|
 smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
 P fimetaria cultivation - Smalltalk   3
#27517472 - 10/25/21 12:58 PM (2 years, 5 months ago) |
|
|
*Identified as Psilocybe Firmetaria 06.04.20200
  
Was Supposed to be semis, but isn't, so sporeprint taken from a fruit from such a biome.
But what are they?
Never seen anything like this - grew nicely on corn+coir
--------------------
Willpower is the one true virtue
   
Edited by smalltalk_canceled (06/10/22 01:50 AM)
|
Land Trout
Stranger
Registered: 01/08/18
Posts: 3,159
Last seen: 3 hours, 12 minutes
|
|
They do like like nice mushrooms. Too bad it’s not what you thought.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
The pictures below are from Google search "psilocybe hispanica", weirdly enough, dont know what they really are.
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (10/27/21 08:36 PM)
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia 
Last seen: 3 hours, 32 minutes
|
|
Looks like homegrown Psilocybe ovoideocystidiata, but please take that with a grain of salt. I'm sure someone will recognize those with high certainty.
--------------------
 l e a r n i n g t h i n g s
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
Consider Psathyrella piluliformis.
What do you mean by semis? Psilocybe semilanceata? If so, that species is almost impossible to cultivate and certainly not worth the bother. I've only ever seen a few novelty grows by very experienced growers, and they're always very low yield and produce very mutant looking fruitbodies.
Was this the original sample? If so, that's Psathyrella I think.
Edited by Duggstar (10/25/21 02:45 PM)
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
 Re: Faulty semis [Re: Duggstar]
#27517606 - 10/25/21 02:47 PM (2 years, 5 months ago) |
|
|
pictures of opening one up
    
Original samples at the end, this the shrooms thespore print was from
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (10/26/21 06:21 AM)
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
5 rating and free spore print to the winner
--------------------
Willpower is the one true virtue
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
|
Someone mixed up the prints, intentionally or unintentionally. I still think it is Psilocybe ovoideocystidiata.
--------------------
l e a r n i n g t h i n g s
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
They actually might be Psilocybe, but I don't think ovoids. Do they have a separable gelatinous pellicle and bruise blue? If that's the same species in your last photo, then consider Psilocybe azurescens.
|
jet li
The One
Registered: 07/09/07
Posts: 4,279
Loc: penis double yew
Last seen: 4 months, 28 days
|
|
Where are you from and where did you get the original mushroom? They sorta look like could be Australian psilocybe species but not sure
|
tonz0Funguy
Registered: 09/03/19
Posts: 200
Loc: 420 yellow brick road
Last seen: 2 months, 16 days
|
Re: Faulty semis [Re: jet li] 1
#27517913 - 10/25/21 06:38 PM (2 years, 5 months ago) |
|
|
--------------------
"The search bar is a oracle"
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
Quote:
smalltalk_canceled said:
Original samples at the end, this the shrooms thespore print was from
And pictures of opening one up
The ones in the last pic look like Psilocybe Pelliculosa to me, or perhaps a mixture of Psilocybe Pelliculosa and P. semilanceata. But that big one is a different species and doesn't look like any Psilocybe to me, it looks more like Psathyrella. Also, I'm not even sure if any wood lover would even fruit off coir without any actual wood. I've never heard or seen of it, but I'm not a cultivator.
|
Land Trout
Stranger
Registered: 01/08/18
Posts: 3,159
Last seen: 3 hours, 12 minutes
|
Re: Faulty semis [Re: Duggstar]
#27518010 - 10/25/21 07:36 PM (2 years, 5 months ago) |
|
|
Do Psathyrella have a webby veil like in the first pic of the post?
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
Quote:
Land Trout said:
Do Psathyrella have a webby veil like in the first pic of the post?
Yes, but so do many Psilocybe species. Psathyrella would be more brittle, don't bruise blue, and don't have a separable gelatinous pellicle.
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
Re: Faulty semis [Re: Duggstar]
#27518292 - 10/26/21 02:43 AM (2 years, 5 months ago) |
|
|
I am not sure to which mushroom Dugs refers with being P.piluliformis, I'm fairly confident there are no Psathyrella in this thread.
I was also first thinking P.azurescens, but well developed annulus shown in first picture is wrong for that species. Perhaps sect.stuntzii ??
OP, can you help us help you by answering these questions:
- do they bruise blue to damage or spontaneously
- what is color of their spore print
- where did you get spore print, from "reliable" source or your own collection, since they are obviously not P.semi. Did you get it from Australia, PNW, Europe ?!
Like Dugg already said, no one ever grew P.semi successfully.
--------------------
l e a r n i n g t h i n g s
Edited by RenegadeMycologist (10/26/21 02:44 AM)
|
 Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
cronicr grew semilanceata indoors successfully... Workman did also...
That said. This is absolutely not semilanceata.
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
|
Quote:
Foo Foo The Snoo said:
cronicr grew semilanceata indoors successfully... Workman did also...
I agree, but they are weak grows, nothing spectacular, probably would be considered failure through the eyes of ordinary cube grower. Imagine you grow cubes and you get only three mutated specimens and shouting: I succeeded ! 
--------------------
l e a r n i n g t h i n g s
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
|
Quote:
Foo Foo The Snoo said:
That said. This is absolutely not semilanceata.
Could it be something Australian, like tassie ?
--------------------
l e a r n i n g t h i n g s
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
Probably not tasmaniana.
Either ovoideocystidiata or something in section stuntzii would be a more appropriate guess.
Definitely Psilocybe, as far as what species, we could not say TBH.
Certainly not semilanceata, however.
The fact these have been cultivated will make the phenotype unusual and almost impossible to accurately guess.
Cultivated fruits can look entirely different to wild examples, especially in some Psilocybe species....
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
Quote:
RenegadeMycologist said:
Quote:
Foo Foo The Snoo said:
cronicr grew semilanceata indoors successfully... Workman did also...
I agree, but they are weak grows, nothing spectacular, probably would be considered failure through the eyes of ordinary cube grower. Imagine you grow cubes and you get only three mutated specimens and shouting: I succeeded !
They were indeed weak grows, but considering semilanceata is next to impossible to cultivate they are still admirable.
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
|
--------------------
l e a r n i n g t h i n g s
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
Dissing those grows in another thread please, those grows you belittle are works of art.
I believe this must be a non psilocybe, there's no blue bruising
--------------------
Willpower is the one true virtue
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
Why so sensitive? We menstruating there OP? We aint dissing no grows my dawg we stating facts.
Mutant indoor semilanceata is such a work of art!
Ok interesting that they are not bruising.
They look superficially like stuntzii or tasmaniana or some weird ovoideocystidiata however... There is no telling what they are...
If they are not Psilocybe then I'm afraid I'm uncertain what they are...
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
Re: Faulty semis [Re: Duggstar]
#27518323 - 10/26/21 04:16 AM (2 years, 5 months ago) |
|
|
Quote:
smalltalk_canceled said:
this the shrooms thespore print was from
These specimens are clearly Psilocybe semilanceatata...
What you have grown in some random inactive trash, who ever gave you the print claiming the spores are semilanceata ripped you off, unintentionally or otherwise.
Quote:
smalltalk_canceled said:
If this is not bruising blue then this clearly is some random shit and is not Psilocybe, bin these specimens and the whole grow if they do not display any blue bruising...
|
Shroomhunts
Hunter Gatherer
Registered: 05/07/18
Posts: 2,954
Loc: PA
Last seen: 19 hours, 42 minutes
|
|
Quote:
RenegadeMycologist said:
Someone mixed up the prints, intentionally or unintentionally. I still think it is Psilocybe ovoideocystidiata.
Not voidz
--------------------
      
You never kno
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
Indeed not ovoideocystidiata, not even Psilocybe for that matter.
OP grew some random inactive.
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
|
He won't tell spore print might be Agrocybe if brown print and if not bruise.
--------------------
l e a r n i n g t h i n g s
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
|
Quote:
smalltalk_canceled said:
Dissing those grows in another thread please, those grows you belittle are works of art.
Raping species to the max to produce fruits in complete unnatural environment and substrate only to get poor mutant individuals and calling it "work od art"... Alright...
You have your opinion and people here have theirs and will most certainly voice it, it's public thread.
Calm down please, everyone here tried to help, you could say in the beginning they don't bruise...You refuse to do spore print, you refuse to say what part of the world you got your prints, you refuse to update with critical information for reliable ID...and you get annoyed by unrelevant things....
--------------------
l e a r n i n g t h i n g s
Edited by RenegadeMycologist (04/11/24 07:58 AM)
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
Quote:
RenegadeMycologist said:
Calm down please, everyone here tried to help, you could say in the beginning they don't bruise...You refuse to do spore print, you refuse to say what part of the world you got your prints, you refuse to update with critical information for reliable ID...and you get annoyed by unrelevant things....
Yeah oath calm down Karen.
We were tamely discussing the semilanceata attempts that were successful, yet only produced weak hauls of homunculus fruit bodies.
We were not dissing cronicr or Workman's attempts, but we both have seen thier grows and were simply discussing the fact they only produced solitary fruits...
Yet that it's still admirable and amazing they even grew indoor libs... Where's the dissing in that Karen? Are you a woman or a man?
IDK whats up will all the fucking sensitivity on the forums in all honesty, to much estrogen in some...
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
|
Yup, man up babnik.
We are all entitled to an opinion, and we still want to help you even if some of us (myself) disagree about other stuff.
--------------------
l e a r n i n g t h i n g s
Edited by RenegadeMycologist (10/26/21 05:02 AM)
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
It's not even opinion LOL it's FACT that they were weak grows, semilanceata does much better in the wild than in a controlled indoor environment.
Karen's just going out of the way to look for things to be offended by...
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
This isn't a indoor grow, it's vaguely based on Baba yaga.
Where they fruited well.
I suggest you check it out
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (10/26/21 05:07 AM)
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
IDK what u mean by "Not indoor grow, based on baba yaga grow"...
But at this stage the discussion of "baba yaga grows" is off topic...
This is Mushroom Hunting and Identification, not Mushroom Cultivation.
The folk here ID mushrooms, not discuss cultivation methods.
End of discussion, nothing more needs to be said.
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
Actually my bad I do know the user Baba Yaga... I might actually check that out...
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
|
tonz0Funguy
Registered: 09/03/19
Posts: 200
Loc: 420 yellow brick road
Last seen: 2 months, 16 days
|
|
I had already linked baba ya ya thread lol oh well, I’d like to give Libs a go in this fashion anyone got a lib spore print? They’re native but a rare find in my area
--------------------
"The search bar is a oracle"
|
Nitro87
Living the Dream
Registered: 07/08/20
Posts: 2,002
Loc: The Clouds
|
|
Quote:
smalltalk_canceled said:
Dissing those grows in another thread please, those grows you belittle are works of art.
I completely agree. I am sure it takes a lot of hard work as well! The more people that can successfully get exotics to fruit the better IMO 
--------------------
Life is worth living
  
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semis [Re: Nitro87]
#27520653 - 10/27/21 07:52 PM (2 years, 5 months ago) |
|
|
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (10/27/21 08:23 PM)
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
I still think they're Psathyrella as the spore print is purple-black and they don't look like Psilocybe, Deconica or Stropharia. But you didn't answer my question yet - do they have a separable gelatinous pellicle? And I take it they still don't bruise blue? Also, are they very brittle?
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
Quote:
RenegadeMycologist said:
He won't tell spore print might be Agrocybe if brown print and if not bruise.
The spore print is purple-black.
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr 
Last seen: 3 hours, 15 minutes
|
Re: Faulty semis [Re: Duggstar] 1
#27521473 - 10/28/21 12:24 PM (2 years, 5 months ago) |
|
|
if I remember correctly, OP had these growing from what he believed was a P. semilanceata spore print
that was sent to him by a fellow Norwegian, which apparently was a seasoned hunter.
I completely agree with Duggstar though, these are not a Psilocybe species, and they do have a strong
resemblance to Psathyrella, very possibly P. piluliformis. How this mix up came about I can't
say much about though. But one misidentified specimen is all it takes, I guess.
But mislabelled prints and collections is not new to mycology. Alan's method uploading all collections
to MO and labelling them and all related paraphernalia with the observation number seems to me a
good way to avoid mixups.
I also suggest people writing in this thread try to appreciate this honest attempt at cultivating P. semilanceata, although
it obviously went south this time.
--------------------
 ★★★★★
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
Thanks angler, this thread is just about trying to identify whatever this is - nobody is more upset with this event than me.
There are other semi cultures that could be correct that still could throw fruits in the current weather, but that's a subject for another thread.
The comments here on semilanceata being impossibly hard must be seen in conjunction with Baba Yagas grow, which had great results.
So impossible inside - currently - but feasible colonized inside and spawned outside - as Baba Yagas thread documents well in my opinion
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (10/28/21 12:43 PM)
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
Might be, or perhaps probably, contamination. It could well have been a Psilocybe semilanceata print to start with, but with the substrate not being suitable for P. semilanceata, the contam species took over.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semis [Re: Duggstar] 1
#27525521 - 10/31/21 04:36 PM (2 years, 5 months ago) |
|
|
It's so funny that this is a failure, with any exotic active this would have been a fine ass piece of work
Just look at these
  
What species found in semilanceata biome, is a cold fruiter, fruits on semilanceata type of terrain like grass meadows, ia brown and with some tendency towards a nipple , and mistakable with semis?
Edited by smalltalk_canceled (10/31/21 04:52 PM)
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
Quote:
smalltalk_canceled said:
What species found in semilanceata biome, is a cold fruiter, grass eater, brown and with some tendency towards a nipple , and mistakable with semis
Who's to say...
Could have been any random in-active the guy trading you for the "semilanceata" print decided to rip you off with...
|
Land Trout
Stranger
Registered: 01/08/18
Posts: 3,159
Last seen: 3 hours, 12 minutes
|
|
Is the blue just a reflection from the liner?
|
Bardy
Registered: 04/02/14
Posts: 2,635
Last seen: 4 hours, 50 minutes
|
|
I think so, I can only really see it in one photo
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
Quote:
Land Trout said:
Is the blue just a reflection from the liner?
I want to know this too! If They are genuinely bluing then I would have to change my mind. If they are Psilocybe, I think but I do not know, that there are only a few species that would fruit off coir so we could rule out any of the wood lovers. The only thing I can think of is Psilocybe fimetaria, and gosh, they look close! Do they have a separable gelatinous pellicle??
And some of these from the original collection with the reddish brown caps don't look like libs to me, I think this is a mixed collection.
|
Land Trout
Stranger
Registered: 01/08/18
Posts: 3,159
Last seen: 3 hours, 12 minutes
|
Re: Faulty semis [Re: Duggstar]
#27525872 - 10/31/21 10:01 PM (2 years, 5 months ago) |
|
|
Yeah, they’ve got a lot of different charachteristics of other Psilocybe, like all over the place, but no semilenceata traits.
|
Bardy
Registered: 04/02/14
Posts: 2,635
Last seen: 4 hours, 50 minutes
|
|
Isn’t Psathyrella piliuliformis a woodlover? Couldn’t you rule that out because of this? ...I’m learning...
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
Re: Faulty semis [Re: Bardy]
#27526016 - 11/01/21 04:56 AM (2 years, 5 months ago) |
|
|
Quote:
Bardy said:
Isn’t Psathyrella piliuliformis a woodlover? Couldn’t you rule that out because of this?
Yes it is woodlover, it fruits literally from wood.
Quote:
Land Trout said:
Is the blue just a reflection from the liner?
Quote:
Bardy said:
I think so, I can only really see it in one photo
There is blue "staining" in all 3 pictures. However, not to the same degree. It's hard to say where it comes from, is it reflection, or intrinsic. They are moved away from blue liner in the third picture, and they still exibit blue staining. Good idea would be to remove the blue foil or whatever that is, then take new set of pictures.
Quote:
Anglerfish said:
I completely agree with Duggstar though, these are not a Psilocybe species, and they do have a strong
resemblance to Psathyrella, very possibly P. piluliformis. How this mix up came about I can't
say much about though. But one misidentified specimen is all it takes, I guess.
How many TIs does it take to identify a Strophariaceae !?
Joke aside, I am not sure why do you guys see Psathyrella piluliformis here, other than superficial resemblance of the cap color, gills are too sparse, much shorther, stem tough and fibrillose. And it's not wood substrate like Bardy noted. I still think this might be Psilocybe, now with the blue "stain" this case is opened again. If they don't bruise, well I still think they are not Psathyrella.
Also can't be forementioned fimetaria though, which is strictly coprophilous species. So if the substrate is not enriched with dung, chances are zero.
His mushrooms are just way too tough for fragile genus of Psathyrella and for the most part family of Psathyrellaceae. I think Deconica might be good contender if this turns out to be fake bruising. That species is usually confused with Psilocybe in the field, it has tough and ornamented stem like pictured here, caramel colored cap, sparse gills, purplish spore print...
--------------------
l e a r n i n g t h i n g s
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
RenegadeMycologist said:
How many TIs does it take to identify a Strophariaceae !?
No one here have suggested anything in Strophariaceae.
Quote:
I still think this might be Psilocybe, now with the blue "stain" this case is opened again. If they don't bruise, well I still think they are not Psathyrella.
To check the apparent bluing is easy, just cut loose one specimen and take a picture in outdoor light.
I'm not convinced of anything here, I think OP owes us some more detailed information about the source(s) of his prints.
--------------------
★★★★★
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
|
Quote:
Anglerfish said:
Quote:
RenegadeMycologist said:
How many TIs does it take to identify a Strophariaceae !?
No one here have suggested anything in Strophariaceae.
I said Agrocybe but Dug said spores seem purplish, and he is completely right. I was also thinking possibly Cyclocybe erebia, but then again, spore color is off. Spores indeed seem purplish, at least on these pictures and on annulus, since we haven't seen this collection printed on paper. I thought this might be something in Strophariaceae, however I completely forgot Psilocybe is in Hymenogastraceae and not in Strophariaceae, so that's my mistake on that part. But I think now it's Deconica, although it's very gregarious, almost caespitose. Also what's up with this blue stain, incredible. Inspecting these photos over and over, can't decide if it's legit.
New photos, no blu foil please ?
--------------------
l e a r n i n g t h i n g s
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
Quote:
RenegadeMycologist said:
Also can't be forementioned fimetaria though, which is strictly coprophilous species. So if the substrate is not enriched with dung, chances are zero.
But so is Psilocybe cubensis and it grows quite nicely on coir in a domestic grow. Is it not reasonable to assume then that P. fimetaria would grow on it too?
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semis [Re: Duggstar]
#27526104 - 11/01/21 08:11 AM (2 years, 5 months ago) |
|
|
As you wish:
 
To me, this does not look like blue bruising
More yellow/brown/dark (spores?)
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (11/01/21 08:13 AM)
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
Re: Faulty semis [Re: Duggstar]
#27526119 - 11/01/21 08:38 AM (2 years, 5 months ago) |
|
|
Quote:
Duggstar said:
But so is Psilocybe cubensis and it grows quite nicely on coir in a domestic grow. Is it not reasonable to assume then that P. fimetaria would grow on it too?
Fair point, not sure.
I believe that cubes are pretty "domesticated" since they are grown for decades now, so strains might adapted to coir, ie those ones which grows well on coir are selected. And fimetaria is I believe grown one or two times total, so I highly assume it still needs manure...
But on the other hand, perhaps there are coir grows from spores taken directly from wild cubes, which will destroy domestication to coir hypothesis, however I'm not into cultivation scene, perhaps someone well versed chimes in.
That said, considering those latest photos, obviously zero bluing is shown. I'm not sure what those are, I'm inclined to think Psathyrella stem would crumble by now of all the weakness, stem in these look rather tough in my eyes. I'll refrain from giving any more ids here...
--------------------
l e a r n i n g t h i n g s
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
Quote:
I believe that cubes are pretty "domesticated" since they are grown for decades now, so strains might adapted to coir, ie those ones which grows well on coir are selected.
I believe the history of using coir started with people experimenting with using it for casing but accidentally finding out that it works better as a substrate, so any cubes should grow on it.
Quote:
I'm inclined to think Psathyrella stem would crumble by now of all the weakness, stem in these look rather tough in my eyes.
I agree. I think these are probably Deconica then if the apparent bluing isn’t true.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semis [Re: Duggstar]
#27526678 - 11/01/21 05:32 PM (2 years, 5 months ago) |
|
|
Saw this post today, found the appearance of these semis pretty upsetting too:
Quote:
soppos said:
2:nd flush Equadorian coming along on a big mega block in a ol' mono i had laying around.
. pins like a boyscout
and some last season libs.
--------------------
Willpower is the one true virtue
|
Moria841
Registered: 07/02/18
Posts: 4,985
Loc: NJ 
Last seen: 40 minutes, 14 seconds
|
|
Quote:
smalltalk_canceled said:
It's so funny that this is a failure, with any exotic active this would have been a fine ass piece of work
Just look at these
What species found in semilanceata biome, is a cold fruiter, fruits on semilanceata type of terrain like grass meadows, ia brown and with some tendency towards a nipple , and mistakable with semis?
We're really saying these look more like Psathyrella than Psilocybe?
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
Re: Faulty semis [Re: Moria841]
#27526733 - 11/01/21 06:32 PM (2 years, 5 months ago) |
|
|
Quote:
We're really saying these look more like Psathyrella than Psilocybe?
No. Some of the earlier photos I thought looked a bit like Psathyrella, but now I see the more mature specimens definitely not. Looks like either Psilocybe or Deconica, but apparently the bluing isn't true, just a reflection of the blue plastic, so I'm going with Deconica.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semis [Re: Duggstar] 2
#27526878 - 11/01/21 08:23 PM (2 years, 5 months ago) |
|
|
This is fucked up man where are the masters when you need em
What are these shrooms ??
These shrooms are maturing and probably dying right now, and we have no definitive answer.
How can I check for the slime clavicle?
--------------------
Willpower is the one true virtue
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
Quote:
smalltalk_canceled said:
How can I check for the slime clavicle?
Do you mean the separable gelatinous pellicle?
To be fair I did ask you 3 times, but it doesn't matter now anyway, it wouldn't distinguish between Deconica and Psilocybe. But you said they don't bruise blue, so they're probably Deconica, and I think that's as good an answer as you're gonna get based on the pics and info provided.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semis [Re: Duggstar]
#27526916 - 11/01/21 09:18 PM (2 years, 5 months ago) |
|
|
Now that you so clearly showed what you wanted me to do,
I checked, and found a slimy formation atop the hat that could be pulled / stretched similar to your picture, although my picture doesn't show it well. It only shows that I could pull a slimy texture from that top of the cap
--------------------
Willpower is the one true virtue
|
Land Trout
Stranger
Registered: 01/08/18
Posts: 3,159
Last seen: 3 hours, 12 minutes
|
|
It would come off almost like a jellylike contact lens
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
|
Quote:
smalltalk_canceled said:
Looks viscid, not separably viscid.
Quote:
Duggstar said:
it doesn't matter now anyway, it wouldn't distinguish between Deconica and Psilocybe. But you said they don't bruise blue, so they're probably Deconica, and I think that's as good an answer as you're gonna get based on the pics and info provided.
OP you have big collection. Try to damage some, see if they bruise blue upon damage. I believe you have hunreds of mushrooms, in collection that big you will get genuine blue somewhere upon damage or as cells dehydrate/dry. In my eyes that is only criteria which will qualify this collection as Psilocybe opposed to Deconica. Fimetaria for example will bruise genuine blue in 40% of dried specimens. Since you have large collection and if you don't find spec of blue anywhere, it pushes the answer to Deconica.
--------------------
l e a r n i n g t h i n g s
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
smalltalk_canceled said:
What are these shrooms ??
These shrooms are maturing and probably dying right now, and we have no definitive answer.
Your best bet to find out is to a) take a spore print and b) dry a few healthy specimens for microscopy and DNA sequencing.
For future reference you really must get better order in your collections and cultures, and label everything properly.
If someone are going to provide you with spore prints for cultivation, demand they also submit you with
pictures of the original mushroom(s) and preferably also more data like what date it was collected, type of
habitat (field, pasture, lawn, golf course etc.).
--------------------
★★★★★
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 12 hours, 45 minutes
|
|
These are Psilocybe semilanceata. Nice work!
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
Is there a reasoning to be shared, AR? What's the argument
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (11/05/21 09:42 AM)
|
rockyfungus
dirty
Registered: 03/01/21
Posts: 1,062
Loc: Front range
Last seen: 1 day, 17 hours
|
|
|
Land Trout
Stranger
Registered: 01/08/18
Posts: 3,159
Last seen: 3 hours, 12 minutes
|
|
Dude!!!!!
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
smalltalk_canceled said:
Is there a reasoning to be shared, AF? What's the argument
I honestly believe the only way to get a full answer is to send a sample to Alvalab in Spain for DNA sequencing.
--------------------
★★★★★
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
|
First ever (really successful) indoor grow of P.semilanceata just on coir+corn with gregarious to caespitose fruiting ?! I don't think so. It's not very likely to say at least.
With these photos only it's impossible narrowing this down more than Psilocybe/Deconica. Try those miraculix tests so the genus is settled at least.
--------------------
l e a r n i n g t h i n g s
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
It's colonized inside, but it was left outside for the whole period from it was placed out. Just to clarify.
--------------------
Willpower is the one true virtue
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
|
Quote:
smalltalk_canceled said:
It's colonized inside, but it was left outside for the whole period from it was placed out. Just to clarify.
Ah. So the actual primordia formation and fruiting happened outside ? Well that increases chances of this being a semi.
--------------------
l e a r n i n g t h i n g s
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
The weather was correct outside and correlated with local semi season temperature wise and humidity
My own theory as outlined by my replies in this thread is that this a 'neighbour' lookalike species that's always found nearby
--------------------
Willpower is the one true virtue
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
Number four picture is fucked
Number five is a new semi print I received from the shroomery recently. Sadly it is faint.
They are pretty similar to my eye at least
--------------------
Willpower is the one true virtue
|
manOwar
Siphonophore
Registered: 07/15/17
Posts: 317
Last seen: 14 days, 14 hours
|
|
I know that posting on this account, my opinion probably won’t count for much, (I accidentally locked myself out of my main one ambc,) but these look like cultivated Psilocybe semilanceata.
For whatever reason, they grow annulate fruit bodies, in cultivated specimens. You can even see that in the Baba Yaga grow. Please don’t chuck the grow regardless, even non-active, non-edible species that produce well in culture could be useful in the future.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semilanceata [Re: manOwar]
#27532168 - 11/06/21 07:05 AM (2 years, 5 months ago) |
|
|
Dark brown when wet, lighter when dry.
Quote:
semilancreator said:
Hey Dusan,
To check if they are deconicA younjust have to check the gills. They are a dead giveaway for the genus like I told you before.
I have recently been send pictures from a Portuguese collection of fimetaria and from central france so yes they do grow in southern Europe and nope not only on the coast.
The lack of bruising makes me suspect deconica. I am giving you a picture I took yesterday of Fimetaria from the same patch as the one we send out for sequencing last year. They were growing together with protostropharia (even on the same piece of dung!!) And a few deconica coprophila were sighted.
Some fullgrown specimen did not show bruising until An hour after picking like this one
I found a good bunch and toon around 40 prints. Gonna test the lot with a miraculix test soon and after that Will ingest and report to you 
Cheers,
Semi
(Edit)
Would like to say that I did not mean that the gills are distinct in the genus of deconica but rather for the species D. Coprophila.
Also found this post
Edited by smalltalk_canceled (11/06/21 08:47 AM)
|
CHUCK.HNTR
feral urbanite
Registered: 09/30/19
Posts: 2,321
Loc: SF, CA, USA
|
|
Sequence thems 
--------------------
"What is the practical application of a million universes?" -Alan Watts
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
Are prominent shroomery members now in complete paralysis from the sheer thought that this might be real?
A few pms I have received, so indicates.
You reader, who have said nothing so far.
It is time to add your words - is this a legendary breakthrough, unthinkably lucky or well done
-
Or what is it?
 
--------------------
Willpower is the one true virtue
|
Bardy
Registered: 04/02/14
Posts: 2,635
Last seen: 4 hours, 50 minutes
|
|
Legendary breakthrough? I think you’re tooting your own horn a bit haha
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
Re: Faulty semilanceata [Re: Bardy] 1
#27532789 - 11/06/21 05:45 PM (2 years, 5 months ago) |
|
|
Quote:
Bardy said:
Legendary breakthrough? I think you’re tooting your own horn a bit haha
It's also 45th bump or so...
Bruh, you got Alan Rockefeller to chime in, that's probably the best you'll get for pictorial identification. Send them for microscopy/sequencing then update.
If semis congrats, this would be the best grow I've ever seen, if not - then fuck, keep trying, but at least we'll know what this is.
--------------------
l e a r n i n g t h i n g s
|
 semilancreator
Stranger
Registered: 03/24/21
Posts: 59
Last seen: 3 minutes, 45 seconds
|
|
Don't think they are fims as the substrate seems insufficient but this is hypothetical. Send specimen to Alan and we will see.
|
sandman420
Saint PP
Registered: 06/17/04
Posts: 5,384
|
Re: Faulty semilanceata [Re: Bardy] 3
#27532915 - 11/06/21 07:35 PM (2 years, 5 months ago) |
|
|
Quote:
Bardy said:
Legendary breakthrough? I think you’re tooting your own horn a bit haha
Hey when you get a thick carpet of exotics like that make sure to share because your post history is nothing but looky looing, how dare you sir. If confirmed that's the best I've seen. Some of us out here doing something.
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
Re: Faulty semilanceata [Re: Bardy]
#27537228 - 11/10/21 01:08 AM (2 years, 5 months ago) |
|
|
Quote:
Bardy said:
Legendary breakthrough? I think you’re tooting your own horn a bit haha
Having a wee toot over there are we OP...
If Alan reckons they are semilanceata then perhaps they are. Where is the bruising tho...
They could be fimetaria perhaps, I know they don't bruise much. Nor do semilanceata for that mater. But it should still be noticeable.
Psilocybe fimetaria and Psilocybe semilanceata can and often do grow alongside each other in the same field and perhaps fimetaria got mistaken for semilanceata...
If they are indeed Psilocybe my vote goes to perhaps fimetaria, then again the cultivated semilanceata could come out looking strange so I'm uncertain.
|
semilancreator
Stranger
Registered: 03/24/21
Posts: 59
Last seen: 3 minutes, 45 seconds
|
|
Quote:
Foo Foo The Snoo said:
Quote:
Bardy said:
Legendary breakthrough? I think you’re tooting your own horn a bit haha
Having a wee toot over there are we OP...
If Alan reckons they are semilanceata then perhaps they are. Where is the bruising tho...
They could be fimetaria perhaps, I know they don't bruise much. Nor do semilanceata for that mater. But it should still be noticeable.
Psilocybe fimetaria and Psilocybe semilanceata can and often do grow alongside each other in the same field and perhaps fimetaria got mistaken for semilanceata...
If they are indeed Psilocybe my vote goes to perhaps fimetaria, then again the cultivated semilanceata could come out looking strange so I'm uncertain.
Fimetaria bruise more than semilanceata imo. Check out my picture gallery for some great examples.
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
I was checking out your fimetaria photos just earlier.
Fucking prime specimens...
Are you from the UK semilancreator?
|
wxorx
elsewhere
Registered: 10/18/19
Posts: 90
Last seen: 2 months, 8 days
|
|
This thread reminded me I have a culture I isolated from a wild semilanceata. I've tried and failed with it to colonize grain twice, and give up after some time, and finally the left petries ended forgotten in the fridge for months. I decided to check them today just to find this:
    
Since I don't know what to do with them I think I will just bury them in the large flowerpot I have on my balkony.
--------------------
void **
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
Re: Faulty semilanceata [Re: wxorx]
#27537308 - 11/10/21 03:44 AM (2 years, 5 months ago) |
|
|
Gnarly. That looks totally mutated...
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
smalltalk_canceled said:
is this a legendary breakthrough, unthinkably lucky or well done
-
Or what is it?
Nobody here can give a definite answer from pictures. No breakthrough is going to happen without
further analysis, i.e. microscopy and DNA sequencing, respectively.
I'd say "well done" whatever species it turns out to be though, since you grew a nice canopy of mushrooms.
--------------------
★★★★★
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
How is it even Psilocybe anyway?
Did his specimens even bruise at all...
If they are semilanceata then they are morphologically not normal.
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
Foo Foo The Snoo said:
How is it even Psilocybe anyway?
Did his specimens even bruise at all...
No bruising observed as far as I can tell. To be honest I think OP has done too little
to get to the source of what this possibly could be.
Quote:
If they are semilanceata then they are morphologically not normal.
Apparently they never are when cultivated, looking at both Baba Yaga and CaptainFuture's grows.
--------------------
★★★★★
|
Foo Foo The Snoo
The Snoo
Registered: 10/15/21
Posts: 177
|
|
Quote:
Alan Rockefeller said:
These are Psilocybe semilanceata. Nice work!
I would not be able to call them Psilocybe without any bruising present, perhaps they could be some Deconia species or some shit if no bruising?
If they are actually semilanceata I'll be genuinely surprised.
What makes you certain they are Psilocybe Alan?
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
Foo Foo The Snoo said:
If they are actually semilanceata I'll be genuinely surprised.
Roger that.
--------------------
★★★★★
|
manOwar
Siphonophore
Registered: 07/15/17
Posts: 317
Last seen: 14 days, 14 hours
|
|
It’s not unheard of to have collections with no noticeable bruising, it’s not one of the things I even look for before IDing wild picks, if they have much bruising I am surprised. Psilocybe semilanceata specific, I mean.
Edited by manOwar (11/11/21 11:54 PM)
|
knarkkorven
Entheoholic
Registered: 06/22/05
Posts: 1,709
Loc: Sweden 
Last seen: 21 days, 20 hours
|
Re: Faulty semilanceata [Re: manOwar]
#27540676 - 11/12/21 02:47 PM (2 years, 5 months ago) |
|
|
Certainly not Psilocybe semilanceata. I mean, come on guys. Some caps are even umbilicate. 
|
semilancreator
Stranger
Registered: 03/24/21
Posts: 59
Last seen: 3 minutes, 45 seconds
|
|
Quote:
knarkkorven said:
Certainly not Psilocybe semilanceata. I mean, come on guys. Some caps are even umbilicate.
A lot of the cultivated libs on this forum looked weird af. Wouldnt rule out libs untill Alan sequenced it.
|
Liberto
Psychonaut
Registered: 11/06/19
Posts: 356
Last seen: 4 months, 26 days
|
|
Libs. Some look like mutants I have found in nature.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semilanceata [Re: Liberto]
#27555050 - 11/23/21 01:40 PM (2 years, 4 months ago) |
|
|
Prints available
Also got a positive on sending tissue samples and prints to be analyzed
We will have the answer, in time
--------------------
Willpower is the one true virtue
|
Mr Piggy
Big Dick Retard
Registered: 09/29/11
Posts: 8,841
|
|
This is fun.
--------------------
🅃🄴🄰🄼 🄵🄾🄸🄻
|
Land Trout
Stranger
Registered: 01/08/18
Posts: 3,159
Last seen: 3 hours, 12 minutes
|
Re: Faulty semilanceata [Re: Mr Piggy]
#27555184 - 11/23/21 03:19 PM (2 years, 4 months ago) |
|
|
Ohhhh boy, got a scope coming in the mail soon too. Will share pics when I learn how to use it.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semilanceata [Re: Land Trout] 1
#27556564 - 11/24/21 04:53 PM (2 years, 4 months ago) |
|
|
Sclerotia
Quote:
smalltalk_canceled said:
Is this sclerotia ?
  
Edited by smalltalk_canceled (12/02/21 12:02 PM)
|
Land Trout
Stranger
Registered: 01/08/18
Posts: 3,159
Last seen: 3 hours, 12 minutes
|
|
  
I don’t know if this helps at all, I’m new at microscopy, and I know I need a way to measure them. Anyway here’s what they looked like under a scope. This is from print small talk
Had sent me.
Edited by Land Trout (12/18/21 09:02 AM)
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
More of these pinning in the garage, long dry period then given water around 0-10C in the garage, pins appeared 1-2d later.
--------------------
Willpower is the one true virtue
|
Land Trout
Stranger
Registered: 01/08/18
Posts: 3,159
Last seen: 3 hours, 12 minutes
|
Re: Faulty semilanceata [Re: Land Trout] 1
#27593450 - 12/24/21 08:12 PM (2 years, 3 months ago) |
|
|
Here’s some pics from another semilanceata print sent by someone else
 
|
JohnS0N
Stranger
Registered: 03/09/14
Posts: 53
Loc: Slovenia 
Last seen: 1 year, 5 months
|
|
Oh darn, still no conclusion!  
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
Land Trout said:
I don’t know if this helps at all, I’m new at microscopy, and I know I need a way to measure them. Anyway here’s what they looked like under a scope. This is from print small talk
Had sent me.
Pximetre perhaps? Did you get tissue samples as well to check cystidia etc.?
--------------------
★★★★★
|
MysticMycologist
Dirt Sherpa
Registered: 10/14/21
Posts: 1,755
Loc: seeking samadhi
|
|
--------------------
Two eyes to look, One eye to see.
Prying open my third eye
   
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (01/03/22 01:38 PM)
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Not much different, I think. They are really beautiful, though! 
--------------------
★★★★★
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 12 hours, 45 minutes
|
|
They look about the same, I think both are Psilocybe semilanceata. If you want to send me a bit of the print I can measure the spores and compare with my semilanceata prints.
|
Nitro87
Living the Dream
Registered: 07/08/20
Posts: 2,002
Loc: The Clouds
|
|
Quote:
smalltalk_canceled said:
Funny Lil guys
Have you had a chance to sample the last flush?
--------------------
Life is worth living
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
Quote:
Alan Rockefeller said:
They look about the same, I think both are Psilocybe semilanceata. If you want to send me a bit of the print I can measure the spores and compare with my semilanceata prints.
Theres a package coming your way by end of January, sorry for the delay.
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (01/03/22 05:17 PM)
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 12 hours, 45 minutes
|
|
Quote:
smalltalk_canceled said:
Theres a package coming your way by end of January, sorry for the delay.
Very cool! I'll scope a couple other collections so I am ready to make a meaningful comparison when it gets here.
|
clampconnected
Researcher
Registered: 04/07/20
Posts: 57
Loc: Portland Oregon
Last seen: 18 hours, 46 minutes
|
|
Great job smalltalk_canceled. These are amazing!
|
Doc9151
Mycologist
Registered: 02/23/17
Posts: 13,753
Loc: Gulf Coast USA
Last seen: 1 year, 8 months
|
|
Quote:
Land Trout said:
I don’t know if this helps at all, I’m new at microscopy, and I know I need a way to measure them. Anyway here’s what they looked like under a scope. This is from print small talk
Had sent me.
You need an eye piece reticle with a 1mm scale with 100 divisions
--------------------
  
Psilocybe cubensis data collection thread. please help with this project if you hunt wild cubensis.
https://www.shroomery.org/forums/showflat.php?Cat=0&Number=26513593&page=0&vc=1#26513593
|
Doc9151
Mycologist
Registered: 02/23/17
Posts: 13,753
Loc: Gulf Coast USA
Last seen: 1 year, 8 months
|
|
Quote:
Land Trout said:
I don’t know if this helps at all, I’m new at microscopy, and I know I need a way to measure them. Anyway here’s what they looked like under a scope. This is from print small talk
Had sent me.
You need an eye piece reticle with a 1mm scale with 100 divisions
Edit: you also need a stage micrometer to calibrate the eye piece.
--------------------
Psilocybe cubensis data collection thread. please help with this project if you hunt wild cubensis.
https://www.shroomery.org/forums/showflat.php?Cat=0&Number=26513593&page=0&vc=1#26513593
Edited by Doc9151 (01/08/22 07:26 PM)
|
clampconnected
Researcher
Registered: 04/07/20
Posts: 57
Loc: Portland Oregon
Last seen: 18 hours, 46 minutes
|
Re: Faulty semilanceata [Re: Doc9151] 1
#27612101 - 01/08/22 07:41 PM (2 years, 3 months ago) |
|
|
Microscopy of the mushroom would be cool, semilanceata have really neat forked cheilocystidia.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
Still handing out prints of these for anyone who wants, printed a single cap twice from the most recent pictures.
I'll easily take a melmak actually, don't have those
Also these fruits are extremely tolerant of cold, they grow and mature just above freezing temperatures
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (01/09/22 04:53 PM)
|
Land Trout
Stranger
Registered: 01/08/18
Posts: 3,159
Last seen: 3 hours, 12 minutes
|
Re: Faulty semilanceata [Re: Doc9151]
#27613278 - 01/09/22 06:15 PM (2 years, 3 months ago) |
|
|
Thank you Doc
|
Baba Yaga
Psychedelic Minion
Registered: 09/13/20
Posts: 4,209
Loc: Try 'n' Error Boot Camp
|
Re: Faulty semilanceata [Re: Land Trout] 2
#27613341 - 01/09/22 06:52 PM (2 years, 3 months ago) |
|
|
Hey smalltalk, I have started an official semilanceata thread
https://www.shroomery.org/forums/showflat.php/Number/27613283#27613283
I will keep updating my progress there but won't be much for another couple of month so I hope you will get in on the action.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semilanceata [Re: Baba Yaga] 1
#27614812 - 01/11/22 07:40 AM (2 years, 3 months ago) |
|
|
Hell yeah I think my fruits look alot like yours in some of your pictures in the initial post
Here's a shot from today
--------------------
Willpower is the one true virtue
|
seldom seen
April Fool
Registered: 11/03/07
Posts: 1,036
|
|
Wow, just chiming in to say nice job smalltalk! Roller coaster of a thread that somehow eluded me. Fkn A man, very nice
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
smalltalk_canceled said:
These are absolutely wonderful. 
Keep 'em coming, please.
--------------------
★★★★★
|
Baba Yaga
Psychedelic Minion
Registered: 09/13/20
Posts: 4,209
Loc: Try 'n' Error Boot Camp
|
|
 and yes I agree they are looking quite similar
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semilanceata [Re: Baba Yaga]
#27622499 - 01/17/22 01:51 PM (2 years, 2 months ago) |
|
|
Hats go lighter in color when dry, just like the real thing.
From brown to beige.
20.01: letter sent to Alan
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (01/20/22 07:57 AM)
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
Found this thread today:
https://mycotopia.net/topic/6365-psilocybe-hispanica-indoor/
"It rarely stains blue even with severe abuse.". - workman
Hispanica and semilanceata was posted to be almost genetically identical elsewhere:
Quote:
Alan Rockefeller said:
Could P. hispanica be conspecific with P. semilanceata?
The ITS sequences are just one base pair different, and it's just that one A turned into two A's near the beginning of the sequence, which is likely not even a real difference.
Perhaps they found P. semilanceata on horse dung and thought it was something new because of the unusual substrate. But horse dung is really just chewed up grass, so it's not that much of a leap - and P. semilanceata is found in the area.
The LSU sequences of the two species are identical.
I am having trouble finding the original species description, which was published in "Docums Mycol. 29(no. 116): 42 (2000)". Docums Mycol. is short for Les Documents Mycologiques.
Here's a photo of the holotype: http://mushroomobserver.org/241329
I belive the pictures in mycotoåi thread settles it well, these are actually hispanica?
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (01/23/22 06:21 AM)
|
semilancreator
Stranger
Registered: 03/24/21
Posts: 59
Last seen: 3 minutes, 45 seconds
|
|
Could be could be.... But then again one would need a sequence of your specimen to make it conclusive. As I heard from Alan while hunting Liniformans in the Dutch Dunes no good conclusive sequence of Hispanica is known. I think we need to do a little expedition into the Pyrenees mountains to collect more material.
Also if your print rlly came from a Norse Hunter I highly doubt they are hispanica if that is a real species.
The plot seems to thickens :p Will be watching this thread.
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 12 hours, 45 minutes
|
|
Quote:
smalltalk_canceled said:
I belive the pictures in mycotoåi thread settles it well, these are actually hispanica?
Possible but very unlikely - where did the spores come from?
Psilocybe hispanica is one species that I haven't been able to track down a sample for study. If anyone has it please PM me.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
Well you have two prints on the way if this is hispanica..
Hispanica and semilanceata is identical genetically according a old post by you
I would grow them out, Alan.
Make a simple sub, and just cold shock near zero, they pin.
--------------------
Willpower is the one true virtue
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 12 hours, 45 minutes
|
|
Spores measure (11.5) 12.2 – 13.7 (16.5) × (6.9) 7 – 7.6 (8.6) µm
Q = (1.6) 1.7 – 1.89 (1.9) ; N = 30
Me = 13 × 7.3 µm ; Qe = 1.8
Spores 1000x
Cheilocystidia 1000x
Behind the scenes:
Today a few people visited my lab including Peter Werner, who is a professional microscopist and a coauthor on the paper that described Psilocybe allenii. We decided to study this sample, and found that microscopically it's a perfect match for Psilocybe semilanceata. Peter made the cheilocystidia mounts and I was able to get some really nice photos of them. The cheilocystidia in this species is very distinctive, and we don't think there's any chance that it's something else.
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
Alan Rockefeller said:
microscopically it's a perfect match for Psilocybe semilanceata.
That's cool. Perhaps the thread title should be changed then, from "faulty" to "successful".
--------------------
★★★★★
|
semilancreator
Stranger
Registered: 03/24/21
Posts: 59
Last seen: 3 minutes, 45 seconds
|
Re: Faulty semilanceata [Re: Anglerfish] 1
#27651799 - 02/09/22 04:50 AM (2 years, 2 months ago) |
|
|
This is Bonkers....
This gives me so much hope for my Fimetaria project :o
All And all this is awesome :o.... Great job smalltalk-canceled!!!
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
All hands rise for justice
--------------------
Willpower is the one true virtue
|
Land Trout
Stranger
Registered: 01/08/18
Posts: 3,159
Last seen: 3 hours, 12 minutes
|
|
Very cool
And it was fun to review the entire thread again. The best and worst of the internet right here friends!
Edited by Land Trout (02/09/22 09:08 AM)
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semilanceata [Re: Land Trout] 1
#27652028 - 02/09/22 09:10 AM (2 years, 2 months ago) |
|
|
Sharing prints, bet their value just went up
--------------------
Willpower is the one true virtue
|
Doc9151
Mycologist
Registered: 02/23/17
Posts: 13,753
Loc: Gulf Coast USA
Last seen: 1 year, 8 months
|
|
Once again, Alan's pictures do NOT disappoint, excellent photos!!!
--------------------
Psilocybe cubensis data collection thread. please help with this project if you hunt wild cubensis.
https://www.shroomery.org/forums/showflat.php?Cat=0&Number=26513593&page=0&vc=1#26513593
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Faulty semilanceata [Re: Doc9151] 7
#27652413 - 02/09/22 02:19 PM (2 years, 2 months ago) |
|
|
Norwegian semilanceata - cultivated
Thanks for all the support and kind words. The project actually took almost 2 years to complete, culture work started as far back as 2020.
Now, finally, getting results and verified results.
Been smiling from top to toe,
all day.
There's something about setting a goal, struggling, being berated, laughed at, and then finally reaching your goal.
--
--
All the outdoor patches failed in 2021. There had been many shoeboxes and jars before this.
But suddenly something started to pin, first a flowerpot on the porch, then later in the garage, this winter 2021.
And here we are!
What I think is significant with my grow, is how it advances our imagery of this species
No more should manure, grass or any other special component be considered important or absolutely necessary in attempts to cultivate this species
No more should indoor cultivation be considered entirely impossible. These most recent ones were never in natural soil, and always roofed.
The honor of the grow goes back to the shroomery, it's Tek writers, TCs, its people.
I would never have achieved this without the fatherly love, Endless patience, and bottomless generosity of the shroomery
Thank you for all you have created - and inspired - in me.
Credits to SO, and to the picker of the collection, whose identification must be called redeemed.
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (02/09/22 03:29 PM)
|
sandman420
Saint PP
Registered: 06/17/04
Posts: 5,384
|
|
Congratulations on your success with this man
|
Baba Yaga
Psychedelic Minion
Registered: 09/13/20
Posts: 4,209
Loc: Try 'n' Error Boot Camp
|
Re: Norwegian semilanceata - Smalltalk [Re: sandman420]
#27652442 - 02/09/22 02:48 PM (2 years, 2 months ago) |
|
|
Yeah, congrats man!
|
Pluviophile
Stranger
Registered: 10/26/17
Posts: 3,289
Loc: Massachusetts
Last seen: 1 hour, 2 minutes
|
Re: Norwegian semilanceata - Smalltalk [Re: Baba Yaga] 2
#27652618 - 02/09/22 05:19 PM (2 years, 2 months ago) |
|
|
Congratulations brother!
Epic grow!
I agree with everything you say about this amazing forum.
Your standing on the shoulders of giants in the mushroom world.
This is a very special grow though!
Historical success with cultivation of this beautiful species.
Thank you for taking the challenge and sharing this grow with the community!
|
natedawgnow
Rocky mountain hood rat
Registered: 02/09/15
Posts: 8,940
Loc: ation
|
Re: Norwegian semilanceata - Smalltalk [Re: Pluviophile] 7
#27652811 - 02/09/22 07:33 PM (2 years, 2 months ago) |
|
|
Dude, smalltalk, great thread. This project appears to have broken the brains
of many TIs and some posters here really made themselves look like complete asses (lookin at you snoo the foo and renegademyco)
Good job dude, seriously.
--------------------
|
CHUCK.HNTR
feral urbanite
Registered: 09/30/19
Posts: 2,321
Loc: SF, CA, USA
|
Re: Norwegian semilanceata - Smalltalk [Re: natedawgnow]
#27653093 - 02/09/22 11:58 PM (2 years, 2 months ago) |
|
|
This is so cool! Congrats OP great work!
Alan excellent work per usual. What a saga of a thread
--------------------
"What is the practical application of a million universes?" -Alan Watts
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Norwegian semilanceata - Smalltalk [Re: natedawgnow]
#27653256 - 02/10/22 06:21 AM (2 years, 2 months ago) |
|
|
Quote:
natedawgnow said:
Dude, smalltalk, great thread. This project appears to have broken the brains
of many TIs and some posters here really made themselves look like complete asses (lookin at you snoo the foo and renegademyco)
Good job dude, seriously.
Thanks Nate
Sorry about before
--------------------
Willpower is the one true virtue
|
ModularMind
M.P.F.
Registered: 02/09/10
Posts: 7,902
|
 Re: Norwegian semilanceata - Smalltalk [Re: natedawgnow]
#27653390 - 02/10/22 08:52 AM (2 years, 2 months ago) |
|
|
Quote:
natedawgnow said:
Dude, smalltalk, great thread. This project appears to have broken the brains
of many TIs and some posters here really made themselves look like complete asses
Well now I have to go back and read from the beginning.
|
Frank Zappotecorum
Smooth-Brained Mycophagist
Registered: 01/01/17
Posts: 138
Loc: Scamdinavia
Last seen: 11 months, 5 days
|
Re: Norwegian semilanceata - Smalltalk [Re: ModularMind]
#27654430 - 02/10/22 09:09 PM (2 years, 2 months ago) |
|
|
This thread was a real pleasure to read. Well done, smalltalk.
--------------------
What are all these leaves doing in my mouth?
I ain't got a lot but peep my Trade list
|
Melgo
Semperviva Fanatic
Registered: 02/11/16
Posts: 737
Loc: Western Europe
Last seen: 2 hours, 17 minutes
|
|
Well done Smalltalk, this is AWESOME!!!
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Norwegian semilanceata - Smalltalk [Re: Melgo] 4
#27660138 - 02/15/22 03:49 PM (2 years, 1 month ago) |
|
|
I heard they are being eaten right now
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (02/15/22 04:12 PM)
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
smalltalk_canceled said:
I heard they are being eaten right now
How did they respond? 
--------------------
★★★★★
|
semilancreator
Stranger
Registered: 03/24/21
Posts: 59
Last seen: 3 minutes, 45 seconds
|
|
Very intrigued!
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 12 hours, 45 minutes
|
|
Update:
I got a good DNA sequence for this and it is a 100% match for Psilocybe fimetaria!
It's closely related to Psilocybe semilanceata, and microscopy isn't very good at separating closely related species.
Matches perfectly with the sequence from https://mushroomobserver.org/471427 and a few other sequences in Genbank.
ITS sequence: ACTTGGCTCGGTTGCAGCTGGTCCTCTCGAGGGCATGTGCTCGCCGTGTCATCTTTATCTCTCCACCTGTGCACCCTTTGTAGACCTGGATTAGTTAACTTTCCGAGGAAACTCGGTCGGGAGGATTGCTTTCACGAGCTCTCCTTGCAATTAAGCCCAGGCCTACGTTTTCATATACCCCAAAGTATGTAACAGAATGTATCATATGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTCGTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGACGTCTGCATGAATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAACACAAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCAT
|
Moria841
Registered: 07/02/18
Posts: 4,985
Loc: NJ
Last seen: 40 minutes, 14 seconds
|
|
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
Alan Rockefeller said:
Update:
I got a good DNA sequence for this and it is a 100% match for Psilocybe fimetaria!
Fantastic!
That means whoever found the original specimens in the wild actually unknowingly
made the first confirmed find of P. fimetaria in Norway, thinking it was P. semilanceata.
Bet that isn't actually the first time this happened, since a lot of people are hunting
them for "recreational" purposes.
--------------------
★★★★★
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Norwegian semilanceata - Smalltalk [Re: Anglerfish]
#27723174 - 04/06/22 12:08 PM (2 years, 10 days ago) |
|
|
and my theory of it being a lookalike cold fruiter was correct!
Wow what a ride. Changing title. Arrrghhhhhh
--------------------
Willpower is the one true virtue
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
are there previous records of cultivating firmetaria? while the semilanceata dream now is reborn, im still kinda pleased with this overall
the firmetaria box in this thread is still fruiting - from december to now
and two tests of them suggest no psychoactive effect, although the species is said to be active
is this a first for growing it too?
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (04/06/22 12:13 PM)
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
--------------------
Willpower is the one true virtue
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
smalltalk_canceled said:
are there previous records of cultivating firmetaria? while the semilanceata dream now is reborn, im still kinda pleased with this overall
the firmetaria box in this thread is still fruiting - from december to now
and two tests of them suggest no psychoactive effect, although the species is said to be active
is this a first for growing it too?
As far as I know there are no records of confirmed P. fimetaria cultivation.
That's probably because it is considered rare, and requires thorough analysis to
be correctly identified.
When you say you tested them for effects, how much did you consume?
It kinda irks me you didn't notice anything, since P. fimetaria are considered
on level with P. semilanceata in potency.
Alan should in any case be able to measure alkaloid content with a Miraculix test.
--------------------
★★★★★
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: Norwegian semilanceata - Smalltalk [Re: Anglerfish]
#27723283 - 04/06/22 01:47 PM (2 years, 10 days ago) |
|
|
I have both firmetaria, and the miraculix test on hand now, so i'll be sharing the results of the test really soon.
--------------------
Willpower is the one true virtue
|
ModularMind
M.P.F.
Registered: 02/09/10
Posts: 7,902
|
|
Cool stuff.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: ModularMind] 1
#27723421 - 04/06/22 03:25 PM (2 years, 10 days ago) |
|
|
There was probably 100-200 semilanceata on the original collection the spore print was taken from (?) and among these, there were maybe a single or a low amount of firmetaria, we must assume, snuck in by the mistake of the picker and printer.
And this somehow ended up being its own genetic line in the agar work,
and fruiting once during fall outside in a flowerpot, and then later in a shoebox in a dubtub in a cold garage, decemeber 2021.
It says on a wiki they like to fruit in circles, thats pretty funny to read NOW and look back at the circular shoebox. I mean there was basically no formal information about firmetaria than this.
Did someone suggest it in the thread? I'll have to check
The prints from the december-now shoebox are sent to alan, who labels it semlanceata based on the microscopy that he and the other guy did.
Then we wait for the DNA test, the DNA test says its Psilocybe Firmetaria
The fruits are not perceived as active by microdosing by me, or the guy who ate the plate dinner. But Firmetaria is said to be active?
Maybe the true answer here is that the Firmetaria is mislabeled,
the fruits only contain trace amounts, and the original finding is based on a observation of the mycelium bruising. The guy who originally makes the taxonomy just erronously extrapolates that since the mycelium bruised, the frutis would contain psilocybin/psilocin.
I'll do a definitive bruise check, by looking for blue bruising on the firmetaria shoebox still fruiting.
with the miraculix test we then should have definitive answers whether or not there is *any* presence of psilocybin or psilocybin, in the mycelium or fruits
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (04/06/22 03:28 PM)
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
smalltalk_canceled said:
The prints from the december-now shoebox are sent to alan, who labels it semlanceata based on the microscopy that he and the other guy did.
Then we wait for the DNA test, the DNA test says its Psilocybe Firmetaria
The fruits are not perceived as active by microdosing by me, or the guy who ate the plate dinner. But Firmetaria is said to be active?
Maybe the true answer here is that the Firmetaria is mislabeled,
the fruits only contain trace amounts, and the original finding is based on a observation of the mycelium bruising. The guy who originally makes the taxonomy just erronously extrapolates that since the mycelium bruised, the frutis would contain psilocybin/psilocin.
I'll do a definitive bruise check, by looking for blue bruising on the firmetaria shoebox still fruiting.
with the miraculix test we then should have definitive answers whether or not there is *any* presence of psilocybin or psilocybin, in the mycelium or fruits
You can't gauge potency by microdosing. You'll have to consume 1 gram dried, and of course do the Miraculix test if you have it on hand.
P. fimetaria potency is supposedly on level with P. semilanceata.
Both species have very similar microscopic attributes, and can have quite similar appearance in the wild.
Perhaps you should contact the finder of the Scottish collection which matched your cultivar, and ask
if he's tested them for alkaloid content at all.
--------------------
★★★★★
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
Quote:
smalltalk_canceled said:
Did someone suggest it in the thread? I'll have to check
Yeah, I did, but not until page 3 
|
DH42
Local to somewhere
Registered: 10/05/20
Posts: 92
Loc: Scotland 
Last seen: 14 days, 1 hour
|
|
Hey Smalltalk
Really great news that you have successfully managed to cultivate P.fimetaria! As far as I know this is the first time it has been done.
There is very little / no research on the potency of Fimetaria, aside from people's own experiences, and these experiences vary greatly. Some people report them having almost no effect, whilst some have said they were easily as strong as P.semilanceata. This is one of the main things about Fimetaria I am trying to understand. I initially thought it was something to do with the substrate from which it grows, perhaps with cow dung producing weaker specimens and horse manure stronger. However, it may be to do with different climatic conditions somewhere along its growth cycle, different populations lacking/having the correct enzyme, etc. More research needed - I have not managed to have any of my collection's alkaloid content tested - yet.
(I believe this should also address Anglerfish's comment about Fims being the same strength as Semis)
Also, which part of https://www.shroomery.org/12504/Psilocybe-fimetaria were you refering to when you said it needs an update?
Could you clarify what you mean about your Fims fruiting in a circle? Did you mean they did or they didn't? I had initially removed where it says they 'often fruit in large rings' from the Shroomery fimetaria page, because I had seen no evidence of it in the wild - and because it is a direct quote from Stamets' 'Psilocybin Mushrooms of the World', within which the information on Fimetaria is very inaccurate. This confirmed to me that the statements in the wikis might not have any grounding in reality. I had forgotten to change the information on the main Wikipedia page until you mentioned it just there.
Going back to the subject of psilocybin/psilocin content, I suspect that the traditional bruise test might not work on Fims. The subject of blue bruising in Fims is linked to the potency debate and, again, very little hard research has been done on it.
Roy Watling writes that the bluing effect was noted, but was variable. He told me verbatim that 'it only blues slightly on the stem'. However, I wonder how much even he has field experience with this specific species, perhaps not a great deal.
Looking back on my notes just now I found that there must have been some form of chemical analysis of Fimetaria: in 1967, Benedict et al (I'm not sure who they are) found Psilocybin to be present in Fimetaria, but not Psilocin.
Could I also ask what substrate have you used to grow the Fims on, and what temps did you find worked?
Well done, you have done some really great work!
p.s. I would love it if you could share some of the pics/info of your efforts to the subreddit r/fimetaria, the purpose of which is to be a focused knowledge/information/picture etc base dedicated to only P.fimetaria! However, I totally understand if you wish to keep it on Shroomery
--------------------
Have a look at the subreddit r/fimetaria!
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: DH42] 1
#27724552 - 04/07/22 12:50 PM (2 years, 9 days ago) |
|
|
ill post a copy of the summary to the firmataria reddit when I have done the miraculix test. Thank you for your post, it was interesting to read.
as for the circle, i just noticed that they sidepinned :P they fruited in a circular manner around the gaps, but thats normal for substrates where the conditions become superior around the gap
i believe we cannot say anything about this, and for safety i suspect the good decision is to remove this, as we dont have any shroomery specific credentials afaik to documentate it, and these pictures are not hard proof in any way.
they grew very well on corn + coir, they pinned outside in a flowerpot during rainy norwegian autumn when temps were below 10C
they also pinned in a small shoebox, inside a unheated garage during the winter months, first pins fruiting around middle-late december, at just above freezing temps, and still fruiting now in april, which is pretty impressive to me. few subs last that long in the halls of smalltalk
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (04/07/22 12:59 PM)
|
DH42
Local to somewhere
Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 14 days, 1 hour
|
|
Those are great pics, especially the first two. They're fruiting so ferociously, it's great to see. I suspect you are right about the conditions around the edge of the box being more preferable for fruiting; it makes a lot more sense, considering the lack of evidence of rings in the field. Again, I strongly believe we should take what Stamets says about P.fimetaria in the aforementioned book with a grain of salt (no disrespect to Stamets at all, I'm only talking about Fimetaria).
I look forward to hearing the results of the miraculix test. Whatever the result, it will tell us something.
Did you find the mycelium was aggressive at all? Any trouble with mould in the sub-10 degree weather?
--------------------
Have a look at the subreddit r/fimetaria!
|
rhizoRider
Mycorrhizally expanding
Registered: 12/24/13
Posts: 2,321
|
Re: P firmetaria cultivation - Smalltalk [Re: DH42]
#27725101 - 04/07/22 10:07 PM (2 years, 9 days ago) |
|
|
 Missed those pics before, will be a image I never forget
Wow impressive  smalltalkcancel
--------------------
|
semilancreator
Stranger
Registered: 03/24/21
Posts: 59
Last seen: 3 minutes, 45 seconds
|
Re: P firmetaria cultivation - Smalltalk [Re: rhizoRider]
#27725492 - 04/08/22 10:05 AM (2 years, 9 days ago) |
|
|
Very impressive! You beat me to it 
But ffs call it by the proper name...Fimetaria....not Firmetaria
|
semilancreator
Stranger
Registered: 03/24/21
Posts: 59
Last seen: 3 minutes, 45 seconds
|
Re: P firmetaria cultivation - Smalltalk [Re: semilancreator] 1
#27725498 - 04/08/22 10:11 AM (2 years, 9 days ago) |
|
|
Also not to long ago i did test fimetaria. Came out in the low .3ish
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
hey im still lernin
--------------------
Willpower is the one true virtue
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
semilancreator said:
Also not to long ago i did test fimetaria. Came out in the low .3ish
Okay, so way below libs then. Or more like libs not that potent. They do exist, after all. Huge variety.
--------------------
★★★★★
|
RenegadeMycologist
On the case
Registered: 12/05/20
Posts: 3,818
Loc: Serbia
Last seen: 3 hours, 32 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: Anglerfish]
#27731107 - 04/12/22 07:41 AM (2 years, 5 days ago) |
|
|
Would you look at that
--------------------
l e a r n i n g t h i n g s
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
RenegadeMycologist said:
Would you look at that
Hey Renegade, good to see you around!
--------------------
★★★★★
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 12 hours, 45 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: Anglerfish]
#27738022 - 04/16/22 11:54 PM (2 years, 10 hours ago) |
|
|
|
DH42
Local to somewhere
Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 14 days, 1 hour
|
|
Quote:
Alan Rockefeller said:
Sequence is now in Genbank: https://www.ncbi.nlm.nih.gov/nuccore/ON158811
Did you sequence only ITS, or LSU as well? I don't understand the Genbank language very well lol. I wonder if sequencing TEF1 and comparing it to my collection's sequence would be of any use? From what I gather, TEF1 can tell us more than ITS..? It may be interesting to see whether or not TEF1 shows a 100% match with the Scottish fimetaria.
--------------------
Have a look at the subreddit r/fimetaria!
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 12 hours, 45 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: DH42]
#27739271 - 04/17/22 07:35 PM (1 year, 11 months ago) |
|
|
I sequenced just ITS. I could do more genes, but ITS is usually the best for species level differentiation because the others tend to be more conserved, so there are less differences between species.
TEF1 would be a good second gene to do - do you have TEF1 data from your find?
|
DH42
Local to somewhere
Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 14 days, 1 hour
|
|
Yes we did extract TEF1. However, I only recently attached it to the Mushroom Observer post. I'll attach it below if it's of any use.
There is one other TEF1 sequence for P.fimetaria on GenBank, by Jan Borovička. Mine was 99.81% match with his. Off the top of my head, mine was a 100% match on ITS with a sample from France, I think uploaded by yourself.
TTGTCGGAGGGACGGACGGGGGGCTCGATGGCATCAATGGCGTCGAGGAGGGTCTTGCCCTTGACAACACCGGCCTTGGTCTCACGAGACCAACCCTTGAACCAGGGCATACTGGAAATAAAAATTTAGCAAGCGTCCACATGATTAGAAACAAAATCGCAGCTTACTTGACGGACTCCTCCAACATGTTGTCTCCGTGCCATCCGGAAATGGGGACGAAGGCGACGGTCTTGGGGTTGTAACCGACCTTCTTGATGAAGTTGGAAGTCTCCTTGACAATTTCATTGAAACGGTCTTCGGACCACTGCAAGAGTAGATTAAATAAAATTTTCAAATTTTCGGGTCAAGCAGAAAAAACCGACCTTGGTGGTGTCCATCTTGTTGACGGCGACAATAAGTTGTCGGACACCGAGGGTGAAGGCGAGGAGAGCGTGCTCGCGAGTCTGGCCATCCTTGGAGATACCAGCCTCGAACTCACCAGTTCCACCGGCGATGATGAGGATGGCACAATCAGCCTGGGAGGTACCGGTGATCATGTTCTTGATGAAATCACGATGTCCTGGGGCATCAATGACCTAAAAGAGTTTAATGTGGGTCTGATTAGATAACAGAGTAATGCAAGTTATGACTCACAGTGACCATGAACTTGGGGGTCTCGAACTTCCAGAGAGCGATATCGATGGTGATACCACGCTCACGCTCGGCCTTGAGCTTGTCAAGAACCCAGGCTAGAAAGAGAAAATTTTAACAAAAGTCGCTTGGACCACCAATGAAAAATTTTACACACCATACTTGAAGGAACCCTTTCCGAGTTCAGCAGCCTCCTTCTCGAATTTTCTCGAT
--------------------
Have a look at the subreddit r/fimetaria!
|
clampconnected
Researcher
Registered: 04/07/20
Posts: 57
Loc: Portland Oregon
Last seen: 18 hours, 46 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: DH42]
#27743792 - 04/20/22 02:53 PM (1 year, 11 months ago) |
|
|
Wow that’s pretty cool eh!
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: clampconnected] 1
#27750540 - 04/25/22 11:16 AM (1 year, 11 months ago) |
|
|
--------------------
Willpower is the one true virtue
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
How many flushes on this grow so far?
--------------------
★★★★★
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: Anglerfish]
#27750641 - 04/25/22 12:59 PM (1 year, 11 months ago) |
|
|
These are like five months now
--------------------
Willpower is the one true virtue
|
Anglerfish
hearing things
Registered: 09/08/10
Posts: 18,767
Loc: Norvegr
Last seen: 3 hours, 15 minutes
|
|
Quote:
smalltalk_canceled said:
These are like five months now
Wow. That's endurance. They look a bit exhausted, though. Reasonably enough.
--------------------
★★★★★
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: Anglerfish] 2
#27812336 - 06/09/22 03:12 PM (1 year, 10 months ago) |
|
|
Check out this!
These fimetarias are BRUISING blue - outdoor spawn
 
    
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (06/09/22 04:34 PM)
|
rhizoRider
Mycorrhizally expanding
Registered: 12/24/13
Posts: 2,321
|
|
Are you making prints man? Or wizard 🧙♂️ shud we say lol
Dang good job those look so neat and Medusa type cluster stem
Wow
--------------------
|
Bardy
Registered: 04/02/14
Posts: 2,635
Last seen: 4 hours, 50 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: rhizoRider] 1
#27812508 - 06/09/22 05:27 PM (1 year, 10 months ago) |
|
|
Nice work! They look beautiful.
Ps. Should correct the spelling mistake in the title of the thread so that people can find it easier via search.
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: rhizoRider]
#27813511 - 06/10/22 03:05 PM (1 year, 10 months ago) |
|
|
Quote:
rhizoRider said:
Are you making prints man? Or wizard 🧙♂️ shud we say lol
Dang good job those look so neat and Medusa type cluster stem
Wow
I want to spread these, so people can try to grow them easily on grains and coir, and then over time, we will see if this species can be domesticated into a decent potency mushroom.
I still have 30-40 prints from the ITS sequenced grow, if you want to spread them around, please take ten. I mean these are prints are pretty rare and unique right now in the world, even if their ultimate use isn't clearcut.
--------------------
Willpower is the one true virtue
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
I agree your latest ones are Psilocybe species, and most likely Psilocybe Fimitaria, but how can you be 100% certain they're P. Fimitaria? Maybe I'm just being a bit overly meticulous, but there are other Psilocybes that could possibly match the description, however unlikely. Could there possibly be dung in the substrate? Have you checked to see if they have a removable gelatinous gill edge (use a pin)? I'm sure you've probably mentioned it in the thread somewhere already, but could you remind us where in the world you are? Did you put some of your substrate from your grow out into your garden?
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: Duggstar]
#27813647 - 06/10/22 04:44 PM (1 year, 10 months ago) |
|
|
We can't be 100% sure.
Fimetaria is my own identification on these based on the burying spawn there from the semilanceata/fimetaria project and the fruits having strong similarity to the two past fimetaria fruitings.
But goddamn these fruits shock me every time. Theres the "gregarious fruiting" ones, there's the much slimmer shorter phenotype, and then there's these hispanica lookalikes?
Even if these fruits were ITS sequenced, the mystery eludes us.
Im working to secure more ITS sequencing, but its not exactly something cheap or trivial to come by for most of us.
One card is Alan returning to the chase, the other is this
company i'm in contact with that have a guy and the equipment.
No deal yet.
Im also doing a miraculix test of the bruising fruits at 150 mg really soon. Just cant prioritize this over fathering all these kids.
Something fishy is going on for sure, Duggstar.
Whats going on? What is the true species? Is there two semilanceatas, one like this, and the mythic one - is there really a p fimetaria? Is there really a p hispanica?
I m wondering aloud.
Im sure everyone is wondering with me.
TCs, friends, enemies and critics,
you may.
But as far as I understand, if p fimetaria has its own ITS sequence and identification, then it is some psilocybe that has a listing.
Thats what we have
--------------------
Willpower is the one true virtue
|
Duggstar
Registered: 01/20/09
Posts: 6,273
Loc: Ireland
Last seen: 1 year, 4 months
|
|
Quote:
Fimetaria is my own identification on these based on the burying spawn there from the semilanceata/fimetaria project and the fruits having strong similarity to the two past fimetaria fruitings.
If you buried your spawn there then it's reasonable to assume that these are P. fimetaria too. They're definitely not P. semilanceata.
|
knarkkorven
Entheoholic
Registered: 06/22/05
Posts: 1,709
Loc: Sweden
Last seen: 21 days, 20 hours
|
Re: P firmetaria cultivation - Smalltalk [Re: Duggstar]
#27814126 - 06/11/22 02:26 AM (1 year, 10 months ago) |
|
|
The lack of potency is intriguing... I mean, I see brusing on the stipes.
Perhaps high Psilocin/low psilocybin. Try eating fresh fruits.
|
DH42
Local to somewhere
Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 14 days, 1 hour
|
|
Quote:
smalltalk_canceled said:
Check out this!
These fimetarias are BRUISING blue - outdoor spawn
Hey Smalltalk,
Nice to see that fruiting outdoors. However, I'm surprised it is fruiting at this time of year? What are the climactic conditions?
Based on the above images alone, I would say 75% they are P.fimetaria. Look how similar they are to a cluster I found last year in amongst a lot of other Fims:
However, it should be noted that this single cluster looked different to all the other ones I found. Unfortunately I didn't take a sample as it would have been interesting to check its DNA against the other ones I found.
I think the most likely situation is that they are all P.fimetaria, but sometimes they just vary a bit in appearance.
The jury is still out on this one regardless..
--------------------
Have a look at the subreddit r/fimetaria!
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: DH42]
#27834489 - 06/24/22 01:25 PM (1 year, 9 months ago) |
|
|
Wow, thanks for sharing to the thread.
That's really useful to see!
Fat stems! Fruiting from dead grass/straw too?
Digested straw+manure? I cant really tell 100%.
I've been seeing appreciative growth from my fime cultures on Straw.
-
Yeah I'm stupified too about whether or not its a cold or hot fruiter, or both, since the semilanceata lookalike theory suggests it's a cold fruiter sharing biome.
Today was the hottest day yet so far in June, temps hitting 28C!
Yet I see the outdoor patch/location of the fimetarias produce new pins and spreading out.
Watering the spot daily so their survival is artificial.
Climactic conditions are that these were placed in ground in early-ish may, which had some close to 5-6C nights and ar least way colder than now, with only insignificant amounts of rain falling in this period.
They are definitely reliant on things generally being wet, if left outside dry and high FAE, they just wither and fail.
Perhaps those fruits you posted had the best of both worlds, perfect amount of FAE and enough humidity over time to both keep things damp and supply water in the ground.
These can recover from being dry, I've seen them go from dry to normal after soaking the spot.
As in seeing them dry, soaking the ground, and seeing them recover and look normal the day after.
Gonna try to print some of these outdoor ones and add them as a bonus to the 7 spore letters I'm sending out.
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (06/24/22 02:11 PM)
|
semilancreator
Stranger
Registered: 03/24/21
Posts: 59
Last seen: 3 minutes, 45 seconds
|
|
I think you nailed it on the head when you said the survival is artificial. I think the moisture is the key for Them to fruit and not so much the temperature. Or at least they seem to be able to fruit in quite a wide range of temps if the humidity/moisture level is on point.
Super cool to see this...shame they are so weak 
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: semilancreator] 3
#27839123 - 06/27/22 03:14 PM (1 year, 9 months ago) |
|
|
This year is partially about finding fimetaria myself, in my native country, which has no identified listing of it in its database, to possible prove that it physically exists here already.
Two goals possible: one, if the fimetaria is found and ITS sequenced locally, i have cultivated it, and proven its existence in my country in scandinavia,
a match also help solve (2) the source, supporting that it was from the semilancea lookalike found locally in my country and printed from the print sources i received where people sent me what they thought was semilanceata prints. And not from baba yaga.
Im thinking back on all the evidence, the data, the discussion,
also stoicly hoping that culture work from 2021
surviving from last year, as i have
found mycelial activity at spots where i buried stuff in 2021,
will fruit as either fimetaria or semilanceata
if these fruit as fimetaria, that supports it belonging here.
Im also looking back on my extreme collection of mushrom pictures, and I came over this. I do believe this is me picking a fruit locally.
Now, would you call this fimetaria or semilanceata?
Quote:
semilancreator said:
I think you nailed it on the head when you said the survival is artificial. I think the moisture is the key for Them to fruit and not so much the temperature. Or at least they seem to be able to fruit in quite a wide range of temps if the humidity/moisture level is on point.
Super cool to see this...shame they are so weak
we dont know anything about how weak or how strong they are, no realiable tests have been made. only two administrations of a small amount of fruit, mainly because of the very real consideration if they somehow magically were actually toxic.
a jar grow from the fimetaria project
Some dried fruits
The first flowerpot fruiting
The winter indoor shoebox
Man it looked good wtf are those? semilanceata-UFO-TAMPS?
The indoor garage shoebox shows the same look as the ones I picked
Be on the lookout for these until winter sets it:
(P. fimetaria pins outside)
Bottom row, same stripes, same color tendency as it dries
Unless the top image is erratic, I think
those who have heard of this project, will find it this year.
Looking forward to all the "is this semilanceata threads+pictures"
the coming autumn, looking for fimetara lookalikes and securing possibly prints or genetics from them, or finding them myself,
will close down the fimetaria project, and conclude what actually happened according to my theory anyways
The current ourdoor fruits rough state as i write this post:
--------------------
Willpower is the one true virtue
Edited by smalltalk_canceled (06/27/22 03:47 PM)
|
Dandurn777
Registered: 12/09/19
Posts: 1,573
|
|
So you’ve never tried them?
--------------------
Prying open my Allenii
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: Dandurn777]
#27839338 - 06/27/22 05:45 PM (1 year, 9 months ago) |
|
|
ive ate them once, a small dosage, fresh, from fruits that did not bruise, did not encounter anything discernable. id suggest it would be 0.2-15 dried.
--------------------
Willpower is the one true virtue
|
semilancreator
Stranger
Registered: 03/24/21
Posts: 59
Last seen: 3 minutes, 45 seconds
|
|
You know I did the miraculix test with it right? That's the only test done so dat afaik
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
Oh, is there a post? I must have overlooked or forgot it. One test on random fruits can't be held to gauge much, in my head. There may one can get s decent potency culture going
--------------------
Willpower is the one true virtue
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 12 hours, 45 minutes
|
|
Quote:
smalltalk_canceled said:
Now, would you call this fimetaria or semilanceata?
That is Psilocybe semilanceata.
|
DH42
Local to somewhere
Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 14 days, 1 hour
|
|
Smalltalk, in response to your initial questions, the likely Fims I posted above were growing out of cow dung. It is made up of mixed upland grasses (I have pictures of the grass it will be). Note P.fimetaria has never, to the best of my knowledge, been documented naturally growing out of anything other than horse or cow manure.
Also I believe there has been P.fimetaria reported from Scandinavia before, it might have been Sweden..? I think somebody posted some last season on r/fimetaria. I'm not 100% sure, I'll have to check.
--------------------
Have a look at the subreddit r/fimetaria!
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: DH42]
#27842671 - 06/29/22 04:44 PM (1 year, 9 months ago) |
|
|
so you find them directly on manure, like p. subcoprophila? interesting.
i havent used manure for them at all at any point, so they are definitely capable in of living without artificially.
Here's norway, the neighbour of Swedens official lack of listing of observations/finds of it:
https://artskart.artsdatabanken.no/app/#map/427864,7623020/3/background/greyMap/filter/%7B%22TaxonIds%22%3A%5B38105%5D%2C%22IncludeSubTaxonIds%22%3Atrue%2C%22Found%22%3A%5B2%5D%2C%22Style%22%3A1%7D
Here's the sweden page:
https://artfakta.se/artbestamning/taxon/5705
There's six "observations of it", suggesting that it might
have been found in sweden. This, along with the garden fruiting,
weakly supports the theory that it might exist in norway and be rare
but biannual and natural and reproducing here.
The state sweden library uses those words about its proliferation in sweden, "stable residency and reproducing".
They might be wrong,
but if they arent,
this is interesting. I'll have to prepare a picture gallery of wild fimetaria pictures, to use in semilanceata identifaction threads 2022, to see if there can be a wild find other than if I find one myself.
--------------------
Willpower is the one true virtue
|
MysticMycologist
Dirt Sherpa
Registered: 10/14/21
Posts: 1,755
Loc: seeking samadhi
|
|
You believe them to be potentially toxic?
--------------------
Two eyes to look, One eye to see.
Prying open my third eye
|
DH42
Local to somewhere
Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 14 days, 1 hour
|
|
I'm not quite sure what you mean by P.subcoprophila...are you referring to Deconica coprophila? If so, then yet they seem to like the same substrate. I can't speak much for D.coproprophila though, as I have not got as much field experience with them.
I don't think P.fimetaria will grow naturally in anything other than manure. You have succeeded in getting it to grow in straw, but you have created a habitat for it, got spores / mycelium, cultivated and watered it. I think it will only grow naturally in dung as the livestock's ingestion of the spores and the development of the mycelium through the stages of the manure's decomposition is an intrinsic part of P.fimetaria's lifecycle. I believe this is probably the same for all coprophilous (psilocybe) fungi, in that if some spores blew onto some straw substrate mix, like you have yours growing on, it wouldn't grow and fruit. Hopefully someone more knowledgeable on the science side of things can fact check this thought
--------------------
Have a look at the subreddit r/fimetaria!
|
MentalPariah
Pariah of my mind
Registered: 03/18/18
Posts: 3,903
Last seen: 1 month, 8 days
|
Re: P firmetaria cultivation - Smalltalk [Re: DH42] 1
#27843724 - 06/30/22 11:35 AM (1 year, 9 months ago) |
|
|
Quote:
DH42 said:
I'm not quite sure what you mean by P.subcoprophila...are you referring to Deconica coprophila? If so, then yet they seem to like the same substrate. I can't speak much for D.coproprophila though, as I have not got as much field experience with them.
I don't think P.fimetaria will grow naturally in anything other than manure. You have succeeded in getting it to grow in straw, but you have created a habitat for it, got spores / mycelium, cultivated and watered it. I think it will only grow naturally in dung as the livestock's ingestion of the spores and the development of the mycelium through the stages of the manure's decomposition is an intrinsic part of P.fimetaria's lifecycle. I believe this is probably the same for all coprophilous (psilocybe) fungi, in that if some spores blew onto some straw substrate mix, like you have yours growing on, it wouldn't grow and fruit. Hopefully someone more knowledgeable on the science side of things can fact check this thought
I believe Alan said all psilocybe will in-fact grow from wood debris, I think he even has proof of some psilocybe cubensis in Texas growing in woodchip beds.... I could have misunderstood and this is anecdotal until confirmed or denied. While its probably unlikely it's also not impossible.
--------------------
Whoever appeals to the law against his
Fellow man is either a fool or a coward
Whoever cannot take care of himself without that law is both
For a wounded man shall say to his assailant
If I live I will kill you, if I die you are forgiven
Such is the rule of honor
|
FoggyDew
may contain nuts
Registered: 08/13/18
Posts: 600
Loc: Leinster, Ireland 
|
|
This thread though! Fascinating & entertaining reading to say the least. Always more to learn, debate over & discover in this hobby. Awesome grow Smalltalk!  
|
semilancreator
Stranger
Registered: 03/24/21
Posts: 59
Last seen: 3 minutes, 45 seconds
|
|
Somewhere in this thread I posted my miraculix test. It came out in the low 0.3's so very weak indeed.
You are right tho that the test doesn't say much since my base material is defintely a mixture of Both Fimetaria and its close relative Liniformans. However Since Stamets once allegedly tested liniformans which came in also very low and all the (anecdotal) ingestion reports I have collected report only the slightest effect at normal Cube dose, i think it is safe to assume they are supe low in potency.
This season I Will make the biggest en best documented Fimetaria/liniformans collection out there to Serve as a base for further research by people in the likes of Alan.
Also I have found fimetaria once (no pictures) one ground saturated with manure. So in a way they were growing from manure but in a way from the soil. Same goes for a friend of mine who finds Them in the grass where cows used to graze. I think if the ground is saturated enough with old dung there is a good chance that dunglovers Will grow in that soil
Cheers,
|
smalltalk_canceled
Babnik
Registered: 07/13/20
Posts: 2,904
Last seen: 18 hours, 51 minutes
|
|
10 days vacation + no watering killed and removed all signs of the outside fruits and mycelium, so throughly i couldnt even truly see
where the patch once was.
next update will be either
calls to identify wild specimens of fimetaria found locally
or, if rain during summer months produces fruits
or, if fruits show up autumn/winter from outside patches
OR if any of the 5-7 guys i sent fimetarias can get these going and reproduce that this is a psilocybe not very hard to grow!
good luck receivers of the giveaway, all other spore prints are now lost
because on top of fruits outside being destroyed by summer,
i have misplaced and lost both a baggie of weed and the last
of my fimetaria prints.
as far as i understand, the people who received the prints and the emergence of more fruits outside are the last hope for the propagation of this species on shroomery
thank you for the interest,
and have a nice winter
--------------------
Willpower is the one true virtue
|
scapo
Scientist
Registered: 11/05/22
Posts: 366
Loc: PNW
Last seen: 20 hours, 46 minutes
|
|
This thread is great, do we have any updates on the (potentially) wild Fimetaria?
|
scapo
Scientist
Registered: 11/05/22
Posts: 366
Loc: PNW
Last seen: 20 hours, 46 minutes
|
Re: P firmetaria cultivation - Smalltalk [Re: MentalPariah]
#28210270 - 03/01/23 08:53 PM (1 year, 1 month ago) |
|
|
I have proof of cubes growing on cardboard, and wood chips! Yes, they’ll grow on woody debris
|
|
Threaded
Previous
Index
Next
Edit 
Reply 
1 2 all )
optieklops
asd11
Wolfred
spores
psylosymonreturns
up_right