Home | Community | Message Board

MRCA Tyroler Gluckspilze
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: MagicBag.co All-In-One Bags That Don't Suck   Mushroom-Hut Mono Tub Substrate   Left Coast Kratom Buy Kratom Extract   PhytoExtractum Buy Bali Kratom Powder   North Spore Bulk Substrate   Original Sensible Seeds Bulk Cannabis Seeds   Myyco.com Isolated Cubensis Liquid Culture For Sale   Kraken Kratom Red Vein Kratom

Jump to first unread post Pages: < Back | 1 | 2 | 3 | Next >  [ show all ]
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 57
Last seen: 1 day, 9 hours
Re: The official 2021 Fimetaria thread [Re: Liberte]
    #27541341 - 11/13/21 05:20 AM (2 years, 4 months ago)

Breaking news!!!!!!

Some dung I picked off my Fimetaria find was put in a small ceramic plant container and left outside. Now 2 weeks later it has started to fruit :laugh:. The fruits are super tiny but maybe will grow some in the next days.
I Will keep u guys posted!








Cheerful greetz,
Semi,

Edited by semilancreator (11/13/21 05:21 AM)

Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 2 days, 12 hours
Re: The official 2021 Fimetaria thread [Re: semilancreator]
    #27542888 - 11/14/21 10:42 AM (2 years, 4 months ago)

Great work Semi :smile: looking forward to seeing a post about a successful cultivation of Fimetaria!


--------------------
Have a look at the subreddit r/fimetaria!

Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 2 days, 12 hours
Re: The official 2021 Fimetaria thread [Re: RenegadeMycologist]
    #27543002 - 11/14/21 12:20 PM (2 years, 4 months ago)

Quote:

RenegadeMycologist said:

I have eaten both, and they failed to induce psychedelic experience, hence they are Deconica.







Hi Renegade, I really believe that this is not evidence of those two mushrooms either not being Fims or being a Deconica.


My thoughts on the potency of P.fimetaria in Europe


Most Fims here in Europe seem to be weaker on average than libs, some quite considerably. Through speaking to people who have picked and consumed them, I have found that the potency seems to vary a lot. One person had only 5 small Fims - from cow dung - and felt very strong effects from them (he said he had to stop driving as he couldn't see lol). However, others have reported weak or no effect. With some of these, I have seen pictures of the exact ones and they look just like normal European Fims to me. Somebody from the Netherlands told me that they had consumed a certain amount of Fims - from horse dung - one year, with little to no effect. However, a year later they consumed a similar amount from the same location and had a strong trip, apparently similar to P.semilanceata. I do understand that this is not a rigorous scientific method and is largely anecdotal evidence. However, I believe it does carry some weight - and it's a start.

Therefore my theory is that the potency varies a lot with Fimetaria. I imagine it is do with the substrate which they grow from. One thing that supports this is that Semi reports blueing on 40-50% of his specimens, which grow from horse manure. On the other hand, the majority of Fimetaria reported in the subreddit r/fimetaria have grown from cow dung, and the majority of the specimens have not shown signs of bluing. I would have thought this shows a difference in psilocin production if nothing else, considering we can see that most (but not all) of the ones which are psychoactive in the UK have not show bluing. It is worth noting that Watling (1967) noted Fimetaria's blueing reaction but stated it can be variable. I don't believe he went into detail about what he thought affected it, however.

I have recently been wondering if the freshness of the manure has some effect on potency...but there are many other potential variables. One might be the type of grass ingested by the animal (ie what is the substrate composed of). Another could be atmospheric/environmental effects like the temperature, altitude and/or moisture content (I think this is less likely to be a factor). This definitely would be an interesting area to study.

One thing that really interests me is the idea that there are multiple varieties of Fimetaria. I believe the ones documented by Stamets in America are either a different species altogether or, more likely, a different variety to what we have in Europe. Take P.liniformans, for example. Macroscopically, it is fairly similar to P.fimetaria in Europe. There is a P.liniformans var. liniformans (recorded in NL) and P.liniformans var. americana. The European variety has a separable gill edge, the American does not. The P.fimetaria documented by Stamets in America has an annulus, whereas P.fimetaria in Europe has a ring zone, although sometimes quite faint.

I wonder, is it possible that it is the same for Fimetaria? Could there be a P.fimetaria var. americana or var. fimetaria etc? I am not sure on what the correct names would be! I'm sure it is entirely possible, however, that the species is genetically the same either side of the Atlantic. I think it is unlikely. 

Apparently there are gene sequences of ITS, LSU and tef1 of P.fimetaria in public databases. Hopefully some of these are from American samples. I am going to send some samples off for ITS sequencing, and all going well LSU and tef1 as well. I will update when I know the results. Hopefully it will bring some clarity to the mysterious P.fimetaria! :cool::confused::thumbup:


--------------------
Have a look at the subreddit r/fimetaria!

Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,818
Loc: Serbia Flag
Last seen: 15 hours, 39 minutes
Trusted Identifier
Re: The official 2021 Fimetaria thread [Re: DH42]
    #27561885 - 11/29/21 11:46 AM (2 years, 3 months ago)

Quote:

DH42 said:
Hi Renegade, I really believe that this is not evidence of those two mushrooms either not being Fims or being a Deconica.



I have eaten descent amount that day, and taking into account my personal sensitivity with serotonergic drugs, I would have felt effects, but nothing. However I might have collected both fimetaria and Deconica, so the Deconicas diluted the magic cocktail. Not sure what happened on that strange day, but investigation is under way.

Quote:

DH42 said:
...
I would have thought this shows a difference in psilocin production if nothing else, considering we can see that most (but not all) of the ones which are psychoactive in the UK have not show bluing.



Not psilocin nor psilocybin content is correlated to the amount od bruising. Some potent mushrooms don't bruise, and some weak in potency bruise strongly. Also some bruise significantly faster than others, even when they have same tryptamine content. It was a mystery for a long time but it was resolved two years ago, it's the enzyme activity responsible for the bruising effect and there are different routes of polymerization for resulting blue pigment.
I have often written on shroomery about it, you can see full scientific article here:
https://doi.org/10.1002/anie.201910175


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:

Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,818
Loc: Serbia Flag
Last seen: 15 hours, 39 minutes
Trusted Identifier
Re: The official 2021 Fimetaria thread [Re: RenegadeMycologist]
    #27561906 - 11/29/21 12:10 PM (2 years, 3 months ago)

Semilancreator's collection 2021

Spores subellipsoid or ellipsoid both in face and side view, thick-walled, yellowish brown in KOH, with a broad germ pore.

(11.3) 12.4 - 13.7 (14.3) × (6.7) 7.1 - 7.8 (8.6) µm
Q = (1.5) 1.6 - 1.8 (2) ; N = 70
Me = 13 × 7.4 µm ; Qe = 1.7

1000x oil imersion, 5% KOH


Notes: further microscopic study will be conducted soon.

Semilancreator's collection 2020

Not studied microscopically, but we have an ITS sequence:

AACCGGGAACCAACCTGANTTTGAAGGTCAAATTGTCATTTGTGTTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAGACGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCATATGATACATTCTGTTACATACTTTGGGGTATATGAAAACGTAGGCCTGGGCTTAATTGCAAGGAGAGCTCGTGAAAGCAATCCTCCCGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAGGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCTCGAGAGGACCAGCTGCAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAATTGACCAAGAAA

Notes: Sequence matches very well with other Psilocybe fimetaria accessions in the GenBank (score over 99.5%). This sequence was already published on the shroomery in another thread, but it fits in this thread better.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:

Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 57
Last seen: 1 day, 9 hours
Re: The official 2021 Fimetaria thread [Re: RenegadeMycologist] * 1
    #27562555 - 11/30/21 12:37 AM (2 years, 3 months ago)

Thanks Dusan!

Last weekend I had the chance to go hunting with Alan Rockefeller who happened to be over in the Netherlands for a week.
We went to a dunearea (different one from my fimetaria spot) with reported finds of both fimetaria and liniformans.
Not to long after we arrived we found two clusters of what we expect is Psilocybe liniformans. I was not the first to find a specimen but I did find the biggest one which has been printed. Both Alan and another mycologist had their high Def cameras with them and shot beautiful pictures of my find.
Picture by Jip Leermakers


Pictures by Alan Rockefeller

Alan is going to sequence some specimen and I will send off a big cap as well for sequencing. We did not have a pin with us so we couldnt do the gill test for liniformans (did it with a tiny spyglass)* however if these come out as liniformans it means that next year we will do two kinds of dunglovers.
Before some of you start to ask BTW..... I only have two decent prints of the species atm so I will not trade these. If I get fruits this year we might be able to change that.

That's all for now,
Semi

Edited by semilancreator (11/30/21 12:41 AM)

Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,818
Loc: Serbia Flag
Last seen: 15 hours, 39 minutes
Trusted Identifier
Re: The official 2021 Fimetaria thread [Re: semilancreator]
    #27562645 - 11/30/21 04:11 AM (2 years, 3 months ago)

Great ! Looking forward on seeing what those will sequence to, and how far their sequence is from fimetaria (if they're really P.liniformans).

It would be great you checked for gill edge, so the community has a sequence of a specimen with that feature, which in my eyes best represents liniformans.

I will conduct further microscopy on fimetaria, for now I only had time to do the spores I posted previously.

In any case I'm glad to see both of these species being investigated.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:

Extras: Filter Print Post Top
OfflineAnglerfishM
hearing things
Male User Gallery


Registered: 09/08/10
Posts: 18,741
Loc: Norvegr Flag
Last seen: 9 hours, 4 minutes
Trusted Identifier
Re: The official 2021 Fimetaria thread [Re: semilancreator]
    #27562671 - 11/30/21 05:32 AM (2 years, 3 months ago)

Quote:

semilancreator said:
We did not have a pin with us




"One does not simply go liniformans hunting without a needle".

Seriously though, very cool find and lucky you to go hunting with Alan! :bow2:


--------------------



Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,818
Loc: Serbia Flag
Last seen: 15 hours, 39 minutes
Trusted Identifier
Re: The official 2021 Fimetaria thread [Re: Anglerfish]
    #27562679 - 11/30/21 05:48 AM (2 years, 3 months ago)

Quote:

Anglerfish said:
"One does not simply go liniformans hunting without a needle".



:ilold:

My thoughts exactly, was even thinking about making a joke: what a bunch of n00bz in the field that day - hunting linies without a needle, but I refrained :dumblol:


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:

Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 2 days, 12 hours
Re: The official 2021 Fimetaria thread [Re: RenegadeMycologist]
    #27563045 - 11/30/21 11:52 AM (2 years, 3 months ago)

Quote:

Anglerfish said:

"One does not simply go liniformans hunting without a needle".

:laugh::laugh:


Semi - those are great pics of the Liniformans..I wish we could get some high-def pics of Fimetaria as well! It is remarkable/scary how similar those Liniformans look to some of the Fimetaria I've found. I wonder have Liniformans been found in the UK...? I haven't heard of any reports. Glad they're being researched/sequenced.

Dusan - That's amazing work you've done with the microscopy of the fims! Looking forward to seeing what you find with other spores. And thanks for the info on bluing - I didn't know how indirectly it correlated to potency. I would love to be able to establish why Semi's fims down in NL blue so much more than many of the ones found in the UK.


And Semi, how did You/Alan/the rest of your party establish those mushrooms were definitely Liniformans without being able to test for the sperable gill edge? We all know how similar they can look to some Fims. Maybe Fim caps tend to be a bit more flat / lightly umbonate compared to Liniformans being more convex/bell shaped? Or do Liniformans flatten out with age as well? Interested to hear anybody's thoughts on this...


--------------------
Have a look at the subreddit r/fimetaria!

Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 57
Last seen: 1 day, 9 hours
Re: The official 2021 Fimetaria thread [Re: DH42]
    #27564105 - 12/01/21 03:25 AM (2 years, 3 months ago)

Hey guys

Thanks for all the reactions. To be short: we looked at the gills with a pocket microscope. The reason we had doubts is because the gilledge seems to lack in the bigger specimen in the picturw OR at least is very small. Here is another picture showing a different specimen with a clearly visible lining of the gills:

Picture by Jip Leermakers.
As one can see this one has a clearer line than the other. However IT could be that because the other specimen was so big and mature that the layer was thinner. Wonder what you guys think based on the photos.
Also the macroscopic differences between fimetaria and liniformans seem very small. I do think that Liniformans flattens out more with age as well as that she is not as umbonate as the fimetaria. However I think I need to study Them side by side a lot more to get a clear picture of the situation.
All in all I am super Stoked for the coming months to experiment a bit with the Spores :laugh:

Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,818
Loc: Serbia Flag
Last seen: 15 hours, 39 minutes
Trusted Identifier
Re: The official 2021 Fimetaria thread [Re: semilancreator]
    #27564193 - 12/01/21 06:03 AM (2 years, 3 months ago)

I think they are literally identical, or at least overlap in features so often that differentiation on the basis of general morphology is not reliable.

They have the same macro/micro features, habitat/season, and the only distinguishing characteristic is the gill cheilocystidia arrangement and structure - which translates macroscopically in both gelatinous and separable gill edge layer. Personally I wouldn't make bet on liniformans if it lacks the separable gill edge...
Supposedly liniformans var. americana lacks it, so that one might actually be redesribed fimetaria. I don't know if the var. americana type was studied, perhaps Alan chimes in.

ITS + LSU sequence would be interesting in this collection, but also in specimens with forementioned separable gill edge feature.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:

Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 2 days, 12 hours
Re: The official 2021 Fimetaria thread [Re: RenegadeMycologist]
    #27590812 - 12/22/21 03:06 PM (2 years, 3 months ago)

I am happy to have just learnt that the supposed fimetaria I have been observing have had their sequencing results come back: 100% match for Psilocybe fimetaria (ITS). For reference, the exact sample used is the bottom mushroom in the pictures below. The data will be uploaded to Genbank once I figure out how to do it, or someone more advanced in this area does it for me!





--------------------
Have a look at the subreddit r/fimetaria!

Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 2 days, 12 hours
Re: The official 2021 Fimetaria thread [Re: DH42]
    #27602264 - 01/01/22 10:35 AM (2 years, 2 months ago)

The sequence of the aforementioned sample - kindly extracted by RenegadeMycologist

TTCTCTAGATNACACTCGGACGGCCAAAGACCGCCAGATTTTAAATTTGAGCTTTTCCCGC
TTCACTCGCAGTTACTAGGGGAATCCTTGTTAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAG
CGGGTAGTCCTACCTGATTTGAGGTCAAATTGTCATTTGTGTTGTCCAGTGAAGGACGGTTAGAAGCAGC
GCAATCCCATTCATGCAGACGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCA
CCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATT
ATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGA
GCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCT
GCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGC
CATATGATACATTCTGTTACATACTTTGGGGTATATGAAAACGTAGGCCTGGGCTTAATTGCAAGGAGAG
CTCGTGAAAGCAATCCTCCCGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAGGGTGCAC
AGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCTCGAGAGGACCAGCTGCAACCGAGCCAAGTTC
ATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGGA
CCAAGAAA


--------------------
Have a look at the subreddit r/fimetaria!

Edited by DH42 (01/01/22 03:17 PM)

Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,818
Loc: Serbia Flag
Last seen: 15 hours, 39 minutes
Trusted Identifier
Re: The official 2021 Fimetaria thread [Re: DH42]
    #27603287 - 01/02/22 05:55 AM (2 years, 2 months ago)

Absolutely great work DH42 and semilancreator on fimetaria !

I created phylogenetic tree with your sequences including closely matching accessions from the GenBank, but I also added one liniformans sequence from the shroomery which Alan posted recently. Cladogram is generated using maximum likelihood algorithm with 1000 bootstrap replications. For substitution model I used Kimura 2-parameter model.



Now this tree might not be correct, or even completely fucked up at worst, and bootstrap values on some branches are low, but doing it over and over again it always seems more or less the same. Hopefully Alan chimes in with some insight.

What is interesting is that the tree is clearly showing 2 liniformans sequences as separate from DH42's and semilancreator's sequence, but on the other hand grouped with 3 other fimetarias. For one of them (MK141011) I highly assume it's P.pelliculosa. MN901955 submitted by Jan Borovička I don't know what it is, might be mislabeled liniformans. I also haven't seen morphology of MW714570 from France but since Alan submitted it into the GenBank as fimetaria, I suspect he examined the collection.

So I'm not really sure how to interpret the data other than there might be some mislabeled accessions of liniformans in the GenBank OR liniformans and fimetaria sometimes have really similar ITS sequence OR I'm doing something wrong in the process of tree construction.
Perhaps protein coding gene should be used to compare those ambiguous sequences. DH42 is in the process of acquiring tef1 so we will see.

DH42's collection from Scotland and semilancreator's collection from Netherlands are always on 100% bootstrap value no matter what sequences I use for the tree or whatever input parameters I provide.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:

Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,818
Loc: Serbia Flag
Last seen: 15 hours, 39 minutes
Trusted Identifier
Re: The official 2021 Fimetaria thread *DELETED* [Re: RenegadeMycologist]
    #27603291 - 01/02/22 06:11 AM (2 years, 2 months ago)

-


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:

Edited by RenegadeMycologist (01/04/22 07:57 AM)

Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,818
Loc: Serbia Flag
Last seen: 15 hours, 39 minutes
Trusted Identifier
Re: The official 2021 Fimetaria thread [Re: RenegadeMycologist]
    #27605306 - 01/03/22 02:53 PM (2 years, 2 months ago)

Ok so I have ro-rooted my tree and decided to select Psilocybe medullosa as an outgroup. This time tree is generated with PhyML with Gblock eliminating poorly aligned positions. It looks like this:


And this is the same tree as before just with Psilocybe medullosa as an outgroup:


I'm yet to figure out why the divergence line for semilancreator's and dh42's fimetaria is so long and should I trim those other sequences to ITS only - perhaps that's why I'm getting somewhat distorted phylogeny.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:

Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,818
Loc: Serbia Flag
Last seen: 15 hours, 39 minutes
Trusted Identifier
Re: The official 2021 Fimetaria thread [Re: RenegadeMycologist]
    #27605612 - 01/03/22 05:17 PM (2 years, 2 months ago)

I have resolved it by reversely complementing sequences from Netherlands and Scotland and deleting some problematic sequences after inspection of the sequence alignment.

Tree generated with PhyML:


Earlier tree corrected (same parameters: 1000 bootstrap replications, maximum likelihood algorithm, kimura 2 substitution model):
*Insert photo here

So the tree is clearly showing Psilocybe liniformans as separate species to Psilocybe fimetaria. Support values are high on all branches.

Both sequenced collections from this thread are colorized in blue.

MK141011.2 in my opinion is most likely Psilocybe pelliculosa.

Edited by RenegadeMycologist (01/16/22 04:53 PM)

Extras: Filter Print Post Top
InvisibleNitro87
Living the Dream
Male User Gallery


Registered: 07/08/20
Posts: 1,991
Loc: The Clouds
Trusted Identifier
Re: The official 2021 Fimetaria thread [Re: RenegadeMycologist]
    #27605786 - 01/03/22 06:52 PM (2 years, 2 months ago)

Awesome work! :snoop:


--------------------
Life is worth living


Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,818
Loc: Serbia Flag
Last seen: 15 hours, 39 minutes
Trusted Identifier
Re: The official 2021 Fimetaria thread [Re: Nitro87]
    #27607578 - 01/05/22 04:59 AM (2 years, 2 months ago)

Please, this is all preliminary interpretation of mine, something might change while we're learning new things about this species or when I develop another method for analysis. My tree and interpretation most certainly require peer review, so the interpretation is mostly "in development". I could be wrong.

Regarding the phylogenetic tree and in evolutionary perspective what it means is a follows:

1. Psilocybe semilanceata might have evolved from Psilocybe fimetaria. (?) Incorrect, they are somewhat related and share the common ancestor.

2. Liniformans did not lose the separable gill edge from whatever evolutionary pressure and transformed into the other species which is fimetaria. Nor did fimetaria transformed into liniformans.
Tree shows that both fimetaria and liniformans have a recent common ancestor, but neither one evolved from each other i.e. evolution went in two different directions regarding these two species.

3. Tree also shows unbased pelliculosa positions which means decoding pelliculosa phylogenetic placement will require protein gene sequencing (tub2, tef1, rpb2) since its ITS region sequence overlaps with fimetaria, even though they are obviously different species. Furthermore, protein gene sequencing will sometimes be nessesary for pelliculosa determination to prevent ITS collision with fimetaria.

4. When it comes to fimetaria, it exibits stable genetics, which means its dna did not diverge to geo-types, like fimetaria sensu Scotland VS fimetaria sensu Netherlands or fimetaria sensu France. Sometimes species when separated geographically develop dna mutations in their its region over time, however fimetaria did not. That means there is no Psilocybe fimetaria group (for now), because all sequenced collections basically match. Hopefully we get some North American material in the GenBank so I can add it to my tree.

PLEASE if anyone has a comment or a correction or really anything to add, I would like some peer review and opinions on this matter. Thanks.

Final version of the tree:

Edited by RenegadeMycologist (01/16/22 05:01 PM)

Extras: Filter Print Post Top
Jump to top Pages: < Back | 1 | 2 | 3 | Next >  [ show all ]

Shop: MagicBag.co All-In-One Bags That Don't Suck   Mushroom-Hut Mono Tub Substrate   Left Coast Kratom Buy Kratom Extract   PhytoExtractum Buy Bali Kratom Powder   North Spore Bulk Substrate   Original Sensible Seeds Bulk Cannabis Seeds   Myyco.com Isolated Cubensis Liquid Culture For Sale   Kraken Kratom Red Vein Kratom


Similar ThreadsPosterViewsRepliesLast post
* Psilocybe cyanescens: Official Fall 2004 Thread
( 1 2 3 4 ... 28 29 )
Gumby 104,909 577 12/08/14 02:56 PM
by TheShroomNinja
* East coast 2021 ovoideocystidiata thread
( 1 2 3 4 ... 51 52 )
Shroomhunts 37,695 1,032 02/01/22 06:13 AM
by SandwichMan
* Weilii Thread
( 1 2 all )
Shdwstr 4,902 21 08/15/05 08:06 PM
by PSiFr33k
* Re: Freshly picked P. fimetaria and P. Subfimetaria mjshroomer 4,128 15 04/18/01 12:24 AM
by Thor
* p.fimetaria *DELETED* asd11 1,629 12 10/30/04 12:26 PM
by mjshroomer
* Spring cyans and some fimetaria
( 1 2 all )
spores 3,364 22 04/21/05 02:47 PM
by llamaboy
* Horse field P. Stunzii or P Fimetaria?
( 1 2 all )
psylosymonreturns 3,447 21 10/23/09 03:18 PM
by caphillkid
* Psilocybe fimetaria? up_right 5,903 18 12/13/09 03:48 AM
by CaptainFuture

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, inski, Alan Rockefeller, Duggstar, TimmiT, Anglerfish, Tmethyl, Lucis, Doc9151, Land Trout
2,405 topic views. 1 members, 13 guests and 42 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.035 seconds spending 0.006 seconds on 14 queries.