria but if you want to check his posts out then follow this, this, this or this link.
I really hope that I'm growing semilanceata here or else this thread is in need of some serious rebranding. Can't wait for other members to show what they are getting out of their grows.
I sifted through a few of the semilanceata Hunting Threads to find images of unusual looking wild fruits that would match more of the phenotypes which have been growing in my patches and I managed to find a few examples of wild fruits that had a somewhat similar look. This doesn't mean anything really though and is no proof which is why I will get my fruits sequenced.


I'm sorry that I can't name the OPs of those photos cause I just downloaded them without taking notes. So thanks to all you nice people that are uploading their finds for us to enjoy and use.
Edited by Baba Yaga (05/15/22 04:53 AM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27769065 - 05/08/22 07:14 PM (2 years, 11 days ago) |
|
|
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27770049 - 05/09/22 04:32 PM (2 years, 10 days ago) |
|
|
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27770588 - 05/10/22 12:44 AM (2 years, 9 days ago) |
|
|
Beautiful Baba! These were spawned this year?
I still have a few rye jars going. Ignored Smalltalk's advice to chuck and start over (sry). I'll try and get a pic later today. There is mycelium all over the jars but it looks very thin/whispy, idk the right word but it's very hard to see. From a distance you'd think nothing much is going on in those jars.
Since there is nothing much to lose I will probably be spawning all of it to trays. Contemplating on whether or not to pasteurize.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Tweeq]
#27770638 - 05/10/22 03:12 AM (2 years, 9 days ago) |
|
|
yep that was spawned mid-end Feb end of Jan. Got lucky that I grew anything because of mold infestation.
I would pasteurize because your spawn in questionable (?), so you know that it's not your bulk sub when it turns moldy.
Photo of your spawn would be cool.
Edited by Baba Yaga (05/10/22 03:07 PM)
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27770915 - 05/10/22 09:16 AM (2 years, 9 days ago) |
|
|
Ok so here we go. Spawn is a big word for this.
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 3
#27772821 - 05/11/22 03:51 PM (2 years, 8 days ago) |
|
|
Im looking into improving our capacity for ITS sequencing through friendship and advertising, so in the future it might be possible that I too can receive samples and send them to ITS sequencing. Its been my hope Alan would be liberal with this for us in the future for us trying to work out the semilanceata problem once and for all, but self-suffiency is ideal.
I can report that I feel like a prepared contender for a semilanceata cultivation + ITS sequence ID this season, real hulk hogan grim reaper style, because i have a multitude of different either fimetaria, hispanica or semilanceata cultures, all being sent outside this year with the utmost care and preparation. One of them HAS to be semis. It WILL fruit.
People have no idea how much time has been spent on this project by me now so far. and how long some stuff have been growing. its all being spawned outside this season, either precolonized inside subs to outside, or straight grains to the ground, with focus on the former and not the latter because grains to ground seems to have the mycelium struggle a bit this early spring in general for me.
Cultures: F10, F9, F3, Semi Bing, Semilanceata 104 ++
There's plates with primordia, there's a topfruited shoejar with primordia, and it looks like the fimetarias are fruiting hard in spring, and there's also this either OTHER PHENOTYPE FIMETARIA or what the fuck are these? THey have not been sequenced by Alan, and its my #1 priority to have these ITS sequenced.
I originally thinked these were fimetarias too, but now im unsure and at least want to get it tested.
Quote:
On Mon May 09 2022 04:40 PM, smalltalk_canceled said: What you think

also i believe that ITS sequencing of your fruits will turn out to be semilanceata or at least something other than fimetarias, and i belive this is the picture that suggests it the most, i mean if this was a semilanceata ID thread picture...
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (05/11/22 04:02 PM)
|
keeno
enthusiast



Registered: 06/01/11
Posts: 2,679
Loc: UK
Last seen: 12 days, 17 hours
|
|
amazing stuff. I'm just discovering this thread before I go to bed, so this is me bookmarkign in a way.
quick question where's the nipples? cheers!
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: keeno] 1
#27774453 - 05/12/22 06:15 PM (2 years, 7 days ago) |
|
|
This is the first specimen with a nipple this year.

Phenotypes are all over the place just look at the first and last photo in my signature. That is why I sometimes think "yes, these are semis" and the next time it's like "mmmh, not sure what these are".
I got enough material to send away now, have asked Alan if he is interested in sequencing but he hasn't gotten back to me yet. Well he is a busy man and if I haven't heard back from him in a week then I will send samples to Alva Lab in Spain.
Hey smalltalk, good on you for developing the skills to do DNA sequencing
|
keeno
enthusiast



Registered: 06/01/11
Posts: 2,679
Loc: UK
Last seen: 12 days, 17 hours
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27775203 - 05/13/22 07:14 AM (2 years, 6 days ago) |
|
|
wow, so different to the ones I'm used to here  fascinating stuff Baba!
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: keeno] 3
#27775950 - 05/13/22 06:03 PM (2 years, 6 days ago) |
|
|
Picked 3 more fruits today.

The smaller two are actually producing some spores, these are going to be tiny prints. The big one is sterile again. The light red brown color is actually giving away sterility early on I think. I remember from the last grow that fruits with the same red brown cap color would not produce spores. I can't remember now if that was a 100% true for each and every example though but a significant tendency for sure.
15 or so pins have popped up in the flower pot.

A couple more in the one garden patch as well. Better mushroom weather is on the horizon so there is hope that numbers will improve a little bit.
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27776325 - 05/14/22 12:09 AM (2 years, 5 days ago) |
|
|
Very nice Baba 
The two jars I posted were spawned to untreated potting soil and topped off with some more soil mixed with grass seed.
I have low/no expectations. Just growing two trays of grass now basically 
We'll see if it grows anything other than grass in October!
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Tweeq] 5
#27778547 - 05/15/22 03:11 PM (2 years, 4 days ago) |
|
|
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27778551 - 05/15/22 03:12 PM (2 years, 4 days ago) |
|
|
save a print bro
-------------------- Willpower is the one true virtue
  
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
I will, the only print I managed to pull so far is very faint and only 5mm across.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 3
#27783246 - 05/18/22 04:11 PM (2 years, 1 day ago) |
|
|
Last update with a few photos before the gender reveal, don't know how long it will take till I get results, only just took the first step and got into contact with the lab for a preliminary quote. Some of the caps are dropping spores, can't tell yet how good they are going to be because they are still printing but I can see spore deposits under a few the caps.

|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27783271 - 05/18/22 04:35 PM (2 years, 1 day ago) |
|
|
Bruising?
-------------------- Willpower is the one true virtue
  
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
Yes they bruise after ~20 min or so, here the photos I posted before

Will have a look at the caps currently printing if they have bruised and there are still a few more to harvest. I assume that not all of them will though.
Edited by Baba Yaga (05/18/22 05:11 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27783615 - 05/18/22 09:57 PM (2 years, 1 day ago) |
|
|
OK, this is the last update now for real and extra for you smalltalk. I have picked a few more fruits and tried to provoke bruising.

This time they were blueing less than before. Took a long time to develop and it was so faint that the camera wasn't really picking it up. Had to ramp up color saturation on the computer to make it more visible. It was more obvious when looking at it directly. In the first photo you can see the little primordia bruising blue.

EDIT: some more bruising on one of the bases

Also took better shots of the separable pellicle

OK That's it for a while, I am having a break from the forum for some time starting after this weekend. Will probably be back once I get the results from the DNA sequencing back.
Edited by Baba Yaga (05/20/22 05:49 PM)
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 5
#27784220 - 05/19/22 12:19 PM (2 years, 10 hours ago) |
|
|
These were both spawned May 13th. They are 6 liter trays but not completely full.

Each tray has one jar mixed with potting soil (straight from the bag) and a thin top layer of potting soil and grass seed.
At least the grass is happy atm. Will report back if/when something happens.
Im currently growing a few more dishes bc I want to slant this clone culture, just in case it turns out to be good after all.
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: Tweeq] 2
#27784471 - 05/19/22 03:18 PM (2 years, 7 hours ago) |
|
|
Cool dudes! I’ve put my couple little tubs in the ground, and had one bag of spawn that didn’t look to good so I just broadcast it around the yard and in the taller grass, and in the feeders and I think some of the sheep took a few bites. Still making spawn, think I’ll keep broadcasting it in the lawn, figure even it the rodents movie is around and eat it it’ll still get spread to even better places than I can get it to.
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Land Trout] 3
#27784497 - 05/19/22 03:36 PM (2 years, 6 hours ago) |
|
|
I got a new culture fruiting now, will share pics once the primordia develops. Hopefully its not another fimetaria! But its more than likely sadly, because if a true semilanceata fruit show up in a top coired spawn jar, well i'll be damned.
Edit: the fruiting jar

Some of my subs getting ready:

Grass seeds are not hard to work with at all imo
Pin coming in:
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (05/21/22 10:52 AM)
|
Zenn
LittleLurker



Registered: 09/22/19
Posts: 300
Last seen: 1 year, 7 months
|
|
Awesome thread.
Just happen to have put some semi spores on agar today, let's see what happens. Last grow attempt failed, but it was a learning curve.
Fingers crossed
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Zenn] 5
#27806037 - 06/04/22 06:45 PM (1 year, 11 months ago) |
|
|
Can't believe how fast time is passing, it's only 3-4 month before the northern hemisphere grows are hopefully popping some fruits. The sample for sequencing is on it's way. Hopefully The results will be in soon. In the meantime I use this state of uncertainty to post a few more pictures of these unconfirmed semis. My one flower pot is still producing a small number of fruits every few days. There are more fruits that are looking more semilanceata'ish now and quite a bit of bluing is showing as well. So happy that at least that one substrate is producing something. Trich took out all my shoeboxes, tubs and pots apart from this one. Have to take more care with culture selection and keeping more than one genetic line in the mix to avoid failure of that magnitude in the future.
Edited by Baba Yaga (06/15/22 03:41 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Zenn]
#27806042 - 06/04/22 06:54 PM (1 year, 11 months ago) |
|
|
Quote:
Zenn said: Awesome thread.
Just happen to have put some semi spores on agar today, let's see what happens. Last grow attempt failed, but it was a learning curve.
Fingers crossed
Good luck!
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27812332 - 06/09/22 03:11 PM (1 year, 11 months ago) |
|
|
Outdoor spawn spring fruiting, Fimetaria, the semilanceata brother I'd say considering how close they are in appeareance for some fruits. especially how they turn beige/lighter as they dry.



Bruising fruits from outside, fines, or finally semis!?
No but important!
Unexpected to see them bruise like this - first time
Im thinking of eating those blue ones!
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (06/09/22 04:36 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
What ever they are, they are beautiful. Are you getting them sequenced?
Make sure you are keeping track of the genetic source.
|
ChildOfTheMoon
Stranger


Registered: 01/07/22
Posts: 143
Last seen: 1 year, 2 months
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27821900 - 06/16/22 03:05 AM (1 year, 10 months ago) |
|
|
Hey! I’m trying to get some semis going on agar to try a few indoor and outdoor grows.
Does this look like semi mycelium? I think so?

I have another plate that I transferred from the same parent, but I think there’s maybe some bacteria going along there cause it looks a bit thicker/slightly tinted.

Potato quality pictures cause I didn’t feel like setting up and cleaning my SAB just to remove a lid for three seconds, sorry.
Haven’t been able to find any in the wild yet or get spore prints, so my process has been to scrape the inside of a dried cap (from a bag I bought from a 🔌) on agar and clean it up. This is the first transfer, will probably do another one before going to grain. This is how I started all my cubes so I know it works to get mycelium growing from dried like that.
But they’re foraged, had a ton of contam on the first plates, and I haven’t seen a lot of semi plates, so for all I know I transferred along spores of something else.
Excited for this experiment though!
Edit: forgot to mention. There’s a bit of activated charcoal in my agar, which always makes the myc whispier/thinner and stand up a bit.
Edited by ChildOfTheMoon (06/16/22 03:16 AM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
There are a few photos of cultures on the first page of this thread. Your first plate looks alright from what I can see, photos of the other one are not showing much detail. Just transfer til you get some regular circular growth.
God job on reviving dried material once again. I hope you are getting some harvestable results.
|
ChildOfTheMoon
Stranger


Registered: 01/07/22
Posts: 143
Last seen: 1 year, 2 months
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27824195 - 06/17/22 01:33 PM (1 year, 10 months ago) |
|
|
Cool, thanks! Will do some more transfers next week and maybe send some of the first plate to grain already.
Not expecting much result at once, but will be fun to find out what happens. Forgot to write down my agar transfer dates, but am starting to take notes on every step of the process from now on. Seems to be slower on agar than cubes though.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
Just wanted to let you guys know that the grows I posted are now officially confirmed to be semilanceata via gene sequencing. Really happy that this is settled now.
Sequence:
ACCTGATTTGAGGNCAAATTGTCATTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTTGCAAGGAGAGCTTGTGAAAGCAATCCTCTTGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGAAACCAAGGAAA
Alignment with the top match in Blast showing only one difference between the two and a phylogenetic tree made with Geneious Prime:

Hope all you projects are going to be fruitful in this coming season.
Edited by Baba Yaga (08/02/22 05:27 PM)
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27886800 - 08/02/22 11:24 AM (1 year, 9 months ago) |
|
|
Hell yes! Congrats Baba!
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Adas]
#27887003 - 08/02/22 02:34 PM (1 year, 9 months ago) |
|
|
Gratis baba I am so glad for you and jealous at the same time!
-------------------- Willpower is the one true virtue
  
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|

I do have a couple of prints that I could share. If you still want one then privnote me your address. They are dense but small.
Will make germination plates from the new spores once I get off this damn computer.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 4
#27900008 - 08/12/22 04:04 AM (1 year, 9 months ago) |
|
|
Soooo, I'm just coming back from a 0.7gr dose and it was so much more than I bargained for. Took me by surprise cause I haven't had a proper trip in years.
Though I'll take it easy with a sub 1g dose and then boooooom....hit me like a truck while burning gum tree branches in the back yard.
Happy it did hit me the way it did though, have to get back into it more regularly to enjoy in depth. Got a bit scary for few minutes and I had to walk it off around the neighborhood.
Full moon!
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27900301 - 08/12/22 08:57 AM (1 year, 9 months ago) |
|
|
Nice man! How would you say are Semis different?
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: Adas] 3
#27900392 - 08/12/22 10:02 AM (1 year, 9 months ago) |
|
|
Awesome Baba, nothing better than those trips that take you further than expected. I had some pretty suspect grain spawn, and wasn’t wanting to do too much work with it so I just scattered it around the yard and the paddocks and pretty surprised at how it’s going.
 You can see the grains and wispy myc getting into the grasses around it. Must have been a month or so ago, through some pretty high temps. I think I’ll keep just spreading grain spawn around the yard, maybe spawn it thicker. Hopefully mice have cached a lot of the grain in their nests.
Edited by Land Trout (08/12/22 10:03 AM)
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Land Trout]
#27901027 - 08/12/22 04:44 PM (1 year, 9 months ago) |
|
|

The pheno I'd wish I'd managed
Sent pm baba maybe third time's the charm
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (08/12/22 04:46 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Adas]
#27901076 - 08/12/22 05:20 PM (1 year, 9 months ago) |
|
|
Yep no problem will send you a print. I have germinated some spores but there is also some mold on the plate which popped up first. Will try and see if I can clean this up but after that last mold disaster I should probably trash this plate and try with another print.
So be prepared that there might be some mold popping up.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 3
#27901082 - 08/12/22 05:26 PM (1 year, 9 months ago) |
|
|
Looking good land trout, quite a lot of myc there.
Quote:
Adas said: Nice man! How would you say are Semis different?
The visuals where less defined then what I get with woodlovers. When taking Subs I almost always starting to see a structure in open space and often things like fire seem to be made up by tiny cubes, kind of granular and lots of wall breathing and such. CEV with Subs are mostly line patterns that are moving as if they are part of a clockwork.
The Semis were fuzzy and colourful. OEV would only manifest when sitting down and looking at a scene for a while but would blurr out the field of vision all of a sudden as someone has flipped a switch, when this happened first I got a bit flustered and started moving around. It was like my vision got all fuzzy and colours would start bleeding out of the objects into the surrounding while some objects remained crystal clear. Not much breathing of objects. CEV were waving blankets of colourful organic patterns mostly that felt like were wrapping around me, quite beautiful.
I had a fair bit of auditory effects like guttural and female singing coming from far away and some water drop like sounds or echoed clicking noises. I usually get this though so its not a Semi thing for me.
The headspace was mostly clear with almost no body load. Surprising was that I didn't get the yawns at all, with Subs and Pans I yawn a lot. Quite energetic, they didn't tie me to the chair and moving around was easy, maybe too easy lol. I actually like it when the shrooms a weighing me down a bit, kind of helps me to chill out.
Well as I said I haven't tripped really in the last 3 years and got a bit flustered over the strength of the trip. I am sure I can let go and enjoy this more once I get back into practice. They are easily as strong as Pans.
The last time I took Semis was a good 30 years ago. In a brain fart moment my brother and I took our whole stash at once which was a lot and we went out wandering through the crop fields in the middle of the night while the stars where raining down on us and road signs were big lollypops even after 2 hours in we went past the turnoff to our street on our way back, like 5 times because we didn't see it lol. I took a long break after that one.
|
Rotnpins
🤮 Rotten-Pins 🍄



Registered: 01/11/22
Posts: 4,738
Loc: in (front of) the hood
Last seen: 1 year, 4 months
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27901100 - 08/12/22 05:41 PM (1 year, 9 months ago) |
|
|
Very cool thread.. don't know how I missed this one.
I was browsing through the thread and you guys are killing it with some of your grows 
Probably getting too late in the year to start a grow. By the time I am able to get my hands on some spores and get clean agar>spawn it will probably be getting cold outside.. but I definitely plan on joining in the fun next spring
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: Rotnpins]
#27901168 - 08/12/22 06:23 PM (1 year, 9 months ago) |
|
|
Baba, you ever get super horny from subs? Took some last weekend and the damn things got me all worked up during the come up. Could have just striped away my “self” and just got overwhelmed with how amazing my wife is and she just turned me on, but damn, never had that happen before.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Land Trout]
#27901187 - 08/12/22 06:39 PM (1 year, 9 months ago) |
|
|

nah, never on the night itself but the morning after seems to have me in a heightened state of arousal.
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: Land Trout]
#27901543 - 08/13/22 02:33 AM (1 year, 9 months ago) |
|
|
Quote:
Baba Yaga said: Looking good land trout, quite a lot of myc there.
Quote:
Adas said: Nice man! How would you say are Semis different?
The visuals where less defined then what I get with woodlovers. When taking Subs I almost always starting to see a structure in open space and often things like fire seem to be made up by tiny cubes, kind of granular and lots of wall breathing and such. CEV with Subs are mostly line patterns that are moving as if they are part of a clockwork.
The Semis were fuzzy and colourful. OEV would only manifest when sitting down and looking at a scene for a while but would blurr out the field of vision all of a sudden as someone has flipped a switch, when this happened first I got a bit flustered and started moving around. It was like my vision got all fuzzy and colours would start bleeding out of the objects into the surrounding while some objects remained crystal clear. Not much breathing of objects. CEV were waving blankets of colourful organic patterns mostly that felt like were wrapping around me, quite beautiful.
I had a fair bit of auditory effects like guttural and female singing coming from far away and some water drop like sounds or echoed clicking noises. I usually get this though so its not a Semi thing for me.
The headspace was mostly clear with almost no body load. Surprising was that I didn't get the yawns at all, with Subs and Pans I yawn a lot. Quite energetic, they didn't tie me to the chair and moving around was easy, maybe too easy lol. I actually like it when the shrooms a weighing me down a bit, kind of helps me to chill out.
Well as I said I haven't tripped really in the last 3 years and got a bit flustered over the strength of the trip. I am sure I can let go and enjoy this more once I get back into practice. They are easily as strong as Pans.
The last time I took Semis was a good 30 years ago. In a brain fart moment my brother and I took our whole stash at once which was a lot and we went out wandering through the crop fields in the middle of the night while the stars where raining down on us and road signs were big lollypops even after 2 hours in we went past the turnoff to our street on our way back, like 5 times because we didn't see it lol. I took a long break after that one.

Thanks for sharing! Sounds beautiful! I've heard female singing when I overdosed on weed edibles once. It felt ancient. Beautiful.
Quote:
Land Trout said: Baba, you ever get super horny from subs? Took some last weekend and the damn things got me all worked up during the come up. Could have just striped away my “self” and just got overwhelmed with how amazing my wife is and she just turned me on, but damn, never had that happen before.
I almost always get horny from Azzies. On the comeup there is always a short period where sexual energies activate a lot for some reason. After a minute or 2 everything is back to normal (unless you act on it I guess).
|
Land Trout
Stranger



Registered: 01/08/18
Posts: 3,159
Last seen: 14 days, 10 minutes
|
Re: The Official Semilanceata Thread [Re: Adas] 3
#27901717 - 08/13/22 08:11 AM (1 year, 9 months ago) |
|
|
Hahahah, oh we acted in it! But we’re also cut short cause our kid REALLY needed mommy more than I did.😭
|
myco.bay
Stranger
Registered: 09/05/21
Posts: 86
Last seen: 3 hours, 6 minutes
|
Re: The Official Semilanceata Thread [Re: Land Trout] 3
#27923189 - 08/28/22 09:11 PM (1 year, 8 months ago) |
|
|
Hi I germinated a plate a couple weeks ago and now have some growth. I wanted to get some feedback on how it is looking. It's been pretty slow growing and thin.


|
Rotnpins
🤮 Rotten-Pins 🍄



Registered: 01/11/22
Posts: 4,738
Loc: in (front of) the hood
Last seen: 1 year, 4 months
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27923201 - 08/28/22 09:23 PM (1 year, 8 months ago) |
|
|
If you spawn these during the spring time, is that early enough to get any fruits? Or do you have to start your beds the year prior by the fall?
Will the mycelium bed be able to survive a winter freeze, or are they better grown in warmer climates?
Edit: I also saw some pictures tweek posted about 3 months ago that looked like an indoor grow in some trays with potting soil and grass?
Can these be grown effectively indoors, or did I misinterpret the picture and the trays were actually from an outdoor grow?
Edited by Rotnpins (08/28/22 09:28 PM)
|
Awestruck
Nerding out



Registered: 05/04/09
Posts: 551
Loc: The U.S. of .... fuckin A
Last seen: 1 year, 2 months
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27923205 - 08/28/22 09:25 PM (1 year, 8 months ago) |
|
|
-------------------- Repaying my karmic debt to the Shroomery. Looking for a Pan cambo print.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: myco.bay]
#27923292 - 08/28/22 10:51 PM (1 year, 8 months ago) |
|
|
Quote:
myco.bay said: Hi I germinated a plate a couple weeks ago and now have some growth. I wanted to get some feedback on how it is looking. It's been pretty slow growing and thin.



This looks about right. Here a photo of a germination plate that I'm keeping as a backup and the other two photos are of first transfers from another germ plate.

Still very thin but the growth should get better after a few more transfers.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27923330 - 08/28/22 11:16 PM (1 year, 8 months ago) |
|
|
Quote:
Rotnpins said: If you spawn these during the spring time, is that early enough to get any fruits? Or do you have to start your beds the year prior by the fall?
Will the mycelium bed be able to survive a winter freeze, or are they better grown in warmer climates?
Edit: I also saw some pictures tweek posted about 3 months ago that looked like an indoor grow in some trays with potting soil and grass?
Can these be grown effectively indoors, or did I misinterpret the picture and the trays were actually from an outdoor grow?
Early spring is plenty of time. I spawned and planted late summer and it worked out well and didn't have to worry to keep them happy during peak heat. They grow all over Europe including Norway & Finland so yeah, freezes are no problem. Non of my bed or buried cakes were fruiting the following year and I don't know what it takes to establish them long term.
I think I know the photos you are talking about. Wasn't that of trays in a greenhouse? I don't recall seeing any followup posts with fruits though and can't remember when those were posted. Shouldn't be far away for the season in the northern hemisphere to really kick off. A few 2022 Season Thread are already going in the Hunting & ID Forum. So I hope we are going to see some success soon.
Indoors is not easy I think and I don't talk about having a tub in an unheated room in the middle of winter, that can work alright. Under indoors I understand an off season grow in an controlled fruiting environment but having said this, Holofractal over in the Official Woodlover Thread has some good results with stuntzii indoors and they are closely related to semilanceata. It might pay off to try his approach for Libs as well as it seems not that complicated. Worth a shot....I will stop growing pans for a while after this coming growing season to focus more on this species and papuana. Have to switch it up a bit every now and then to keep it interesting in the grow room.
Edited by Baba Yaga (08/28/22 11:27 PM)
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Rotnpins] 1
#27923350 - 08/28/22 11:38 PM (1 year, 8 months ago) |
|
|
Quote:
Rotnpins said: Edit: I also saw some pictures tweek posted about 3 months ago that looked like an indoor grow in some trays with potting soil and grass?
Can these be grown effectively indoors, or did I misinterpret the picture and the trays were actually from an outdoor grow?
Hi Rotnpins,
My trays with grass sit outdoors. Maybe I took the pic in the house but the trays are always outside
|
myco.bay
Stranger
Registered: 09/05/21
Posts: 86
Last seen: 3 hours, 6 minutes
|
Re: The Official Semilanceata Thread [Re: Tweeq]
#27923360 - 08/28/22 11:49 PM (1 year, 8 months ago) |
|
|
Thanks Baba, that's reassuring to know
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: myco.bay] 1
#27948950 - 09/13/22 11:09 PM (1 year, 7 months ago) |
|
|
I had a second germination plate sitting around for 3 weeks as backup and took some transfers from it. The mycelium grew out stronger than what I got from the other germination plate I used earlier, both were from the same print. Out of five transfers 4 grew out like in the first photo and the one in the second image is kind of more linear growing and more vigorous. Not sure if I should trust that one.
Edited by Baba Yaga (10/28/22 06:02 PM)
|
HappinessStan
Fungivore



Registered: 10/10/12
Posts: 1,762
Loc: Worcester, UK
Last seen: 4 days, 19 hours
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27949092 - 09/14/22 01:42 AM (1 year, 7 months ago) |
|
|
I'm so getting in on this. Gonna wait for the season to kick in and clone the biggest lib I can find. I live by a canal and have always dreamed of spreading them up and down the towpath. Great work, everybody!
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
|
I'm currently working out what to use as a substrate for my semi clone. I'm a newbie cultivator so would like some input...
- Semis like to grow in areas where there is animal manure (particularly sheep). Does it make sense to add composted cow manure to semi substrate? Will there be any nutrients that mushrooms can use, given that the cow-manure is composted?
- Planning to use a lot of sphagnum-rich soil in my substrate... I know its not very nutritional, but how is it contam wise?
- spawn/sub ratio? Given a substrate of manure-rich, sphagnum-rich soil?
- Sterilize? Pasteurize?
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: major_semi] 2
#27952933 - 09/16/22 02:43 PM (1 year, 7 months ago) |
|
|
Yes you can add manure, the cakes I buried were made of coir, H-manure, vermiculite and grain flour. I can't remember the exact ratios but it was mostly coir (at least half), then manure and vermiculite to adjust texture and field capacity. Avoid making it soggy at all so the mycelium has an easy time colonizing it, making it a bit on the drier side is better than too wet.
Why you say sphagnum do you mean the peat? I don't think it is very useful as the main bulk, it won't beat coir in terms of contam resistance. I'd go with coir as main ingredient and add to that but hey you can try out what you suggested and report back.
I used a ratio of 1:3 when spawning to straight compost from the garden center. Some say that spawning to straight coir does work as well.
If you spawn grain to substrate then pasteurize.
Since this is not an exact science and such there is lots of room for experimentation so knock yourself out and do some testing, you might find something good.
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27953031 - 09/16/22 03:36 PM (1 year, 7 months ago) |
|
|
Quote:
Baba Yaga said: Why you say sphagnum do you mean the peat? I don't think it is very useful as the main bulk, it won't beat coir in terms of contam resistance.
Hi, yes I think its the same thing... Forgot to mention this will be an indoor attempt...
The reasoning behind using soil rich in peat and manure in the substrate is that this would be close to the semis natural environment. So im hoping that will make them more willing to fruit... Might add some other stuff to the substrate as well (coir perhaps).
Edited by major_semi (09/16/22 03:38 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: major_semi]
#27953078 - 09/16/22 04:01 PM (1 year, 7 months ago) |
|
|
If you try indoors then I would keep the substrate as simple as possible. Coir or coir/manure. I'd say environment is more important than the sub recipe.
How are you planning on fruiting them? I assume that you are northern hemisphere which means that winter is coming and you could keep your tub(s) in an unheated room if that is a possibility. Don't you have a yard, porch or garage? Could do planters on your outside window sills.
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27953144 - 09/16/22 04:37 PM (1 year, 7 months ago) |
|
|
I would look into holofractals work with woodlovers inside too, perhaps there is a path forward where drying it out is key.
He shares some of it in the official woodlover thread.
Inside we don't really know how to induce fruiting
Outside Baba has proved is more "easy" or reliable
Edit: as Baba says don't complicate the substrate,
We don't have much proof towards psilocybes being so overly dependant on these special mixes, it adds contam vectors usually and so many species have proven they can adapt to lack of more complex nutrition, enough to fruit at least.
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (09/16/22 04:40 PM)
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27953271 - 09/16/22 05:45 PM (1 year, 7 months ago) |
|
|
Quote:
Baba Yaga said: How are you planning on fruiting them? .
Plan was a unheated room in the basement. Maybe set a termostat of 10-12c... Garage/porch is also an opportunity. But the semis here in my part of norway fruit wild in August. My grain spawn will not be ready before October... So would think porch/garage would be too cold for an outdoor / semi outdoor grow... (?) Could try anyway if I have enough spawn... Might try outdoor next year...
Quote:
smalltalk_canceled said: as Baba says don't complicate the substrate.
Yeah, good idea to keep it simple... Maybe just straight coir, and a casing layer of soil.. ?
Edited by major_semi (09/16/22 05:47 PM)
|
Rotnpins
🤮 Rotten-Pins 🍄



Registered: 01/11/22
Posts: 4,738
Loc: in (front of) the hood
Last seen: 1 year, 4 months
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27954542 - 09/17/22 12:40 PM (1 year, 7 months ago) |
|
|
Does anybody have a print of these that they'd be willing to share? I was going to ask in the marketplace, but I figured I'd have a better chance of finding a print here.
I've got a couple things I could possibly trade.
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Rotnpins] 2
#27954969 - 09/17/22 05:07 PM (1 year, 7 months ago) |
|
|
Quote:
Rotnpins said: Does anybody have a print of these that they'd be willing to share? I was going to ask in the marketplace, but I figured I'd have a better chance of finding a print here.
I've got a couple things I could possibly trade.
Pm
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Tweeq] 2
#27955571 - 09/18/22 04:01 AM (1 year, 7 months ago) |
|
|
I have plenty to give away
-------------------- Willpower is the one true virtue
  
|
Rotnpins
🤮 Rotten-Pins 🍄



Registered: 01/11/22
Posts: 4,738
Loc: in (front of) the hood
Last seen: 1 year, 4 months
|
|
Quote:
smalltalk_canceled said: I have plenty to give away
Thanks! Looks like I'm all set already 
I appreciate the quick replies
|
Benderr
Stranger

Registered: 06/05/22
Posts: 96
Last seen: 1 year, 2 months
|
Re: The Official Semilanceata Thread [Re: Rotnpins]
#27959848 - 09/20/22 10:02 PM (1 year, 7 months ago) |
|
|
Dont mind me
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: Benderr]
#27970448 - 09/27/22 10:21 AM (1 year, 7 months ago) |
|
|
For indoor attempt I was thinking about alternating between the fridge at night and room temp at day to try and induce fruiting... Anyone tried this?
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: major_semi] 4
#27970791 - 09/27/22 02:50 PM (1 year, 7 months ago) |
|
|
I tried it with a couple of cakes once and it didn't work out except from a few knots. Not sure what was missing to get it to fruit. Just give it a go, might be working. If I would do this again I would keep a container in the fridge for a couple of weeks or something similar to what holofractal does over in the woodlover thread. He got a write up in his journal.
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27970819 - 09/27/22 03:09 PM (1 year, 7 months ago) |
|
|
Yeah, I've been following Holo and his indoor work and I agree that this is most likely also going to work with Semilanceata.
|
Guerrilla
Bumbaclart


Registered: 01/30/21
Posts: 3,171
Loc: United Kingdom
|
Re: The Official Semilanceata Thread [Re: Tweeq] 1
#27970823 - 09/27/22 03:11 PM (1 year, 7 months ago) |
|
|
Seems like success is within arm's reach.
Staying tuned.
Liberty caps are our native active species here in the UK.
-------------------- Being pissed on does not make you a real man.
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27970851 - 09/27/22 03:25 PM (1 year, 7 months ago) |
|
|
Ok, my idea was more about having a very low "nightly" temperature, i.e. continued cold shocks.
So might be better to instead focus on having a moderately low temp(12c ish?) + very very high humidity at the surface...?
Edited by major_semi (09/27/22 03:25 PM)
|
Rotnpins
🤮 Rotten-Pins 🍄



Registered: 01/11/22
Posts: 4,738
Loc: in (front of) the hood
Last seen: 1 year, 4 months
|
Re: The Official Semilanceata Thread [Re: Tweeq]
#27970943 - 09/27/22 04:11 PM (1 year, 7 months ago) |
|
|
Quote:
Tweeq said: Yeah, I've been following Holo and his indoor work and I agree that this is most likely also going to work with Semilanceata.
I'll probably give it a try when my spores get here I was actually curious if it was possible to grow these indoors.. was going to get some cultures ready in cold storage to spawn in the spring time, might as well give it a try indoors while I'm waiting.
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Rotnpins] 2
#27971003 - 09/27/22 04:44 PM (1 year, 7 months ago) |
|
|
with more people joining using verified ideas like simple substrates, building on what we already know, trying to adapt what holo has found with woodlovers, im sure more people will succeed in 2022/2023 and this species too will be manhandled into workable fruiting
Got fimes fruiting in in my garden fruiting now, out of a functioning high-res camera so no pics
only 1-2-3 fruits but the mycelium has thus survived since may
Managed to snap one
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (09/28/22 04:43 AM)
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
|
Nice pics, smalltalk
Wondering about How to achieve enough surface humidity for indoor grow. Casing layer is one thing… But don’t think that is enough..
Thinking either : - Reptile fogger - having something at the surface), that retains humidity, but is weak/sparse enough that the semis can grow through. Like balls of polyfil or plastic grass/leaves or something…
Ideas?
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: major_semi]
#27974996 - 09/30/22 06:26 AM (1 year, 7 months ago) |
|
|
What do you think about this picture, gang?

To me its a pretty weak annulus semi pheno
and a bit fimetaria like?
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (09/30/22 06:59 AM)
|
Guerrilla
Bumbaclart


Registered: 01/30/21
Posts: 3,171
Loc: United Kingdom
|
|
I think it needs rotating
Otherwise, sexy
-------------------- Being pissed on does not make you a real man.
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: Guerrilla]
#27975025 - 09/30/22 07:00 AM (1 year, 7 months ago) |
|
|
hunting or cultivation?
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27975033 - 09/30/22 07:11 AM (1 year, 7 months ago) |
|
|
im keeping an eye on the seasonal ID threads looking for semis that look like Fimes, i thought this one was a bit like so, but based on your answers i guess they look 99% semi to you
-------------------- Willpower is the one true virtue
  
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
Who's photo is this? If you post a photo in here then I automatically assume you post a photo of lib caps. Looks like them to me though.
Edited by Baba Yaga (09/30/22 07:50 AM)
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27975055 - 09/30/22 07:50 AM (1 year, 7 months ago) |
|
|
norway semi ID threads. ill keep these posts for PMs in the future
-------------------- Willpower is the one true virtue
  
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
All good, did you get my print?
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27975071 - 09/30/22 08:01 AM (1 year, 7 months ago) |
|
|
Yessir, ill germ it tonight. Currently rocking some verified norwegian semilanceata cultures hopefully they will produce a pin in the unheated garage this winter.
also realizing this year just how slow semis are compared to fimetaria, that shoulld have informed me in the last attempt.
-------------------- Willpower is the one true virtue
  
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
cool, glad to hear it got to you. I hope it's not one of the mold laden prints, chances are 50/50. Looking forward to see those norse sems in action.
I am working on two different culture lines from one print at the moment where one is slow and the other quite fast. Still not sure if I can trust the speedy one but don't want to throw it out either just in case I have hit gold. Will have to see this through to the end I guess. Going to LC broth soon.
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27975400 - 09/30/22 02:02 PM (1 year, 7 months ago) |
|
|
Looks like libs to me too
|
CreonAntigone
Stranger

Registered: 05/30/21
Posts: 2,972
|
Re: The Official Semilanceata Thread [Re: Tweeq] 1
#27977033 - 10/01/22 05:41 PM (1 year, 7 months ago) |
|
|
Trying a grow this year based on the principle that they are grass parasites, infecting a lawn grass and two species of sedge grass with the spores in-vitro in the hopes to produce plants parasitized by the mushroom.
I have also two plates growing of it, as well.
For those who have noticed myc growth but had no success, you might try a higher spawn ratio. I noticed workman was able to get some fruits of these during the summer, and he observed that the mushrooms were popping up because there was so much mycelium.
|
shobimono
Why?

Registered: 09/14/04
Posts: 561
|
|
A friend of mine got her hands on a couple dried fruits that were picked last year. How long do spores last from these? Is it worth trying to do anything with the caps or are the spores all going to be dead?
|
Guerrilla
Bumbaclart


Registered: 01/30/21
Posts: 3,171
Loc: United Kingdom
|
Re: The Official Semilanceata Thread [Re: shobimono] 1
#27978997 - 10/03/22 04:51 AM (1 year, 7 months ago) |
|
|
Spore is out of the question at this stage. You capture spores when the mushroom is still fresh and at the point in its reproductive cycle where it is actively dropping spores.
Some people have had luck with dried tissue to agar but it's a long shot.
-------------------- Being pissed on does not make you a real man.
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: Guerrilla]
#27980879 - 10/04/22 09:07 AM (1 year, 7 months ago) |
|
|
Spawning today… have some options regarding container.. What would you say is minimum sub thickness for semis?
Gonna use some pf-jars or food containers, and dig them down in a perlite-filled storage container. Use humidifier for fae.
Edited by major_semi (10/04/22 09:18 AM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: major_semi] 1
#27980910 - 10/04/22 09:38 AM (1 year, 7 months ago) |
|
|
I keep the subs for everything I grow between 2 and 3 inch.
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: shobimono]
#27980916 - 10/04/22 09:42 AM (1 year, 7 months ago) |
|
|
Quote:
Is it worth trying to do anything with the caps or are the spores all going to be dead?
If u have no other options I would try tearing the cap in two after wiping outside with alcohol soaked paper. Then scraping the gills with a scalpel over agar …
Edited by major_semi (10/04/22 09:43 AM)
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: shobimono]
#27980920 - 10/04/22 09:46 AM (1 year, 7 months ago) |
|
|
Quote:
shobimono said: A friend of mine got her hands on a couple dried fruits that were picked last year. How long do spores last from these? Is it worth trying to do anything with the caps or are the spores all going to be dead?
Ill get you a print if needed
-------------------- Willpower is the one true virtue
  
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
|
Two of my cakes 2 days into colonization  Substrates CVG(A) and enriched soil(C). Soon comes the hard part...
Edited by major_semi (10/07/22 02:54 AM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: major_semi]
#27985791 - 10/07/22 03:39 AM (1 year, 7 months ago) |
|
|
Looking good 
What is the hard part?
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27985793 - 10/07/22 03:42 AM (1 year, 7 months ago) |
|
|
Fruiting
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: major_semi]
#27985798 - 10/07/22 03:48 AM (1 year, 7 months ago) |
|
|
what season are you in atm?
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: Baba Yaga]
#27986217 - 10/07/22 10:51 AM (1 year, 7 months ago) |
|
|
Autumn. End of semi season… too late to try and fruit outside u think? Found the specimen in start of august… growing really fast after the agar stage….
|
Adas
Lonely Dreamer



Registered: 12/22/16
Posts: 5,307
Loc: Central EU
Last seen: 6 hours, 43 minutes
|
Re: The Official Semilanceata Thread [Re: major_semi] 1
#27986340 - 10/07/22 12:19 PM (1 year, 7 months ago) |
|
|
Growing really fast is a bad sign with Libs.
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: Adas]
#27986377 - 10/07/22 12:53 PM (1 year, 7 months ago) |
|
|
Less likely to fruit bad or might not even be semis bad?  Hope my cloning technique is not that bad , lol
|
Screwup
Googles your dumb questions


Registered: 01/27/22
Posts: 6,340
Last seen: 2 months, 12 days
|
Re: The Official Semilanceata Thread [Re: major_semi]
#27986379 - 10/07/22 12:54 PM (1 year, 7 months ago) |
|
|
Why is that growth so sporadic like you shook it? Have you shaken it?
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: Screwup]
#27986395 - 10/07/22 01:10 PM (1 year, 7 months ago) |
|
|
It's grain spawn and substrate mixed... Made several "cakes" like this.
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: major_semi] 1
#27986403 - 10/07/22 01:14 PM (1 year, 7 months ago) |
|
|
whats the merit of cloning a wild semi vs using multispore? isnt the latter a broader range of genetics more likely to contain whatever possible genetics that could be easier to use
-------------------- Willpower is the one true virtue
  
|
major_semi
Stranger

Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
|
Sounds reasonable to me...
No specific reasoning behind the cloning. Seemed like the thing to do. Started the cloning process before I started reading up on this thread...
Edited by major_semi (10/07/22 01:44 PM)
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,906
Last seen: 7 hours, 47 minutes
|
Re: The Official Semilanceata Thread [Re: major_semi] 1
#27995311 - 10/12/22 01:53 PM (1 year, 7 months ago) |
|
|
germinated the latest print from baba yaga today, 6 different plates. will be sharing the plates here so we have more pictures of the mycelium as it goes from t0 to organized growth from latter transfers
guess it will have to go in the garage dec-january-> since the timing so off season wise
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (10/12/22 01:54 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
|
Good Idea, we can put some more info like this in the OP. Please try to get really good pictures and once you have a sequence I can ad it to the OP. I have a few nice cultures on the way and it took 2 transfers to have it growing out denser and on top of the agar, before that it kinda grew more within the medium.
Will be dropping them to grain soon. Trying to do an indoor grow ala holofractal with just coir and coir/compost. Will also be a good test run to see if there is something riding along before going big outdoors.
Nothing has hatched yet in the beds and pots of the northern faction?
|
Tweeq
Tweeq of Nature


Registered: 06/07/18
Posts: 2,062
Loc: Netherlands
Last seen: 22 hours, 57 minutes
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 2
#27995516 - 10/12/22 03:40 PM (1 year, 7 months ago) |
|
|
My two trays don't show any signs. I did bury some colonized grains under grass outside too but that was probably too dry, for too long (if that myc was even good to begin with).
We're going on a semi hunt coming sunday though so at least there's that. Hopefully get some new prints and/or clone(s) to work with for my next try.
|
major_semi
Stranger


Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: Tweeq]
#27998849 - 10/14/22 02:57 PM (1 year, 7 months ago) |
|
|
Regarding casing layer...
The potting soil I have access to contains some nutrition(Chicken manure) in addition to peat moss . Can I still use this?
Alternatively, I have some pure peat moss. Do I need to ph-buffer it to use it?
Edited by major_semi (10/14/22 02:58 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: major_semi] 1
#27998901 - 10/14/22 03:22 PM (1 year, 7 months ago) |
|
|
For out doors I would try either but indoors I would go for pure peat and pH balanced if it was the only two options cause it can take a long time before something is going to happen. This is just me liking to try a few things but maybe try one with coir as well, or verm. Will be joining you in a few weeks with experimenting. LCs are slowly getting there.
|
major_semi
Stranger


Registered: 09/16/22
Posts: 62
Last seen: 5 months, 15 days
|
Re: The Official Semilanceata Thread [Re: Baba Yaga] 1
#27998918 - 10/14/22 03:35 PM (1 year, 7 months ago) |
|
|
Would be a great step to get fruits with verm or coir casing… I’m afraid not using peat moss. have some idea they need the microorganisms/acidity or something,lol. Would be good to bust that potential myth.
Most successful indoor grow (captainfuture) used coir/soil.
Grew my substrate in pf-jars, 8 of them. so I have some options for experimenting with casing. also considering birthing some of them and use verm or a verm/peat combo…
Edited by major_semi (10/14/22 03:37 PM)
|
Baba Yaga
Psychedelic Minion

Registered: 09/13/20
Posts: 4,241
Loc: On Break Vacation
|
Re: The Official Semilanceata Thread [Re: major_semi] 2
#27998940 - 10/14/22 03:49 PM (1 year, 7 months ago) |
|
|
It sure will take "a few" attempts to figure this out.
|
Benderr
Stranger

Registered: 06/05/22
Posts: 96
Last seen: 1 year, 2 months
|
|
Quote:
smalltalk_canceled said:
Quote:
shobimono said: A friend of mine got her hands on a couple dried fruits that were picked last year. How long do spores last from these? Is it worth trying to do anything with the caps or are the spores all going to be dead?
Ill get you a print if needed
Can I whore in on that? I promise to post about it.
|
|